The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
NC_022351	Campylobacter jejuni subsp. jejuni 00-2538, complete sequence	1719369	252161	322079	1719369	protease,terminase,integrase,tRNA,capsid,plate,transposase,tail	Campylobacter_phage(46.15%)	88	266807:266826	295369:295388
WP_002857531.1|252161_253385_+|protease	ATP-dependent Clp protease ATP-binding subunit ClpX	protease	G3M9Z9	Bacillus_virus	54.7	6.8e-118
WP_002857495.1|253396_254437_+	rod shape-determining protein	NA	NA	NA	NA	NA
WP_002859838.1|254426_255176_+	rod shape-determining protein MreC	NA	NA	NA	NA	NA
WP_002894865.1|255436_258706_+	carbamoyl-phosphate synthase large subunit	NA	NA	NA	NA	NA
WP_002851686.1|258702_259125_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002896364.1|259125_260103_-	transaldolase	NA	NA	NA	NA	NA
WP_002920488.1|260102_260726_-	phosphoserine phosphatase SerB	NA	NA	NA	NA	NA
WP_002826355.1|260725_261247_-	purine-binding chemotaxis protein CheW	NA	Q56AR1	Bacillus_thuringiensis_phage	24.8	1.9e-05
WP_002926253.1|261251_263561_-	response regulator	NA	Q56AR1	Bacillus_thuringiensis_phage	26.0	1.3e-13
WP_002851778.1|263564_264521_-	chemotaxis protein CheV	NA	Q56AR1	Bacillus_thuringiensis_phage	31.2	4.5e-40
WP_074469048.1|264513_265131_-	UDP-2,3-diacylglucosamine diphosphatase	NA	NA	NA	NA	NA
WP_002858660.1|265281_265767_-	transcription elongation factor GreA	NA	NA	NA	NA	NA
WP_002858730.1|265778_266873_-	lipid-A-disaccharide synthase	NA	NA	NA	NA	NA
266807:266826	attL	CTTTTAAAACTTCTTTTAAA	NA	NA	NA	NA
WP_002857286.1|266969_267722_-	AcfC family glycoprotein adhesin PEB3	NA	NA	NA	NA	NA
WP_002854555.1|269409_270186_+	5'/3'-nucleotidase SurE	NA	A0A1B1ITZ2	uncultured_Mediterranean_phage	33.7	1.0e-34
WP_002860322.1|270175_270835_+|tRNA	tRNA cyclic N6-threonylcarbamoyladenosine(37) synthase TcdA	tRNA	S4VW33	Pandoravirus	28.2	2.3e-11
WP_002858683.1|270818_271277_+	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_002857482.1|271386_271767_-	aspartate 1-decarboxylase	NA	NA	NA	NA	NA
WP_002778123.1|271763_272612_-	pantoate--beta-alanine ligase	NA	NA	NA	NA	NA
WP_002783229.1|272622_273447_-	3-methyl-2-oxobutanoate hydroxymethyltransferase	NA	A0A0P0BXC9	Ostreococcus_lucimarinus_virus	39.5	1.6e-49
WP_002804146.1|273699_274398_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002804144.1|274397_275072_-	LexA family transcriptional regulator	NA	X2KRC9	Campylobacter_phage	32.1	9.8e-26
WP_002804142.1|275221_275422_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002876259.1|275418_277494_+|integrase,transposase	DDE-type integrase/transposase/recombinase	integrase,transposase	NA	NA	NA	NA
WP_002806833.1|277564_278488_+	AAA family ATPase	NA	A0A2H4JAW1	uncultured_Caudovirales_phage	24.5	3.9e-09
WP_002795448.1|278490_278682_+	DNA-directed RNA polymerase sigma-70 factor	NA	NA	NA	NA	NA
WP_002824157.1|278678_278864_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002791419.1|278922_279264_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002922653.1|279370_279856_+	host-nuclease inhibitor Gam family protein	NA	A0A2K9VGT9	Faecalibacterium_phage	33.3	8.4e-19
WP_002876317.1|279914_280877_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002784531.1|280873_281143_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002876316.1|281142_281835_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002876315.1|281831_282281_+	DUF1018 domain-containing protein	NA	NA	NA	NA	NA
WP_002873721.1|282327_282603_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002876312.1|282594_283266_-	endonuclease	NA	NA	NA	NA	NA
WP_002784523.1|283359_283644_+	DNA-binding protein	NA	NA	NA	NA	NA
WP_002872705.1|283765_283972_+	CJH_07325 family protein	NA	J9SI91	Campylobacter_phage	100.0	2.8e-32
WP_002872706.1|283958_284750_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002872707.1|284714_285692_-|tail	tail protein	tail	A0A219Y9Y2	Aeromonas_phage	25.7	6.2e-13
WP_002784520.1|285685_285877_-|tail	tail protein X	tail	NA	NA	NA	NA
WP_002876309.1|285869_286244_-|tail	phage tail protein	tail	NA	NA	NA	NA
WP_002909482.1|286369_287608_-	hypothetical protein	NA	M4M9M5	Vibrio_phage	29.8	1.9e-19
WP_002872709.1|287609_288980_-	DUF935 family protein	NA	A0A2H4JHL1	uncultured_Caudovirales_phage	26.6	4.5e-17
WP_002875116.1|288989_290660_-|terminase	phage terminase large subunit	terminase	H1ZZE1	Pseudomonas_virus	41.4	3.0e-92
WP_002803360.1|290659_291259_-	DUF1804 family protein	NA	NA	NA	NA	NA
WP_002855185.1|291251_291710_-	DUF1320 family protein	NA	NA	NA	NA	NA
WP_002876307.1|291825_292803_-|capsid	major capsid protein	capsid	R9TRN2	Rhizobium_phage	23.4	5.6e-06
WP_002875114.1|292805_293333_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002876306.1|293335_294151_-	hypothetical protein	NA	A0A2H4JAW3	uncultured_Caudovirales_phage	48.4	2.9e-24
WP_002784501.1|294152_294587_-	hypothetical protein	NA	NA	NA	NA	NA
WP_021034186.1|294735_295125_+	DUF882 domain-containing protein	NA	A0A1X9Q0V8	Human_gokushovirus	46.7	1.7e-22
WP_002854893.1|295135_295477_+	hypothetical protein	NA	NA	NA	NA	NA
295369:295388	attR	TTTAAAAGAAGTTTTAAAAG	NA	NA	NA	NA
WP_021036343.1|295473_295722_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002784492.1|295833_296148_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002876443.1|296147_296780_+|plate	phage baseplate assembly protein V	plate	V5YUM9	Pseudomonas_phage	34.6	1.7e-08
WP_002784486.1|296788_296980_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002795239.1|296976_297267_+	GPW/gp25 family protein	NA	Q8H9N4	Vibrio_phage	40.8	2.7e-09
WP_002876444.1|297263_298430_+|plate	baseplate J/gp47 family protein	plate	Q8H9N3	Vibrio_phage	24.6	3.0e-14
WP_002855112.1|298426_299047_+|tail	phage tail protein I	tail	A7YH02	Campylobacter_phage	100.0	8.7e-61
WP_002875274.1|299046_300078_+|tail	phage tail protein	tail	A7YGA7	Campylobacter_phage	100.0	2.5e-190
WP_002875277.1|300102_300609_+	DUF4376 domain-containing protein	NA	A7YGA6	Campylobacter_phage	100.0	2.0e-87
WP_002922150.1|300605_300977_+	DUF1353 domain-containing protein	NA	A7YGA5	Campylobacter_phage	100.0	8.8e-69
WP_021034188.1|301076_302090_+	hypothetical protein	NA	A7YGA4	Campylobacter_phage	100.0	2.7e-192
WP_002922156.1|302100_303294_+|tail	tail sheath protein	tail	A7YGA3	Campylobacter_phage	100.0	5.0e-198
WP_002865376.1|303320_303830_+|tail	phage major tail tube protein	tail	A7YG76	Campylobacter_phage	100.0	3.3e-90
WP_002843342.1|303982_304222_+|tail	phage tail assembly protein	tail	A7YGZ3	Campylobacter_phage	62.5	3.2e-11
WP_002784655.1|304333_304639_-	hypothetical protein	NA	A7YG98	Campylobacter_phage	100.0	4.7e-36
WP_002875579.1|304680_306903_+|tail	phage tail tape measure protein	tail	A7YG97	Campylobacter_phage	100.0	0.0e+00
WP_002875578.1|306906_307395_+	phage virion morphogenesis protein	NA	A7YG96	Campylobacter_phage	100.0	1.6e-89
WP_002922158.1|307499_308315_+	DNA adenine methylase	NA	A7YG95	Campylobacter_phage	100.0	6.3e-152
WP_019109140.1|308342_308630_-	hypothetical protein	NA	A7YG94	Campylobacter_phage	100.0	1.9e-47
WP_002875224.1|308709_308904_-	hypothetical protein	NA	A7YG72	Campylobacter_phage	98.4	5.1e-28
WP_002865000.1|308913_309234_-	hypothetical protein	NA	A7YGI4	Campylobacter_phage	100.0	1.3e-52
WP_019108975.1|309314_309944_-	S24 family peptidase	NA	A7YGK7	Campylobacter_phage	100.0	2.6e-60
WP_002783228.1|312220_312994_+	OXA-61 family class D beta-lactamase OXA-193	NA	NA	NA	NA	NA
WP_002816233.1|313078_313963_-	sulfate/molybdate ABC transporter ATP-binding protein	NA	G3M9Y6	Bacillus_virus	36.5	2.2e-25
WP_002857391.1|313959_314634_-	molybdate ABC transporter permease subunit	NA	NA	NA	NA	NA
WP_002857328.1|314626_315028_-	molybdenum-pterin-binding protein	NA	NA	NA	NA	NA
WP_002857589.1|315024_315774_-	molybdate ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_002816240.1|315824_316511_-	malonyl-ACP O-methyltransferase BioC	NA	NA	NA	NA	NA
WP_002816243.1|316507_317119_-	DUF452 family protein	NA	NA	NA	NA	NA
WP_002816245.1|317115_318258_-	pyridoxal phosphate-dependent aminotransferase family protein	NA	V5LQ39	Emiliania_huxleyi_virus	26.8	2.2e-25
WP_002816247.1|318325_319609_+	adenosylmethionine--8-amino-7-oxononanoate transaminase	NA	NA	NA	NA	NA
WP_002816248.1|319595_320201_-	dethiobiotin synthase	NA	NA	NA	NA	NA
WP_002783223.1|320210_320525_-	multidrug efflux SMR transporter	NA	NA	NA	NA	NA
WP_002783219.1|320528_320867_-	multidrug efflux SMR transporter	NA	NA	NA	NA	NA
WP_002791314.1|321000_321537_+	50S ribosomal protein L25/general stress protein Ctc	NA	NA	NA	NA	NA
WP_002858659.1|321533_322079_+|tRNA	aminoacyl-tRNA hydrolase	tRNA	NA	NA	NA	NA
>prophage 2
NC_022351	Campylobacter jejuni subsp. jejuni 00-2538, complete sequence	1719369	1246733	1294731	1719369	head,protease,terminase,integrase,tRNA,portal,capsid,tail	Campylobacter_phage(94.64%)	64	1256360:1256377	1271459:1271476
WP_002858315.1|1246733_1247939_-|tRNA	tyrosine--tRNA ligase	tRNA	A0A1S6UA79	Serratia_phage	29.9	4.9e-28
WP_002858057.1|1247950_1250146_-	bifunctional (p)ppGpp synthetase/guanosine-3',5'-bis(diphosphate) 3'-pyrophosphohydrolase	NA	A0A1B1IUF0	uncultured_Mediterranean_phage	44.0	1.4e-07
WP_002853464.1|1250129_1250354_-	DNA-directed RNA polymerase subunit omega	NA	NA	NA	NA	NA
WP_002858454.1|1250364_1251084_-	UMP kinase	NA	NA	NA	NA	NA
WP_002853860.1|1251135_1252329_-	M23 family metallopeptidase	NA	NA	NA	NA	NA
WP_002853622.1|1252325_1253132_-	FtsX-like permease family protein	NA	NA	NA	NA	NA
WP_002853534.1|1253118_1253784_-	ABC transporter ATP-binding protein	NA	G3M9Y6	Bacillus_virus	34.8	2.8e-17
WP_002858203.1|1253853_1255032_-|tRNA	tRNA (guanosine(46)-N7)-methyltransferase TrmB	tRNA	NA	NA	NA	NA
WP_014516824.1|1255031_1256267_-	fibronectin type III domain-containing protein	NA	NA	NA	NA	NA
WP_002858282.1|1256211_1257180_-	RluA family pseudouridine synthase	NA	NA	NA	NA	NA
1256360:1256377	attL	ATAAAATACAAAAAATAA	NA	NA	NA	NA
WP_002853654.1|1257257_1258358_+	rod shape-determining protein RodA	NA	NA	NA	NA	NA
WP_002787311.1|1258696_1259872_+|integrase	site-specific integrase	integrase	X2KXI6	Campylobacter_phage	100.0	1.7e-222
WP_002787309.1|1259868_1260075_-	helix-turn-helix domain-containing protein	NA	X2KXB9	Campylobacter_phage	100.0	4.8e-32
WP_002787307.1|1260076_1260430_-	hypothetical protein	NA	X2KRB4	Campylobacter_phage	100.0	2.1e-56
WP_002787306.1|1260447_1261203_-	site-specific DNA-methyltransferase	NA	X2KR14	Campylobacter_phage	100.0	9.6e-147
WP_002787304.1|1261180_1261447_-	hypothetical protein	NA	X2KLR9	Campylobacter_phage	100.0	4.7e-40
WP_002858334.1|1261430_1261802_-	hypothetical protein	NA	X2KQ09	Campylobacter_phage	100.0	1.2e-60
WP_011049924.1|1261802_1262027_-	hypothetical protein	NA	X2KXC3	Campylobacter_phage	100.0	4.1e-37
WP_002869676.1|1262035_1262797_-	hypothetical protein	NA	X2KQ45	Campylobacter_phage	99.5	4.0e-124
WP_002787295.1|1262733_1263048_-	hypothetical protein	NA	X2KR17	Campylobacter_phage	100.0	1.6e-50
WP_002787293.1|1263126_1263447_-	hypothetical protein	NA	X2KLS2	Campylobacter_phage	100.0	1.4e-51
WP_002787289.1|1263834_1264071_-	hypothetical protein	NA	X2KXC5	Campylobacter_phage	100.0	8.1e-36
WP_002787287.1|1264084_1264852_-	hypothetical protein	NA	X2KRC2	Campylobacter_phage	100.0	3.7e-138
WP_002787283.1|1264989_1265220_-	hypothetical protein	NA	X2KLS5	Campylobacter_phage	100.0	5.0e-38
WP_002787281.1|1265185_1265449_-	hypothetical protein	NA	X2KQ17	Campylobacter_phage	100.0	4.1e-44
WP_002787279.1|1265505_1265793_-	hypothetical protein	NA	X2KXC8	Campylobacter_phage	100.0	2.4e-50
WP_011049928.1|1265845_1266577_-	phage antirepressor KilAC domain-containing protein	NA	X2KRC4	Campylobacter_phage	100.0	2.8e-127
WP_002912332.1|1267007_1267292_-	hypothetical protein	NA	X2KLS8	Campylobacter_phage	100.0	4.5e-41
WP_002870299.1|1267288_1267492_-	hypothetical protein	NA	X2KQ19	Campylobacter_phage	100.0	4.8e-29
WP_002870336.1|1267696_1268350_+	hypothetical protein	NA	X2KXC9	Campylobacter_phage	100.0	1.2e-113
WP_002870274.1|1268584_1269247_+	S24/S26 family peptidase	NA	X2KRC9	Campylobacter_phage	100.0	4.2e-122
WP_011049930.1|1269252_1269906_+	DNA/RNA non-specific endonuclease	NA	X2KR27	Campylobacter_phage	100.0	9.3e-122
WP_002870263.1|1269922_1270204_+	PLDc N-terminal domain-containing protein	NA	X2KLT3	Campylobacter_phage	100.0	9.3e-47
WP_002913413.1|1270217_1270415_-	hypothetical protein	NA	X2KQ22	Campylobacter_phage	100.0	4.4e-27
WP_002870261.1|1270332_1270752_-	hypothetical protein	NA	X2KXD3	Campylobacter_phage	100.0	2.9e-52
WP_002870260.1|1270980_1271442_-	hypothetical protein	NA	X2KRD2	Campylobacter_phage	100.0	1.4e-84
WP_002788854.1|1271490_1272774_-	hypothetical protein	NA	X2KLT6	Campylobacter_phage	100.0	1.6e-239
1271459:1271476	attR	TTATTTTTTGTATTTTAT	NA	NA	NA	NA
WP_019108750.1|1272770_1273145_-	DUF1353 domain-containing protein	NA	X2KQ25	Campylobacter_phage	100.0	1.2e-68
WP_002869963.1|1273137_1273521_-	hypothetical protein	NA	X2KXD5	Campylobacter_phage	100.0	2.4e-61
WP_002789149.1|1273517_1274153_-	DUF4376 domain-containing protein	NA	X2KRD7	Campylobacter_phage	100.0	1.3e-96
WP_002798141.1|1274165_1274615_-	hypothetical protein	NA	X2KR34	Campylobacter_phage	100.0	4.6e-80
WP_011049933.1|1274616_1276182_-	hypothetical protein	NA	X2KLU0	Campylobacter_phage	100.0	3.3e-210
WP_002869967.1|1276174_1276807_-	hypothetical protein	NA	X2KQ29	Campylobacter_phage	100.0	6.0e-110
WP_002788295.1|1276803_1277121_-|head,tail	head-tail adaptor protein	head,tail	X2KXD7	Campylobacter_phage	100.0	9.2e-51
WP_002788293.1|1277133_1277571_-|head,tail	phage gp6-like head-tail connector protein	head,tail	X2KR38	Campylobacter_phage	100.0	1.8e-76
WP_002788291.1|1277567_1277819_-	hypothetical protein	NA	X2KLU2	Campylobacter_phage	100.0	3.7e-18
WP_002788288.1|1277829_1278996_-|capsid	phage major capsid protein	capsid	X2KQ31	Campylobacter_phage	100.0	2.8e-214
WP_002788287.1|1279012_1279570_-|head,protease	HK97 family phage prohead protease	head,protease	X2KXE1	Campylobacter_phage	100.0	1.1e-96
WP_002788286.1|1279655_1280525_-	hypothetical protein	NA	X2KRE5	Campylobacter_phage	100.0	3.9e-168
WP_019108749.1|1280537_1286237_-	hypothetical protein	NA	X2KR41	Campylobacter_phage	100.0	0.0e+00
WP_002788283.1|1286296_1286635_+	hypothetical protein	NA	X2KLU6	Campylobacter_phage	100.0	1.6e-56
WP_002788282.1|1286626_1286842_-	hypothetical protein	NA	X2KXE3	Campylobacter_phage	100.0	2.2e-32
WP_002788281.1|1286922_1287279_-	hypothetical protein	NA	X2KRE9	Campylobacter_phage	100.0	1.8e-58
WP_002788279.1|1287275_1288256_-	hypothetical protein	NA	X2KR44	Campylobacter_phage	100.0	3.9e-180
WP_002869970.1|1288402_1288627_+	hypothetical protein	NA	X2KLV0	Campylobacter_phage	100.0	5.7e-31
WP_002869971.1|1288623_1288887_+	type II toxin-antitoxin system RelE/ParE family toxin	NA	X2KQ37	Campylobacter_phage	100.0	2.9e-34
WP_002788276.1|1288874_1289225_-	hypothetical protein	NA	X2KXE7	Campylobacter_phage	100.0	7.3e-57
WP_002800770.1|1289225_1289768_-	HK97 gp10 family phage protein	NA	X2KRF4	Campylobacter_phage	100.0	5.7e-93
WP_002788272.1|1289764_1290937_-|portal	phage portal protein	portal	X2KR48	Campylobacter_phage	100.0	3.1e-216
WP_002913302.1|1291096_1291531_-	type II toxin-antitoxin system PemK/MazF family toxin	NA	X2KLV2	Campylobacter_phage	100.0	2.4e-78
WP_002913304.1|1291585_1293211_-|terminase	terminase large subunit	terminase	X2KQ40	Campylobacter_phage	100.0	0.0e+00
WP_002913306.1|1293214_1293853_-|terminase	P27 family phage terminase small subunit	terminase	X2KXE9	Campylobacter_phage	100.0	1.9e-111
WP_002869973.1|1294103_1294454_-	HNH endonuclease	NA	X2KRF8	Campylobacter_phage	100.0	1.9e-65
WP_002788257.1|1294440_1294731_-	hypothetical protein	NA	X2KM44	Campylobacter_phage	97.4	2.6e-15
>prophage 3
NC_022351	Campylobacter jejuni subsp. jejuni 00-2538, complete sequence	1719369	1436111	1442747	1719369		Tupanvirus(16.67%)	8	NA	NA
WP_002857908.1|1436111_1436777_-	D-glycero-D-manno-heptose 1-phosphate guanosyltransferase	NA	A0A2K9L821	Tupanvirus	26.6	4.1e-08
WP_002857991.1|1436764_1437370_-	D-sedoheptulose 7-phosphate isomerase	NA	A0A067XQR2	Caulobacter_phage	35.0	2.2e-16
WP_002858413.1|1437357_1438377_-	D-glycero-D-manno-heptose 7-phosphate kinase	NA	A0A222YW25	Synechococcus_phage	40.7	2.7e-59
WP_002857889.1|1438396_1439248_-	FkbM family methyltransferase	NA	NA	NA	NA	NA
WP_002858299.1|1439266_1440208_-	NAD-dependent epimerase/dehydratase	NA	A0A0F7LC08	uncultured_marine_virus	46.1	1.0e-73
WP_002864205.1|1440231_1441272_-	GDP-L-fucose synthase	NA	M1HWW2	Paramecium_bursaria_Chlorella_virus	44.4	1.7e-69
WP_002864204.1|1441271_1442198_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002858190.1|1442201_1442747_-	dTDP-4-dehydrorhamnose 3,5-epimerase family protein	NA	A0A1D8EQH2	Escherichia_phage	32.4	6.1e-18
