The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
NZ_CP012883	Klebsiella pneumoniae KP-1 chromosome, complete genome	5180925	907733	914638	5180925	tRNA	Bacillus_phage(33.33%)	6	NA	NA
WP_004149058.1|907733_909212_+	two-component system sensor histidine kinase BaeS	NA	W8CYF6	Bacillus_phage	28.3	8.5e-30
WP_004175198.1|909208_909931_+	two-component system response regulator BaeR	NA	W8CYM9	Bacillus_phage	33.2	8.3e-31
WP_021440458.1|910249_911611_+|tRNA	tRNA 5-hydroxyuridine modification protein YegQ	tRNA	Q6DW11	Phage_TP	94.5	3.9e-207
WP_004151134.1|911853_912750_+	lipid kinase YegS	NA	A0A1V0SBJ0	Catovirus	29.8	6.1e-15
WP_004180550.1|912990_913764_-	ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	36.7	3.9e-26
WP_004180551.1|913774_914638_-	ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	27.5	5.7e-10
>prophage 2
NZ_CP012883	Klebsiella pneumoniae KP-1 chromosome, complete genome	5180925	3877781	3921940	5180925	terminase,tRNA,plate	Salmonella_phage(32.56%)	64	NA	NA
WP_004143010.1|3877781_3879167_+|tRNA	cysteine--tRNA ligase	tRNA	M1PG92	Moumouvirus	35.4	3.5e-46
WP_004143016.1|3879212_3879425_-	ribosome-associated protein YbcJ	NA	NA	NA	NA	NA
WP_004143017.1|3879426_3880293_-	bifunctional methylenetetrahydrofolate dehydrogenase/methenyltetrahydrofolate cyclohydrolase FolD	NA	A0A249XZQ2	Enterococcus_phage	34.8	1.3e-30
WP_004151317.1|3881764_3882100_-	excisionase family DNA-binding protein	NA	NA	NA	NA	NA
WP_021441324.1|3882101_3882320_-	TraR/DksA family transcriptional regulator	NA	A0A0K2FI84	Escherichia_phage	52.2	7.6e-12
WP_032428565.1|3882316_3882991_-	hypothetical protein	NA	R9VWB9	Serratia_phage	53.0	4.8e-57
WP_032428566.1|3882983_3883328_-	hypothetical protein	NA	NA	NA	NA	NA
WP_032428567.1|3883324_3883549_-	hypothetical protein	NA	A0A286S2B3	Klebsiella_phage	55.4	4.0e-16
WP_123640128.1|3883780_3884002_-	hypothetical protein	NA	NA	NA	NA	NA
WP_021441326.1|3884074_3884368_-	host cell division inhibitory peptide Kil	NA	NA	NA	NA	NA
WP_021441327.1|3884360_3884486_-	hypothetical protein	NA	NA	NA	NA	NA
WP_160124493.1|3884795_3884972_-	hypothetical protein	NA	NA	NA	NA	NA
WP_032428569.1|3885212_3885845_-	helix-turn-helix domain-containing protein	NA	A0A1I9KG86	Aeromonas_phage	36.9	1.1e-34
WP_032428570.1|3885943_3886165_+	helix-turn-helix domain-containing protein	NA	Q716D6	Shigella_phage	55.7	8.2e-14
WP_032428571.1|3886204_3886525_+	hypothetical protein	NA	A0A0M4RU01	Salmonella_phage	68.9	3.8e-36
WP_023312759.1|3886720_3886975_+	hypothetical protein	NA	NA	NA	NA	NA
WP_032428573.1|3886971_3888021_+	hypothetical protein	NA	K7PLZ7	Enterobacterial_phage	45.7	4.6e-30
WP_021441329.1|3888047_3888443_+	hypothetical protein	NA	NA	NA	NA	NA
WP_023158880.1|3888442_3888664_+	hypothetical protein	NA	NA	NA	NA	NA
WP_021441330.1|3888656_3889448_+	hypothetical protein	NA	A4JX52	Burkholderia_virus	51.3	1.1e-63
WP_032428574.1|3889787_3890168_+	HNH endonuclease	NA	K7P7B7	Enterobacteria_phage	93.6	2.5e-63
WP_032428575.1|3890164_3891109_+	DUF551 domain-containing protein	NA	A0A248SKW5	Klebsiella_phage	95.0	5.2e-49
WP_032428576.1|3891193_3891433_+	hypothetical protein	NA	G8C7S3	Escherichia_phage	53.4	3.9e-09
WP_032428578.1|3891514_3891754_+	hypothetical protein	NA	NA	NA	NA	NA
WP_021441332.1|3891753_3892011_+	DNA polymerase III subunit theta	NA	G8C7V1	Escherichia_phage	72.7	1.1e-25
WP_135661363.1|3892030_3892309_+	hypothetical protein	NA	NA	NA	NA	NA
WP_032428579.1|3892832_3893141_+	DUF968 domain-containing protein	NA	Q6V7S4	Burkholderia_virus	56.5	3.5e-23
WP_077264210.1|3893133_3893793_+	phage N-6-adenine-methyltransferase	NA	Q8HA94	Salmonella_phage	80.0	6.3e-102
WP_032428580.1|3893789_3894368_+	DUF1133 family protein	NA	A0A0U2S606	Escherichia_phage	56.1	5.4e-49
WP_032428581.1|3894544_3894916_-	hypothetical protein	NA	NA	NA	NA	NA
WP_032428582.1|3894917_3895124_-	hypothetical protein	NA	NA	NA	NA	NA
WP_032428583.1|3895538_3896336_+	hypothetical protein	NA	NA	NA	NA	NA
WP_048964767.1|3896492_3896813_+	hypothetical protein	NA	O64361	Escherichia_phage	51.1	3.1e-22
WP_032428584.1|3896796_3897321_+	lysozyme	NA	I6PBN2	Cronobacter_phage	61.7	4.2e-48
WP_032428586.1|3897317_3897707_+	DUF2570 domain-containing protein	NA	A0A192Y6H8	Salmonella_phage	48.4	2.6e-23
WP_021441335.1|3898188_3898677_+	hypothetical protein	NA	NA	NA	NA	NA
WP_021441336.1|3898627_3900028_+|terminase	PBSX family phage terminase large subunit	terminase	A0A077KAW0	Edwardsiella_phage	69.2	7.2e-188
WP_032428591.1|3900265_3901717_+	DUF1073 domain-containing protein	NA	A0A0M4S6U1	Salmonella_phage	68.8	3.8e-192
WP_032428680.1|3901772_3902321_+	phage Mu F like family protein	NA	A0A0M4REK0	Salmonella_phage	56.9	1.0e-49
WP_032428593.1|3902372_3903575_+	DUF2213 domain-containing protein	NA	A0A0M4R5A6	Salmonella_phage	54.1	2.0e-109
WP_032428595.1|3903578_3904073_+	hypothetical protein	NA	A0A2H4JHM9	uncultured_Caudovirales_phage	62.7	9.3e-50
WP_032428597.1|3904084_3905026_+	DUF2184 domain-containing protein	NA	A0A2H4J191	uncultured_Caudovirales_phage	77.1	3.0e-137
WP_021441342.1|3905065_3905347_+	hypothetical protein	NA	NA	NA	NA	NA
WP_023284784.1|3905315_3905735_+	DUF4054 domain-containing protein	NA	A0A0M5M3S2	Salmonella_phage	60.7	9.7e-40
WP_021312707.1|3905731_3906238_+	hypothetical protein	NA	NA	NA	NA	NA
WP_009652660.1|3906237_3906642_+	hypothetical protein	NA	A0A2H4J1A4	uncultured_Caudovirales_phage	71.5	1.1e-43
WP_064144275.1|3906634_3907186_+	hypothetical protein	NA	A0A2H4J1A0	uncultured_Caudovirales_phage	44.9	1.5e-40
WP_021441344.1|3907187_3908339_+	DUF3383 family protein	NA	A0A0M4RD26	Salmonella_phage	81.5	1.6e-177
WP_025269949.1|3908349_3908790_+	DUF3277 family protein	NA	A0A0M5M1K6	Salmonella_phage	79.5	2.1e-61
WP_032428602.1|3908793_3909213_+	hypothetical protein	NA	A0A2H4J2V6	uncultured_Caudovirales_phage	65.2	8.8e-41
WP_016244729.1|3909254_3909407_+	hypothetical protein	NA	A0A2H4J1A2	uncultured_Caudovirales_phage	84.0	1.4e-17
WP_021441346.1|3909396_3911313_+	hypothetical protein	NA	A0A0M4REK7	Salmonella_phage	58.4	3.3e-199
WP_032428603.1|3911312_3911888_+	hypothetical protein	NA	A0A0M3ULD5	Salmonella_phage	66.5	3.8e-63
WP_077264211.1|3911963_3912191_+	hypothetical protein	NA	A0A2H4J495	uncultured_Caudovirales_phage	52.0	1.6e-17
WP_021441348.1|3912193_3913258_+	hypothetical protein	NA	A0A0M4QX01	Salmonella_phage	67.8	4.8e-136
WP_032428607.1|3913259_3913724_+	hypothetical protein	NA	NA	NA	NA	NA
WP_032428608.1|3913823_3914183_+	hypothetical protein	NA	NA	NA	NA	NA
WP_021441349.1|3914243_3914897_+	hypothetical protein	NA	A0A0M5M1K7	Salmonella_phage	59.1	1.6e-73
WP_032428611.1|3914898_3915252_+	bacteriophage protein	NA	A0A2H4J629	uncultured_Caudovirales_phage	79.5	1.9e-49
WP_032428612.1|3915251_3916451_+|plate	baseplate J/gp47 family protein	plate	A0A0M4RD32	Salmonella_phage	72.4	2.1e-156
WP_032428613.1|3916447_3917224_+	DUF2612 domain-containing protein	NA	A0A2H4J1A9	uncultured_Caudovirales_phage	56.5	8.8e-79
WP_071888015.1|3917223_3918129_+	hypothetical protein	NA	A0A1I9SEW2	Klebsiella_phage	59.4	1.7e-49
WP_071888016.1|3918128_3918314_+	hypothetical protein	NA	NA	NA	NA	NA
WP_148720654.1|3921112_3921940_+	hypothetical protein	NA	A0A0S1S106	Klebsiella_phage	52.0	3.5e-73
>prophage 3
NZ_CP012883	Klebsiella pneumoniae KP-1 chromosome, complete genome	5180925	4374389	4380728	5180925	integrase	Lactobacillus_prophage(33.33%)	7	4374298:4374315	4383649:4383666
4374298:4374315	attL	AGGCAACAAAAAACCCAT	NA	NA	NA	NA
WP_072271781.1|4374389_4375370_-|integrase	tyrosine-type recombinase/integrase	integrase	A0A218M4I3	Erwinia_phage	55.6	2.6e-96
WP_032428730.1|4375512_4375884_-	ASCH domain-containing protein	NA	Q6SE87	Lactobacillus_prophage	52.4	8.0e-30
WP_032411929.1|4375861_4376935_-	hypothetical protein	NA	Q6SE88	Lactobacillus_prophage	40.2	3.7e-67
WP_032411930.1|4376961_4378041_-	hypothetical protein	NA	NA	NA	NA	NA
WP_040211182.1|4378067_4378679_-	phage repressor protein CI	NA	A0A1S6KZZ7	Salmonella_phage	34.7	4.3e-28
WP_135696540.1|4379859_4380288_+	hypothetical protein	NA	F1BUJ7	Cronobacter_phage	82.6	7.5e-56
WP_072271780.1|4380308_4380728_+	hypothetical protein	NA	F1BUJ7	Cronobacter_phage	44.7	4.5e-13
4383649:4383666	attR	AGGCAACAAAAAACCCAT	NA	NA	NA	NA
>prophage 4
NZ_CP012883	Klebsiella pneumoniae KP-1 chromosome, complete genome	5180925	4418032	4427496	5180925	tRNA,protease	Dickeya_phage(16.67%)	8	NA	NA
WP_004191152.1|4418032_4419148_+	macrolide transporter subunit MacA	NA	A0A140XAI1	Dickeya_phage	52.7	1.3e-06
WP_004150848.1|4419144_4421085_+	macrolide ABC transporter ATP-binding protein/permease MacB	NA	G9BWD6	Planktothrix_phage	40.5	1.9e-37
WP_002896516.1|4421161_4421383_-	cold shock-like protein CspD	NA	A0A2H4N7Y6	Lake_Baikal_phage	61.2	1.3e-16
WP_002896520.1|4421708_4422026_+|protease	ATP-dependent Clp protease adapter ClpS	protease	A0A1B1IT64	uncultured_Mediterranean_phage	45.7	2.0e-13
WP_002896522.1|4422056_4424336_+|protease	ATP-dependent Clp protease ATP-binding subunit ClpA	protease	A0A223W0B1	Agrobacterium_phage	42.0	1.6e-165
WP_001040187.1|4424456_4424675_-	translation initiation factor IF-1	NA	NA	NA	NA	NA
WP_002898014.1|4425028_4425730_-|tRNA	leucyl/phenylalanyl-tRNA--protein transferase	tRNA	NA	NA	NA	NA
WP_021441487.1|4425774_4427496_-	cysteine/glutathione ABC transporter ATP-binding protein/permease CydC	NA	A0A2R8FG22	Brazilian_cedratvirus	34.3	1.5e-14
>prophage 5
NZ_CP012883	Klebsiella pneumoniae KP-1 chromosome, complete genome	5180925	4864667	4935904	5180925	plate,protease,head,holin,capsid,tail,portal,terminase,integrase	Klebsiella_phage(37.5%)	72	4862746:4862760	4871479:4871493
4862746:4862760	attL	AGTTGATCCTCTGGC	NA	NA	NA	NA
WP_019705447.1|4864667_4865429_+	SDR family oxidoreductase	NA	Q06VL0	Trichoplusia_ni_ascovirus	32.1	4.1e-20
WP_004183778.1|4865645_4867178_+	HD domain-containing protein	NA	A0A1B1ISR1	uncultured_Mediterranean_phage	30.0	8.8e-22
WP_016197745.1|4867376_4867925_-	DJ-1/PfpI family protein	NA	NA	NA	NA	NA
WP_019705445.1|4868121_4869303_+|integrase	site-specific integrase	integrase	A0A0M4QX09	Salmonella_phage	84.0	6.2e-201
WP_077255525.1|4869283_4869526_-	AlpA family transcriptional regulator	NA	A0A0M4RTZ2	Salmonella_phage	73.8	2.2e-20
WP_004198245.1|4869485_4869632_-	hypothetical protein	NA	A0A1B5FPC2	Escherichia_phage	70.8	2.9e-15
WP_023317663.1|4870165_4870390_-	hypothetical protein	NA	A0A286S2B3	Klebsiella_phage	90.5	1.8e-29
WP_032428838.1|4870379_4871105_-	Rha family transcriptional regulator	NA	A0A286S260	Klebsiella_phage	85.0	3.4e-109
WP_021441619.1|4871110_4871629_-	hypothetical protein	NA	A0A286S1S7	Klebsiella_phage	99.4	1.3e-94
4871479:4871493	attR	GCCAGAGGATCAACT	NA	NA	NA	NA
WP_023317661.1|4871669_4872110_-	hypothetical protein	NA	A0A286S1S2	Klebsiella_phage	78.1	1.2e-56
WP_004177206.1|4872296_4872551_-	hypothetical protein	NA	A0A286SGR4	Klebsiella_phage	92.9	2.5e-38
WP_023304721.1|4872543_4872909_-	hypothetical protein	NA	A0A286S1Q6	Klebsiella_phage	97.5	5.8e-57
WP_004177202.1|4872909_4873134_-	hypothetical protein	NA	NA	NA	NA	NA
WP_023317659.1|4873316_4873730_-	hypothetical protein	NA	NA	NA	NA	NA
WP_029602970.1|4873893_4874553_-	LexA family transcriptional regulator	NA	A0A1B5FPF4	Escherichia_phage	79.5	9.4e-98
WP_071646927.1|4874708_4874942_+	helix-turn-helix domain-containing protein	NA	A0A1B5FPK9	Escherichia_phage	63.9	2.2e-17
WP_023317658.1|4875660_4877319_+	DEAD/DEAH box helicase	NA	A0A286N2P9	Klebsiella_phage	99.1	0.0e+00
WP_023317657.1|4877320_4878283_+	toprim domain-containing protein	NA	A0A286N2Q0	Klebsiella_phage	99.7	1.3e-183
WP_023317656.1|4878279_4878756_+	hypothetical protein	NA	A0A286N2Q1	Klebsiella_phage	98.7	2.6e-89
WP_023317655.1|4878752_4879535_+	antitermination protein	NA	F1C595	Cronobacter_phage	79.1	3.8e-114
WP_004184721.1|4879688_4879946_+	hypothetical protein	NA	A0A286N2Q3	Klebsiella_phage	100.0	1.3e-42
WP_031280381.1|4879851_4880298_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016160648.1|4881129_4881345_+|holin	class II holin family protein	holin	A5LH82	Enterobacteria_phage	88.7	2.7e-30
WP_023317653.1|4881344_4881842_+	lysozyme	NA	A0A1V0E5Q7	Salmonella_phage	85.2	3.7e-78
WP_023317652.1|4881838_4882189_+	hypothetical protein	NA	R9TPM9	Aeromonas_phage	38.1	3.5e-11
WP_004218558.1|4883093_4883339_+	DUF2560 family protein	NA	A0A286N2R1	Klebsiella_phage	96.3	4.6e-34
WP_032428851.1|4883765_4884170_+	DUF2513 domain-containing protein	NA	NA	NA	NA	NA
WP_023317650.1|4884271_4884613_+	HNH endonuclease	NA	K7P7P4	Enterobacteria_phage	75.7	2.1e-48
WP_004177162.1|4884795_4885260_+|terminase	phage terminase small subunit P27 family	terminase	Q9B019	Phage_GMSE-1	61.4	3.7e-48
WP_021441628.1|4885213_4886956_+|terminase	terminase large subunit	terminase	A0A0U2C138	Paracoccus_phage	46.0	8.2e-141
WP_004177155.1|4886955_4888263_+|portal	phage portal protein	portal	K7PJU5	Enterobacteria_phage	85.7	4.9e-215
WP_032428842.1|4888276_4889095_+|protease	Clp protease ClpP	protease	K7PH05	Enterobacteria_phage	88.9	1.0e-133
WP_021441630.1|4889104_4890322_+|capsid	phage major capsid protein	capsid	K7PM57	Enterobacteria_phage	87.9	3.6e-196
WP_021441631.1|4890364_4890634_+	hypothetical protein	NA	A0A1P8DTJ1	Proteus_phage	68.1	1.8e-10
WP_004177149.1|4890633_4890960_+|head,tail	phage gp6-like head-tail connector protein	head,tail	K7PKT4	Enterobacteria_phage	69.4	6.2e-42
WP_032428844.1|4890971_4891310_+|head	phage head closure protein	head	A0A2H4JHK5	uncultured_Caudovirales_phage	75.0	2.2e-42
WP_021441632.1|4891306_4891756_+	HK97 gp10 family phage protein	NA	Q9MCS9	Enterobacteria_phage	83.2	1.0e-63
WP_016530186.1|4891752_4892100_+	DUF3168 domain-containing protein	NA	K7PKL6	Enterobacterial_phage	63.7	2.8e-32
WP_023313062.1|4892156_4892861_+	immunoglobulin domain-containing protein	NA	K7PHL2	Enterobacterial_phage	66.9	5.5e-80
WP_032428846.1|4892891_4893296_+|tail	phage tail protein	tail	K7PKV6	Enterobacterial_phage	58.5	1.7e-33
WP_032415151.1|4893298_4893604_+	DUF4035 domain-containing protein	NA	Q9MCS5	Enterobacteria_phage	65.7	8.1e-28
WP_032415149.1|4893678_4894062_+	hypothetical protein	NA	A0A0M4QWT0	Salmonella_phage	53.9	3.1e-32
WP_021441637.1|4894129_4897540_+|tail	phage tail tape measure protein	tail	A0A0P0ZCJ4	Stx2-converting_phage	43.3	8.7e-195
WP_004177132.1|4897560_4898034_+	hypothetical protein	NA	A0A286S298	Klebsiella_phage	62.1	1.4e-55
WP_021441639.1|4898020_4898497_+	DUF1833 family protein	NA	A0A286S2B1	Klebsiella_phage	65.8	3.7e-51
WP_019706060.1|4898509_4898890_+	nitrite transporter	NA	A0A286S2A6	Klebsiella_phage	83.3	2.6e-60
WP_021441641.1|4898886_4901964_+	kinase	NA	A0A286S259	Klebsiella_phage	62.0	0.0e+00
WP_060553448.1|4902038_4904765_+	hypothetical protein	NA	A0A0S1S5D9	Klebsiella_phage	54.1	1.2e-242
WP_060553450.1|4904773_4905610_+	hypothetical protein	NA	A0A0S1S106	Klebsiella_phage	65.1	6.3e-99
WP_129718361.1|4905745_4905931_-	hypothetical protein	NA	NA	NA	NA	NA
WP_023317641.1|4905971_4907207_-	hypothetical protein	NA	NA	NA	NA	NA
WP_023317642.1|4907207_4907951_-	hypothetical protein	NA	NA	NA	NA	NA
WP_021440000.1|4908042_4908591_+	recombinase family protein	NA	A0A286S1P7	Klebsiella_phage	96.7	2.9e-92
WP_023317637.1|4909637_4909919_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002902136.1|4910141_4910390_-	DinI-like family protein	NA	S5MQI1	Escherichia_phage	70.4	1.4e-25
WP_004176434.1|4911235_4911727_+	type VI secretion system contractile sheath small subunit	NA	NA	NA	NA	NA
WP_021440001.1|4911769_4913314_+	type VI secretion system contractile sheath large subunit	NA	NA	NA	NA	NA
WP_004179544.1|4913323_4914667_+|plate	type VI secretion system baseplate subunit TssK	plate	NA	NA	NA	NA
WP_004176431.1|4914663_4915353_+	DotU family type IV/VI secretion system protein	NA	NA	NA	NA	NA
WP_021440002.1|4915349_4917056_+	OmpA family protein	NA	NA	NA	NA	NA
WP_002902160.1|4917060_4917552_+	type VI secretion system effector Hcp	NA	NA	NA	NA	NA
WP_023302030.1|4917816_4920471_+	type VI secretion system ATPase TssH	NA	K4FB40	Cronobacter_phage	33.4	7.7e-98
WP_021440004.1|4920472_4922842_+	type VI secretion system tip protein VgrG	NA	A0A2H4JCD4	uncultured_Caudovirales_phage	33.0	2.4e-18
WP_021440005.1|4922845_4923622_+	DUF4123 domain-containing protein	NA	NA	NA	NA	NA
WP_023302028.1|4923646_4924177_+	DUF3304 domain-containing protein	NA	NA	NA	NA	NA
WP_021440007.1|4924164_4926564_+	DUF2235 domain-containing protein	NA	NA	NA	NA	NA
WP_023302025.1|4926606_4926864_+	PAAR domain-containing protein	NA	NA	NA	NA	NA
WP_021440008.1|4926812_4927994_+	hypothetical protein	NA	NA	NA	NA	NA
WP_021440009.1|4927983_4931433_+	type VI secretion protein VasK	NA	NA	NA	NA	NA
WP_004183804.1|4931429_4933022_+	type VI secretion system protein TssA	NA	NA	NA	NA	NA
WP_021440010.1|4933100_4934855_+|plate	type VI secretion system baseplate subunit TssF	plate	NA	NA	NA	NA
WP_004176418.1|4934818_4935904_+|plate	type VI secretion system baseplate subunit TssG	plate	NA	NA	NA	NA
>prophage 6
NZ_CP012883	Klebsiella pneumoniae KP-1 chromosome, complete genome	5180925	5129268	5140156	5180925		Escherichia_phage(87.5%)	9	NA	NA
WP_002210516.1|5129268_5129889_-	aldolase	NA	A0A077SK32	Escherichia_phage	100.0	8.0e-115
WP_004224682.1|5129881_5131147_-	four-carbon acid sugar kinase family protein	NA	A0A077SLJ7	Escherichia_phage	99.8	7.8e-234
WP_002903955.1|5131158_5132061_-	NAD(P)-dependent oxidoreductase	NA	A0A077SLF7	Escherichia_phage	99.7	2.6e-159
WP_002210513.1|5132322_5133084_+	DeoR/GlpR transcriptional regulator	NA	A0A077SK06	Escherichia_phage	100.0	1.9e-134
WP_021440083.1|5133104_5133971_-	class A beta-lactamase SHV-187	NA	A0A077SL40	Escherichia_phage	99.6	1.7e-155
WP_004176262.1|5134262_5134523_+	hypothetical protein	NA	A0A077SK33	Escherichia_phage	98.8	5.4e-41
WP_021440085.1|5134609_5135698_+	AAA family ATPase	NA	A0A077SLJ9	Escherichia_phage	99.7	5.2e-210
WP_004176258.1|5135728_5136994_-	MFS transporter	NA	NA	NA	NA	NA
WP_021440086.1|5137048_5140156_-	beta-galactosidase	NA	L0N6M2	Herpes_simplex_virus	59.6	0.0e+00
>prophage 1
NZ_CP012884	Klebsiella pneumoniae KP-1 plasmid pKP1-19, complete sequence	194742	121117	175355	194742	transposase,bacteriocin,integrase	Shigella_phage(15.38%)	36	150790:150809	162629:162648
WP_106475476.1|121117_123448_+|bacteriocin	klebicin B-related nuclease bacteriocin	bacteriocin	NA	NA	NA	NA
WP_004199332.1|124867_125146_+	replication regulatory protein RepA	NA	NA	NA	NA	NA
WP_004171457.1|125362_125440_+	RepA leader peptide Tap	NA	NA	NA	NA	NA
WP_023307528.1|125432_126290_+	incFII family plasmid replication initiator RepA	NA	NA	NA	NA	NA
WP_004197483.1|127654_127975_-	hypothetical protein	NA	NA	NA	NA	NA
WP_077254108.1|128360_129215_-|transposase	IS3 family transposase	transposase	U5P429	Shigella_phage	54.2	5.2e-80
WP_000537151.1|129211_129496_-|transposase	IS3 family transposase	transposase	U5P4I9	Shigella_phage	47.1	4.7e-14
WP_015065566.1|130398_130818_+	DUF2946 domain-containing protein	NA	NA	NA	NA	NA
WP_004182117.1|130900_132964_+	TonB-dependent copper receptor	NA	NA	NA	NA	NA
WP_023313931.1|133020_133281_+	DUF2534 family protein	NA	NA	NA	NA	NA
WP_004182120.1|134386_135640_-	lactose permease	NA	NA	NA	NA	NA
WP_004182121.1|135691_138766_-	beta-galactosidase	NA	L0N6M2	Herpes_simplex_virus	96.7	0.0e+00
WP_016831235.1|138887_139970_-	DNA-binding transcriptional repressor LacI	NA	C6ZCU4	Enterobacteria_phage	96.1	4.4e-185
WP_004152284.1|140430_141441_+	zinc-binding alcohol dehydrogenase family protein	NA	NA	NA	NA	NA
WP_165765869.1|141774_142062_+	EAL domain-containing protein	NA	NA	NA	NA	NA
WP_004118251.1|142392_142686_-	IS66 family insertion sequence element accessory protein TnpB	NA	A0A0P0ZDM8	Stx2-converting_phage	96.9	2.7e-49
WP_004152282.1|142784_143552_-	Fe(3+) dicitrate ABC transporter ATP-binding protein FecE	NA	G3M9Y6	Bacillus_virus	25.2	9.8e-14
WP_023328280.1|143552_144509_-	Fe(3+) dicitrate ABC transporter permease subunit FecD	NA	NA	NA	NA	NA
WP_004182126.1|144505_145504_-	iron-dicitrate ABC transporter permease FecC	NA	NA	NA	NA	NA
WP_004182127.1|145500_146403_-	Fe(3+) dicitrate ABC transporter substrate-binding protein FecB	NA	NA	NA	NA	NA
WP_004182128.1|146447_148772_-	Fe(3+) dicitrate transport protein FecA	NA	NA	NA	NA	NA
WP_004197067.1|148858_149812_-	fec operon regulator FecR	NA	NA	NA	NA	NA
WP_004197062.1|149808_150330_-	RNA polymerase sigma factor FecI	NA	NA	NA	NA	NA
150790:150809	attL	GGCTTTGTTGAATAAATCAG	NA	NA	NA	NA
WP_004118231.1|151432_151600_+|integrase	integrase	integrase	NA	NA	NA	NA
WP_004118840.1|151884_153012_+	transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_004118227.1|154443_155364_+	ABC transporter permease	NA	NA	NA	NA	NA
WP_004152278.1|155376_156981_+	ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_004118225.1|157025_157973_+	acetamidase/formamidase family protein	NA	A0A1V0S8X7	Catovirus	22.7	9.6e-11
WP_004118832.1|157980_159714_+	ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	29.6	6.9e-15
WP_072143344.1|161624_162593_+|transposase	IS5 family transposase	transposase	A0A1B0VFY5	Salmonella_phage	91.6	2.0e-173
WP_004181990.1|163589_164510_-	two-component system response regulator RssB	NA	W8CYM9	Bacillus_phage	34.1	2.0e-13
162629:162648	attR	CTGATTTATTCAACAAAGCC	NA	NA	NA	NA
WP_004181991.1|164472_167853_-	response regulator	NA	A0A1V0SGX0	Hokovirus	30.3	1.7e-41
WP_004181993.1|169402_170329_+	urea ABC transporter permease subunit UrtB	NA	NA	NA	NA	NA
WP_004181995.1|171449_172199_+	urea ABC transporter ATP-binding protein UrtD	NA	A0A2H4PQG7	Staphylococcus_phage	26.4	2.4e-17
WP_004181996.1|172209_172899_+	urea ABC transporter ATP-binding subunit UrtE	NA	G9BWD6	Planktothrix_phage	29.6	8.5e-17
WP_004118209.1|175091_175355_-|transposase	transposase	transposase	NA	NA	NA	NA
