The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
NZ_CP048273	Bacillus sp. NSP9.1 chromosome, complete genome	4543164	1150667	1162056	4543164	integrase	uncultured_Caudovirales_phage(40.0%)	17	1150293:1150307	1156830:1156844
1150293:1150307	attL	AAAACAAGAGAAAAA	NA	NA	NA	NA
WP_026588513.1|1150667_1151612_+	ADP-ribosylglycohydrolase	NA	A0A1S6UB21	Serratia_phage	31.9	2.3e-36
WP_026588512.1|1151944_1153003_+|integrase	tyrosine-type recombinase/integrase	integrase	A0A1B1IQT7	uncultured_Mediterranean_phage	26.0	2.2e-16
WP_026588511.1|1153274_1153727_+	hypothetical protein	NA	NA	NA	NA	NA
WP_152520996.1|1153731_1154196_+	hypothetical protein	NA	NA	NA	NA	NA
WP_026588509.1|1154192_1154627_+	helix-turn-helix domain-containing protein	NA	A0A2H4IZR0	uncultured_Caudovirales_phage	61.9	4.7e-37
WP_026588507.1|1155079_1155409_+	hypothetical protein	NA	A0A0N9SHL8	Paenibacillus_phage	34.8	3.2e-06
WP_035428443.1|1155448_1155643_+	hypothetical protein	NA	NA	NA	NA	NA
WP_026588506.1|1155643_1155991_+	hypothetical protein	NA	R4JGJ3	Bacillus_phage	41.1	2.3e-10
WP_026588505.1|1155990_1156341_+	hypothetical protein	NA	NA	NA	NA	NA
WP_035428441.1|1156324_1156699_+	hypothetical protein	NA	A0A2H4J134	uncultured_Caudovirales_phage	44.0	8.1e-22
WP_026588503.1|1156715_1157723_+	hypothetical protein	NA	R4JEY6	Bacillus_phage	46.8	1.4e-71
1156830:1156844	attR	AAAACAAGAGAAAAA	NA	NA	NA	NA
WP_026588502.1|1157884_1158652_+	ATP-binding protein	NA	A0A0N7GFF0	Paenibacillus_phage	51.1	2.3e-63
WP_035428438.1|1158648_1158864_+	hypothetical protein	NA	NA	NA	NA	NA
WP_026588500.1|1158860_1159361_+	hypothetical protein	NA	NA	NA	NA	NA
WP_026588499.1|1159360_1159564_+	hypothetical protein	NA	NA	NA	NA	NA
WP_026588498.1|1159560_1160901_+	AAA family ATPase	NA	A0A2H4IZL9	uncultured_Caudovirales_phage	54.1	2.0e-131
WP_026588497.1|1161036_1162056_+	DNA primase	NA	A0A2H4J6E6	uncultured_Caudovirales_phage	46.4	1.5e-73
>prophage 2
NZ_CP048273	Bacillus sp. NSP9.1 chromosome, complete genome	4543164	1165797	1184638	4543164		Bacillus_phage(50.0%)	29	NA	NA
WP_026588493.1|1165797_1166556_+	hypothetical protein	NA	A0A0N9SJW5	Paenibacillus_phage	48.9	4.8e-53
WP_163170547.1|1166578_1166734_+	hypothetical protein	NA	NA	NA	NA	NA
WP_026588492.1|1166733_1167165_+	hypothetical protein	NA	A0A2H4IZM8	uncultured_Caudovirales_phage	38.7	9.7e-11
WP_026588490.1|1168409_1168589_+	hypothetical protein	NA	NA	NA	NA	NA
WP_163170548.1|1168585_1168750_+	hypothetical protein	NA	NA	NA	NA	NA
WP_026588489.1|1168783_1170961_+	DNA polymerase I	NA	A0A2H4J6W7	uncultured_Caudovirales_phage	48.7	1.3e-172
WP_163170549.1|1170962_1171124_+	hypothetical protein	NA	NA	NA	NA	NA
WP_026588488.1|1171196_1172204_+	hypothetical protein	NA	A0A2H4J7K6	uncultured_Caudovirales_phage	57.6	2.1e-109
WP_026588487.1|1172203_1172401_+	hypothetical protein	NA	NA	NA	NA	NA
WP_026588486.1|1172393_1172957_+	hypothetical protein	NA	NA	NA	NA	NA
WP_026588485.1|1172953_1173259_+	hypothetical protein	NA	A0A1S5SA91	Streptococcus_phage	32.6	4.8e-12
WP_026588484.1|1173259_1173625_+	hypothetical protein	NA	A0A218KDD8	Bacillus_phage	41.0	3.9e-13
WP_026588483.1|1173628_1173859_+	hypothetical protein	NA	NA	NA	NA	NA
WP_026588482.1|1173851_1174121_+	hypothetical protein	NA	NA	NA	NA	NA
WP_026588481.1|1174117_1174312_+	hypothetical protein	NA	NA	NA	NA	NA
WP_026588480.1|1174308_1174512_+	hypothetical protein	NA	NA	NA	NA	NA
WP_026588479.1|1174505_1174862_+	class Ib ribonucleoside-diphosphate reductase assembly flavoprotein NrdI	NA	A0A142F1R4	Bacillus_phage	55.1	2.2e-29
WP_026588478.1|1174851_1176951_+	class 1b ribonucleoside-diphosphate reductase subunit alpha	NA	U5PY35	Bacillus_phage	78.8	0.0e+00
WP_026588477.1|1177143_1177362_+	hypothetical protein	NA	NA	NA	NA	NA
WP_026588476.1|1178067_1178589_+	HNH endonuclease	NA	A0A1P8CX39	Bacillus_phage	85.0	1.2e-84
WP_026588475.1|1179204_1179747_+	deoxyuridine 5'-triphosphate nucleotidohydrolase	NA	D2XR49	Bacillus_phage	52.2	9.3e-43
WP_026588474.1|1179739_1180108_-	DUF2513 domain-containing protein	NA	A0A1Q1PVT8	Staphylococcus_phage	40.5	4.9e-19
WP_026588473.1|1180172_1180898_+	FAD-dependent thymidylate synthase	NA	U5PWA7	Bacillus_virus	62.7	1.4e-81
WP_035428437.1|1180900_1181455_+	SPBc2 prophage-derived protein YorM	NA	A0A142F1S8	Bacillus_phage	62.4	1.5e-27
WP_152520995.1|1181451_1181637_+	hypothetical protein	NA	NA	NA	NA	NA
WP_163170550.1|1181652_1181820_+	hypothetical protein	NA	NA	NA	NA	NA
WP_026588472.1|1181820_1182666_+	hypothetical protein	NA	A0A1P8CWY7	Bacillus_phage	53.3	2.2e-38
WP_026588471.1|1182662_1183223_+	dephospho-CoA kinase	NA	A0A0N9SJZ0	Paenibacillus_phage	45.8	5.6e-35
WP_051290429.1|1183219_1184638_+	DNA cytosine methyltransferase	NA	A0A1P8CX13	Bacillus_phage	74.8	2.3e-133
>prophage 3
NZ_CP048273	Bacillus sp. NSP9.1 chromosome, complete genome	4543164	1194189	1211720	4543164	tail,portal,integrase,protease	uncultured_Caudovirales_phage(40.0%)	19	1193312:1193326	1199143:1199157
1193312:1193326	attL	TGTATTTCGAATGTC	NA	NA	NA	NA
WP_026588458.1|1194189_1194735_-|integrase	tyrosine-type recombinase/integrase	integrase	A0A2H4J6I5	uncultured_Caudovirales_phage	43.0	5.9e-29
WP_026588457.1|1194838_1196593_+	hypothetical protein	NA	A0A2H4J484	uncultured_Caudovirales_phage	72.6	5.2e-252
WP_026588456.1|1196609_1197038_+	hypothetical protein	NA	A0A2H4J6Z8	uncultured_Caudovirales_phage	51.4	2.2e-31
WP_026588455.1|1197040_1198672_+|portal	phage portal protein	portal	A0A2H4J180	uncultured_Caudovirales_phage	57.2	7.6e-165
WP_026588454.1|1198668_1199490_+	type IV secretion protein Rhs	NA	A0A0N9SJR1	Paenibacillus_phage	54.9	1.1e-79
1199143:1199157	attR	GACATTCGAAATACA	NA	NA	NA	NA
WP_152520994.1|1199492_1200047_+	hypothetical protein	NA	S5MA16	Bacillus_phage	37.8	1.6e-10
WP_152520993.1|1200166_1200898_+|protease	Clp protease ClpB	protease	A0A2H4IZP8	uncultured_Caudovirales_phage	53.3	1.3e-26
WP_026588453.1|1200949_1202041_+	DUF5309 family protein	NA	A0A2H4J2M3	uncultured_Caudovirales_phage	66.0	5.3e-130
WP_026588452.1|1202095_1202308_+	hypothetical protein	NA	NA	NA	NA	NA
WP_026588451.1|1202323_1202710_+	hypothetical protein	NA	A0A0N9SGG4	Paenibacillus_phage	44.7	4.5e-23
WP_026588450.1|1202710_1203049_+	hypothetical protein	NA	NA	NA	NA	NA
WP_026588449.1|1203045_1203456_+	hypothetical protein	NA	A0A0N9SJT1	Paenibacillus_phage	51.9	2.2e-28
WP_026588448.1|1203459_1203834_+	hypothetical protein	NA	NA	NA	NA	NA
WP_026588447.1|1203872_1204406_+	hypothetical protein	NA	A0A0N9SHI3	Paenibacillus_phage	63.6	6.5e-57
WP_026588446.1|1204464_1204833_+	hypothetical protein	NA	NA	NA	NA	NA
WP_163170575.1|1205168_1205624_+|tail	phage tail tape measure protein	tail	A0A0N9SJR9	Paenibacillus_phage	41.9	2.9e-13
WP_163170576.1|1206064_1208218_+|tail	phage tail tape measure protein	tail	A0A0N9SJR9	Paenibacillus_phage	36.2	9.4e-46
WP_026588443.1|1208214_1209051_+|tail	phage tail family protein	tail	A6M962	Geobacillus_virus	41.6	3.2e-50
WP_026588442.1|1209071_1211720_+	XkdX family protein	NA	E3SQN9	Cyanophage	41.1	5.6e-24
>prophage 4
NZ_CP048273	Bacillus sp. NSP9.1 chromosome, complete genome	4543164	1601139	1756589	4543164	coat,integrase,terminase,plate,holin,capsid,portal,tail	Bacillus_phage(32.91%)	181	1654608:1654658	1708297:1708347
WP_026586439.1|1601139_1601589_-|coat	spore coat protein	coat	NA	NA	NA	NA
WP_026586440.1|1601739_1602225_-|coat	spore coat protein	coat	NA	NA	NA	NA
WP_026586441.1|1602355_1602862_-|coat	spore coat protein	coat	NA	NA	NA	NA
WP_026586442.1|1602929_1603271_-	hypothetical protein	NA	NA	NA	NA	NA
WP_026586443.1|1603317_1603704_-|coat	spore coat protein	coat	NA	NA	NA	NA
WP_026586444.1|1603875_1604232_+	DUF1360 domain-containing protein	NA	NA	NA	NA	NA
WP_026586445.1|1604521_1604731_+	hypothetical protein	NA	NA	NA	NA	NA
WP_026586446.1|1604810_1604930_+	YjcZ family sporulation protein	NA	NA	NA	NA	NA
WP_026586447.1|1605061_1605319_+	sporulation protein	NA	NA	NA	NA	NA
WP_026586448.1|1605357_1607631_-	ATP-dependent helicase	NA	A0A068EQC7	Bacillus_phage	34.3	3.4e-86
WP_026586449.1|1607747_1608005_+	hypothetical protein	NA	NA	NA	NA	NA
WP_026586450.1|1608052_1608640_-	DedA family protein	NA	NA	NA	NA	NA
WP_026586451.1|1608734_1609721_-	UDP-glucose 4-epimerase GalE	NA	A0A2K9L5H6	Tupanvirus	36.6	7.6e-51
WP_026586452.1|1609717_1610608_-	UTP--glucose-1-phosphate uridylyltransferase GalU	NA	A0A127AW70	Bacillus_phage	56.7	4.7e-84
WP_026586453.1|1610634_1611030_-	GtrA family protein	NA	NA	NA	NA	NA
WP_026586454.1|1611192_1611612_-	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_026586455.1|1611621_1612131_-	hypothetical protein	NA	NA	NA	NA	NA
WP_026586456.1|1612195_1612918_-	esterase family protein	NA	NA	NA	NA	NA
WP_026586457.1|1613041_1613494_-	Pathogenicity locus	NA	NA	NA	NA	NA
WP_026586458.1|1613511_1614000_-	damage-inducible protein DinB	NA	NA	NA	NA	NA
WP_026586459.1|1614077_1615022_-	YafY family transcriptional regulator	NA	NA	NA	NA	NA
WP_026586460.1|1615331_1616450_+	methionine biosynthesis PLP-dependent protein	NA	A0A0B5JD48	Pandoravirus	26.7	1.8e-16
WP_026586461.1|1616446_1617622_+	cystathionine beta-lyase	NA	NA	NA	NA	NA
WP_026586462.1|1617659_1618856_-	DUF819 domain-containing protein	NA	NA	NA	NA	NA
WP_026586463.1|1619296_1620022_+	necrosis and ethylene inducing protein	NA	NA	NA	NA	NA
WP_026586464.1|1621676_1622111_+	SMI1/KNR4 family protein	NA	NA	NA	NA	NA
WP_051290348.1|1622351_1623305_-	family 43 glycosylhydrolase	NA	NA	NA	NA	NA
WP_026586466.1|1623990_1626426_+	glycosyl hydrolase	NA	NA	NA	NA	NA
WP_026586467.1|1626422_1627316_+	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_051290349.1|1627550_1630433_+	beta-glucosidase	NA	NA	NA	NA	NA
WP_026586469.1|1630544_1632956_+	glycosyl hydrolase	NA	NA	NA	NA	NA
WP_026586470.1|1632998_1633619_+	hypothetical protein	NA	NA	NA	NA	NA
WP_026586471.1|1633642_1634659_+	glycosyltransferase family 2 protein	NA	NA	NA	NA	NA
WP_026586472.1|1634756_1635863_+	UDP-galactopyranose mutase	NA	E4ZFQ1	Streptococcus_phage	67.0	1.2e-148
WP_051290350.1|1636020_1637007_+	ROK family glucokinase	NA	NA	NA	NA	NA
WP_016886607.1|1637443_1637527_-	hypothetical protein	NA	NA	NA	NA	NA
WP_026586473.1|1637969_1638305_-	hypothetical protein	NA	NA	NA	NA	NA
WP_026586474.1|1638422_1638734_-	hypothetical protein	NA	NA	NA	NA	NA
WP_026586475.1|1638745_1640185_-	lipase	NA	NA	NA	NA	NA
WP_026586476.1|1640243_1640558_+	DUF1433 domain-containing protein	NA	NA	NA	NA	NA
WP_081692821.1|1640622_1640748_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_081692858.1|1640767_1640953_-	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_026586478.1|1641096_1641297_+	hypothetical protein	NA	NA	NA	NA	NA
WP_026586479.1|1641293_1641641_+	hypothetical protein	NA	NA	NA	NA	NA
WP_026586480.1|1641627_1642170_+	hypothetical protein	NA	NA	NA	NA	NA
WP_026586481.1|1642746_1643742_+	hypothetical protein	NA	NA	NA	NA	NA
WP_026586482.1|1643862_1644789_+	hypothetical protein	NA	NA	NA	NA	NA
WP_152520958.1|1644875_1645286_+	hypothetical protein	NA	NA	NA	NA	NA
WP_026586484.1|1645567_1645957_+	hypothetical protein	NA	NA	NA	NA	NA
WP_026586485.1|1645957_1646683_+	hypothetical protein	NA	NA	NA	NA	NA
WP_026586486.1|1646801_1647026_+	hypothetical protein	NA	NA	NA	NA	NA
WP_163170577.1|1647780_1649928_+|tail	phage tail tape measure protein	tail	A0A0N9SJR9	Paenibacillus_phage	40.7	1.1e-38
WP_026586488.1|1650031_1650280_+	hypothetical protein	NA	NA	NA	NA	NA
WP_026586489.1|1651000_1651546_-|integrase	tyrosine-type recombinase/integrase	integrase	A0A2H4J6I5	uncultured_Caudovirales_phage	43.0	1.0e-28
WP_051290352.1|1651521_1651836_-	Bro-N domain-containing protein	NA	A0A2P1JTZ2	Anoxybacillus_phage	63.4	1.3e-25
WP_026586491.1|1652476_1653235_-	helix-turn-helix domain-containing protein	NA	A0A288WFX2	Bacillus_phage	29.0	2.5e-17
WP_026586492.1|1653390_1654437_-|integrase	tyrosine-type recombinase/integrase	integrase	F1BUS9	Erwinia_phage	25.3	3.2e-07
1654608:1654658	attL	GGTATGATTCCGACTGGGCTCGAACCAGCGACCTCTACCCTGTCAAGGTAG	NA	NA	NA	NA
WP_026586493.1|1654913_1656116_-|integrase	site-specific integrase	integrase	A0A2I7SC08	Paenibacillus_phage	44.9	2.2e-92
WP_026586494.1|1656187_1656781_-	hypothetical protein	NA	NA	NA	NA	NA
WP_026586495.1|1656855_1657287_-	ImmA/IrrE family metallo-endopeptidase	NA	D2XR38	Bacillus_phage	51.4	1.2e-37
WP_026586496.1|1657302_1657782_-	helix-turn-helix domain-containing protein	NA	A6XML9	Bacillus_virus	61.6	4.2e-47
WP_026586497.1|1657950_1658190_+	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_026586498.1|1658200_1658401_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_026586499.1|1658491_1659010_+	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_152520959.1|1659006_1659273_+	hypothetical protein	NA	NA	NA	NA	NA
WP_026586501.1|1659273_1659462_+	hypothetical protein	NA	NA	NA	NA	NA
WP_026586502.1|1659597_1659792_+	hypothetical protein	NA	NA	NA	NA	NA
WP_026586503.1|1659804_1660020_+	hypothetical protein	NA	NA	NA	NA	NA
WP_026586504.1|1660125_1660314_+	hypothetical protein	NA	NA	NA	NA	NA
WP_026586505.1|1660310_1662299_+	hypothetical protein	NA	A0A1L2K2K3	Aeribacillus_phage	45.5	5.7e-146
WP_026586506.1|1662295_1662547_+	hypothetical protein	NA	A0A142F1S1	Bacillus_phage	37.2	3.2e-06
WP_026586507.1|1662539_1663283_+	phage recombination protein Bet	NA	A8ATK8	Listeria_phage	57.1	6.1e-69
WP_026586508.1|1663279_1663981_+	MBL fold metallo-hydrolase	NA	A0A1L2JY21	Aeribacillus_phage	69.1	7.2e-96
WP_026586510.1|1664182_1664983_+	hypothetical protein	NA	I1W658	Staphylococcus_phage	38.6	1.4e-18
WP_017474951.1|1664985_1665267_+	hypothetical protein	NA	NA	NA	NA	NA
WP_026586511.1|1665241_1666546_+	replicative DNA helicase	NA	D2XR44	Bacillus_phage	42.7	3.1e-92
WP_081692822.1|1666542_1666758_+	Fur-regulated basic protein FbpA	NA	M4ZS77	Bacillus_phage	50.9	7.2e-07
WP_026586513.1|1666865_1667126_+	IDEAL domain-containing protein	NA	NA	NA	NA	NA
WP_026588402.1|1667262_1667721_+	RusA family crossover junction endodeoxyribonuclease	NA	S6B1L9	Thermus_phage	69.8	7.6e-54
WP_081692823.1|1667732_1668368_+	hypothetical protein	NA	NA	NA	NA	NA
WP_026586515.1|1668498_1668708_+	hypothetical protein	NA	NA	NA	NA	NA
WP_026586516.1|1668724_1669162_+	hypothetical protein	NA	M1IEE7	Bacillus_virus	44.4	1.1e-20
WP_026586517.1|1669289_1669490_+	hypothetical protein	NA	A0A1L2JY31	Aeribacillus_phage	63.6	1.6e-13
WP_026586518.1|1669486_1670173_+	hypothetical protein	NA	NA	NA	NA	NA
WP_026586519.1|1670266_1670650_+	ArpU family transcriptional regulator	NA	Q9ZXB9	Bacillus_phage	58.7	4.0e-32
WP_026586520.1|1670810_1671950_-	tetratricopeptide repeat protein	NA	A0A1P8CWN8	Bacillus_phage	48.4	7.3e-98
WP_035428007.1|1672185_1674132_+|integrase	integrase	integrase	A0A1P8CWI7	Bacillus_phage	24.5	3.7e-17
WP_026586521.1|1674143_1674608_+	SMI1/KNR4 family protein	NA	NA	NA	NA	NA
WP_026586523.1|1675698_1675989_+	hypothetical protein	NA	NA	NA	NA	NA
WP_026586524.1|1676116_1677391_+	DNA modification methylase	NA	A0A2I4R670	Erysipelothrix_phage	45.0	4.8e-90
WP_026586525.1|1677524_1677773_+	hypothetical protein	NA	A8ATN7	Listeria_phage	41.1	6.4e-07
WP_026586526.1|1677815_1678292_-	hypothetical protein	NA	NA	NA	NA	NA
WP_026586527.1|1678431_1679301_+|terminase	terminase	terminase	D2IYW0	Enterococcus_phage	38.9	5.3e-32
WP_026586528.1|1679297_1680599_+|terminase	PBSX family phage terminase large subunit	terminase	M4ZRM5	Bacillus_phage	63.6	4.1e-161
WP_026586529.1|1682133_1683042_+	hypothetical protein	NA	A0A1B1P7D7	Bacillus_phage	39.1	1.1e-51
WP_026586530.1|1683100_1684363_+	hypothetical protein	NA	NA	NA	NA	NA
WP_026586531.1|1684408_1685581_+|terminase	terminase	terminase	A0A1B1P7E4	Bacillus_phage	51.5	4.4e-82
WP_026586532.1|1685593_1686529_+|capsid	phage major capsid protein	capsid	A0A1B1P7E3	Bacillus_phage	63.4	4.3e-104
WP_026586533.1|1686539_1686953_+	hypothetical protein	NA	NA	NA	NA	NA
WP_026586534.1|1686959_1687355_+	DUF3199 family protein	NA	A0A1B1P7D6	Bacillus_phage	39.5	1.1e-16
WP_026586535.1|1687351_1687708_+	YqbH/XkdH family protein	NA	NA	NA	NA	NA
WP_026586536.1|1687704_1688202_+	HK97 gp10 family phage protein	NA	A0A249XXA4	Clostridium_phage	47.2	5.2e-40
WP_081692824.1|1688191_1688656_+|portal	phage portal protein	portal	NA	NA	NA	NA
WP_051290353.1|1688656_1688881_+	hypothetical protein	NA	NA	NA	NA	NA
WP_026586539.1|1688881_1690282_+|portal	phage portal protein	portal	A0A0A7RTT5	Clostridium_phage	42.2	1.9e-84
WP_026586540.1|1690283_1690727_+|tail	phage tail tube protein	tail	A0A0A7RVP1	Clostridium_phage	46.6	1.2e-27
WP_026586541.1|1691253_1691703_+|portal	phage portal protein	portal	A0A0A7RTY8	Clostridium_phage	30.5	2.8e-08
WP_094777351.1|1691732_1691882_+	hypothetical protein	NA	NA	NA	NA	NA
WP_026586542.1|1691885_1697138_+	transglycosylase SLT domain-containing protein	NA	A0A1L2JY60	Aeribacillus_phage	41.2	6.9e-50
WP_026586543.1|1697130_1697790_+	LysM peptidoglycan-binding domain-containing protein	NA	A0A090DBR9	Clostridium_phage	35.0	1.6e-25
WP_026586544.1|1697806_1698787_+	hypothetical protein	NA	H7BV96	unidentified_phage	29.3	7.8e-32
WP_026586545.1|1698783_1699092_+	DUF2577 domain-containing protein	NA	NA	NA	NA	NA
WP_026586546.1|1699104_1699530_+	DUF2634 domain-containing protein	NA	A0A0A7RTU4	Clostridium_phage	37.8	2.5e-11
WP_026586547.1|1699522_1700566_+|plate	baseplate J/gp47 family protein	plate	S6AVU3	Thermus_phage	46.6	1.0e-74
WP_026586548.1|1700552_1701131_+	YmfQ family protein	NA	A0A0A7RTT8	Clostridium_phage	28.9	5.1e-15
WP_026586549.1|1701127_1701403_+	hypothetical protein	NA	NA	NA	NA	NA
WP_026586550.1|1701403_1702489_+	hypothetical protein	NA	M4ZRP1	Bacillus_phage	63.5	5.1e-16
WP_051290354.1|1702501_1702690_+	hypothetical protein	NA	A0A2H4JCI0	uncultured_Caudovirales_phage	46.8	4.1e-06
WP_026586551.1|1702816_1703650_+	hypothetical protein	NA	NA	NA	NA	NA
WP_026586552.1|1703732_1704002_+	protein xhlA	NA	A0A2H4JD40	uncultured_Caudovirales_phage	62.9	9.6e-25
WP_026586553.1|1704017_1704281_+|holin	phage holin	holin	A0A2H4J6M0	uncultured_Caudovirales_phage	72.4	4.4e-30
WP_026586554.1|1704326_1705280_+	LysM peptidoglycan-binding domain-containing protein	NA	A0A141HSE6	Bacillus_phage	47.9	3.5e-61
WP_026586555.1|1705571_1705928_+	hypothetical protein	NA	NA	NA	NA	NA
WP_026586556.1|1705973_1707002_+	DUF4065 domain-containing protein	NA	A0A223LD38	Bacillus_phage	38.1	2.2e-08
WP_051290355.1|1707027_1707636_-	hypothetical protein	NA	NA	NA	NA	NA
WP_026586558.1|1708973_1709258_+	hypothetical protein	NA	NA	NA	NA	NA
1708297:1708347	attR	GGTATGATTCCGACTGGGCTCGAACCAGCGACCTCTACCCTGTCAAGGTAG	NA	NA	NA	NA
WP_026586559.1|1709314_1709878_+	sugar O-acetyltransferase	NA	NA	NA	NA	NA
WP_026586560.1|1709992_1710853_+	AraC family transcriptional regulator	NA	NA	NA	NA	NA
WP_035428011.1|1710986_1711910_+	TIM barrel protein	NA	NA	NA	NA	NA
WP_026586562.1|1711939_1713106_+	Gfo/Idh/MocA family oxidoreductase	NA	NA	NA	NA	NA
WP_077737017.1|1713196_1714105_-	protoheme IX farnesyltransferase	NA	NA	NA	NA	NA
WP_026586564.1|1714270_1715161_-	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_026586565.1|1715483_1717313_+	assimilatory sulfite reductase (NADPH) flavoprotein subunit	NA	NA	NA	NA	NA
WP_026586566.1|1717339_1719055_+	assimilatory sulfite reductase (NADPH) hemoprotein subunit	NA	NA	NA	NA	NA
WP_026586567.1|1719080_1719974_-	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_026586568.1|1720076_1720949_+	DMT family transporter	NA	NA	NA	NA	NA
WP_026586569.1|1720992_1721370_+	hypothetical protein	NA	NA	NA	NA	NA
WP_026586570.1|1721417_1721966_-	hypothetical protein	NA	NA	NA	NA	NA
WP_026586571.1|1722344_1723070_+	LysM peptidoglycan-binding domain-containing protein	NA	L0LBX4	Bacillus_phage	47.8	5.4e-30
WP_026586572.1|1723112_1724540_-	DHA2 family efflux MFS transporter permease subunit	NA	NA	NA	NA	NA
WP_026586573.1|1724558_1725134_-	TetR/AcrR family transcriptional regulator	NA	NA	NA	NA	NA
WP_026586574.1|1725373_1725802_-	hypothetical protein	NA	NA	NA	NA	NA
WP_026586575.1|1725903_1726533_+	poly-gamma-glutamate hydrolase family protein	NA	O64134	Bacillus_phage	45.3	9.8e-44
WP_026586576.1|1726566_1727217_-	ImmA/IrrE family metallo-endopeptidase	NA	A0A2H4JA43	uncultured_Caudovirales_phage	51.7	5.0e-43
WP_026586577.1|1727402_1727759_-	helix-turn-helix transcriptional regulator	NA	A0A2H4J6F9	uncultured_Caudovirales_phage	46.6	8.9e-18
WP_077737006.1|1728184_1728490_+	hypothetical protein	NA	NA	NA	NA	NA
WP_026586579.1|1728486_1729293_+	ArsR family transcriptional regulator	NA	S6BFM4	Thermus_phage	27.4	2.5e-23
WP_035428014.1|1729192_1729993_+	ATP-binding protein	NA	Q0H276	Geobacillus_phage	48.9	1.6e-59
WP_026586581.1|1730256_1730601_+	hypothetical protein	NA	NA	NA	NA	NA
WP_026586582.1|1730597_1730801_+	hypothetical protein	NA	A0A2H4J4M6	uncultured_Caudovirales_phage	56.2	1.4e-12
WP_026586583.1|1730915_1731419_+	sigma-70 family RNA polymerase sigma factor	NA	A0A0K2CNQ1	Brevibacillus_phage	41.7	5.8e-23
WP_026586584.1|1731535_1732342_+|terminase	terminase	terminase	A0A0S2MVB6	Bacillus_phage	51.4	1.7e-64
WP_026586585.1|1732338_1733634_+|terminase	PBSX family phage terminase large subunit	terminase	M4ZRM5	Bacillus_phage	58.9	3.2e-150
WP_026586586.1|1733637_1735149_+|portal	phage portal protein	portal	A0A1B1P7C8	Bacillus_phage	55.3	1.6e-145
WP_026586587.1|1735156_1736005_+|portal	phage portal protein	portal	A0A1B1P7E4	Bacillus_phage	63.5	1.9e-58
WP_026586588.1|1736022_1736958_+|portal	phage portal protein	portal	A0A1B1P7E3	Bacillus_phage	64.4	6.2e-103
WP_142246132.1|1736963_1737140_+	hypothetical protein	NA	NA	NA	NA	NA
WP_026586589.1|1737133_1737508_+	DUF3199 family protein	NA	A0A1B1P7D6	Bacillus_phage	41.6	3.2e-18
WP_026586590.1|1737504_1737861_+	YqbH/XkdH family protein	NA	NA	NA	NA	NA
WP_026586591.1|1737857_1738346_+	HK97 gp10 family phage protein	NA	A0A249XXA4	Clostridium_phage	43.9	4.4e-36
WP_026586592.1|1738358_1738799_+	hypothetical protein	NA	NA	NA	NA	NA
WP_026586593.1|1738799_1739015_+	hypothetical protein	NA	NA	NA	NA	NA
WP_026586594.1|1739014_1740361_+|portal	phage portal protein	portal	S5MNC1	Brevibacillus_phage	40.0	9.3e-76
WP_026586595.1|1740362_1740806_+|tail	phage tail tube protein	tail	A0A0K2CNG3	Brevibacillus_phage	45.4	9.3e-25
WP_026586596.1|1740964_1741414_+|portal	phage portal protein	portal	A0A0A7RTY8	Clostridium_phage	38.7	5.4e-12
WP_142246159.1|1741455_1741593_+	hypothetical protein	NA	NA	NA	NA	NA
WP_035428017.1|1741596_1745520_+	transglycosylase SLT domain-containing protein	NA	A0A1L2JY60	Aeribacillus_phage	46.5	2.8e-48
WP_026586598.1|1745512_1746169_+	LysM peptidoglycan-binding domain-containing protein	NA	A0A0K2SUI2	Clostridium_phage	32.3	8.7e-27
WP_026586599.1|1746224_1747205_+	hypothetical protein	NA	H7BV96	unidentified_phage	32.0	6.0e-40
WP_026586600.1|1747201_1747510_+	DUF2577 domain-containing protein	NA	NA	NA	NA	NA
WP_026586601.1|1747523_1747949_+	DUF2634 domain-containing protein	NA	A0A2H4J6K5	uncultured_Caudovirales_phage	35.9	2.1e-13
WP_026586602.1|1747941_1748985_+|plate	baseplate J/gp47 family protein	plate	S6AVU3	Thermus_phage	44.6	1.8e-71
WP_026586603.1|1748971_1749892_+	YmfQ family protein	NA	A0A0A7RTT8	Clostridium_phage	31.0	5.3e-14
WP_026586604.1|1749905_1750292_+	hypothetical protein	NA	NA	NA	NA	NA
WP_051290357.1|1750306_1751572_+	hypothetical protein	NA	NA	NA	NA	NA
WP_026586605.1|1751597_1752608_+	hypothetical protein	NA	A0A2H4J4R1	uncultured_Caudovirales_phage	42.2	9.0e-15
WP_026586606.1|1752669_1753500_+	glycerophosphodiester phosphodiesterase	NA	NA	NA	NA	NA
WP_026586607.1|1753702_1754881_+	hypothetical protein	NA	A0A2H4J4R1	uncultured_Caudovirales_phage	47.2	1.2e-26
WP_026586608.1|1754915_1755185_+	protein xhlA	NA	A0A2H4JD40	uncultured_Caudovirales_phage	65.2	6.7e-26
WP_026586609.1|1755199_1755463_+|holin	phage holin	holin	A0A2H4J6M0	uncultured_Caudovirales_phage	71.3	1.7e-29
WP_026586610.1|1755509_1756589_+	N-acetylmuramoyl-L-alanine amidase	NA	S6BFI4	Thermus_phage	54.9	6.8e-45
>prophage 5
NZ_CP048273	Bacillus sp. NSP9.1 chromosome, complete genome	4543164	2324705	2365286	4543164	integrase,plate,terminase,holin,capsid,head,protease,portal,transposase,tail	Bacillus_phage(73.81%)	56	2326944:2326958	2335072:2335086
WP_026587140.1|2324705_2325851_-|integrase	site-specific integrase	integrase	A0A0M5M609	Bacillus_phage	41.0	4.8e-73
WP_026587141.1|2325891_2326314_-	ImmA/IrrE family metallo-endopeptidase	NA	A0A0S2SXM3	Bacillus_phage	62.6	1.8e-46
WP_026587142.1|2326322_2326751_-	helix-turn-helix transcriptional regulator	NA	Q5YAA4	Bacillus_phage	66.7	3.2e-46
2326944:2326958	attL	GATATTAGCATATAT	NA	NA	NA	NA
WP_026587143.1|2327019_2327205_+	helix-turn-helix transcriptional regulator	NA	A0A1C8E998	Bacillus_phage	70.5	1.5e-16
WP_026587144.1|2327210_2327480_+	hypothetical protein	NA	A0A0S2SXU9	Bacillus_phage	56.3	3.1e-23
WP_035428092.1|2327508_2327829_+	hypothetical protein	NA	NA	NA	NA	NA
WP_026587145.1|2328097_2328478_-	DUF2513 domain-containing protein	NA	A0A2I7SCV0	Paenibacillus_phage	42.4	2.0e-20
WP_026587146.1|2328532_2328751_+	hypothetical protein	NA	NA	NA	NA	NA
WP_026587147.1|2328743_2329580_+	replication protein	NA	V9QKF6	Oenococcus_phage	43.1	4.2e-50
WP_026587148.1|2329539_2330388_+	ATP-binding protein	NA	Q9MBR8	Staphylococcus_prophage	32.4	2.6e-23
WP_163170533.1|2330377_2330536_+	hypothetical protein	NA	NA	NA	NA	NA
WP_026587149.1|2330687_2331236_+	hypothetical protein	NA	A0A0K2CNP4	Brevibacillus_phage	43.3	4.0e-09
WP_144620496.1|2331340_2331490_+	BH0509 family protein	NA	NA	NA	NA	NA
WP_026587150.1|2331562_2331763_+	hypothetical protein	NA	A0A2H4J4M6	uncultured_Caudovirales_phage	48.4	1.0e-07
WP_026587151.1|2331798_2332149_+	hypothetical protein	NA	U5PUK4	Bacillus_phage	43.0	1.0e-26
WP_163170534.1|2332145_2332322_+	hypothetical protein	NA	NA	NA	NA	NA
WP_026587152.1|2332391_2333006_+	hypothetical protein	NA	NA	NA	NA	NA
WP_026587153.1|2333258_2333699_+	ArpU family transcriptional regulator	NA	S6AVV9	Thermus_phage	50.4	4.0e-36
WP_026587154.1|2333698_2334241_+|integrase	site-specific integrase	integrase	D2XR58	Bacillus_phage	61.1	1.9e-56
WP_026587155.1|2334468_2335281_+	hypothetical protein	NA	NA	NA	NA	NA
2335072:2335086	attR	GATATTAGCATATAT	NA	NA	NA	NA
WP_026587156.1|2335700_2336174_+	hypothetical protein	NA	NA	NA	NA	NA
WP_026587157.1|2336286_2336910_+	hypothetical protein	NA	NA	NA	NA	NA
WP_026587158.1|2336987_2337545_+	hypothetical protein	NA	NA	NA	NA	NA
WP_026587159.1|2337862_2338813_+	hypothetical protein	NA	NA	NA	NA	NA
WP_026587160.1|2338831_2339491_+	hypothetical protein	NA	NA	NA	NA	NA
WP_152520966.1|2339569_2339848_+	hypothetical protein	NA	NA	NA	NA	NA
WP_026587161.1|2339840_2340215_+	HNH endonuclease	NA	Q38456	Bacillus_phage	82.3	2.3e-61
WP_026587162.1|2340183_2340510_+	transglycosylase	NA	Q9T203	Bacillus_phage	55.6	1.6e-29
WP_026587163.1|2340596_2341130_+|terminase	phage terminase small subunit P27 family	terminase	Q9ZXG2	Bacillus_phage	79.7	6.3e-68
WP_026587164.1|2341129_2342839_+|terminase	terminase large subunit	terminase	D6R3Y4	Bacillus_phage	87.5	9.1e-302
WP_026587165.1|2343026_2344274_+|portal	phage portal protein	portal	D6R3Y6	Bacillus_phage	84.1	2.7e-210
WP_026587166.1|2344263_2344893_+|head,protease	HK97 family phage prohead protease	head,protease	Q9ZXF7	Bacillus_phage	82.3	3.5e-94
WP_081692838.1|2344932_2346138_+|capsid	phage major capsid protein	capsid	Q9ZXF6	Bacillus_phage	62.1	4.3e-133
WP_026587168.1|2346154_2346448_+	hypothetical protein	NA	Q9ZXF5	Bacillus_phage	70.1	5.0e-27
WP_026587169.1|2346473_2346914_+	collagen-like protein	NA	D6R3Z0	Bacillus_phage	51.6	8.7e-15
WP_026587170.1|2346929_2347229_+|head,tail	phage gp6-like head-tail connector protein	head,tail	Q9ZXF3	Bacillus_phage	62.2	1.7e-30
WP_051290371.1|2347209_2347584_+|head	phage head closure protein	head	Q9ZXF2	Bacillus_phage	65.6	3.6e-38
WP_026587171.1|2347576_2347960_+	HK97 gp10 family phage protein	NA	Q9ZXF1	Bacillus_phage	68.5	3.8e-43
WP_026587172.1|2347956_2348337_+	DUF3168 domain-containing protein	NA	Q9ZXF0	Bacillus_phage	55.6	6.7e-32
WP_026587173.1|2348336_2348945_+|tail	major tail protein	tail	Q9ZXE9	Bacillus_phage	54.6	1.8e-55
WP_026587174.1|2349004_2349340_+	hypothetical protein	NA	Q9ZXE8	Bacillus_phage	59.8	2.3e-31
WP_026587175.1|2349342_2349525_+	hypothetical protein	NA	D6R3Z7	Bacillus_phage	64.8	3.7e-12
WP_026587176.1|2349537_2353428_+|tail	phage tail tape measure protein	tail	D6R3Z8	Bacillus_phage	64.7	0.0e+00
WP_026587177.1|2353427_2354264_+|tail	phage tail family protein	tail	D6R3Z9	Bacillus_phage	72.9	1.8e-114
WP_026587178.1|2354276_2355986_+	alkaline phosphatase	NA	D6R400	Bacillus_phage	69.2	4.3e-219
WP_026587179.1|2356022_2358584_+	peptidase G2	NA	D6R401	Bacillus_phage	66.8	0.0e+00
WP_081692864.1|2358599_2359784_+|plate	phage baseplate upper protein	plate	M4ZRP1	Bacillus_phage	49.0	7.4e-61
WP_026587180.1|2359780_2359963_+	XkdX family protein	NA	A0EWM9	Staphylococcus_virus	43.8	3.0e-06
WP_026587181.1|2360025_2360295_+	protein xhlA	NA	A0A2H4JD40	uncultured_Caudovirales_phage	59.6	1.6e-24
WP_026587182.1|2360309_2360573_+|holin	phage holin	holin	A0A2H4J6M0	uncultured_Caudovirales_phage	77.0	7.9e-32
WP_026587183.1|2360621_2361575_+	LysM peptidoglycan-binding domain-containing protein	NA	A0A141HSE6	Bacillus_phage	43.7	8.3e-63
WP_035428318.1|2361638_2361827_-	hypothetical protein	NA	NA	NA	NA	NA
WP_026587185.1|2361876_2363394_-|transposase	transposase	transposase	A0A2I7SCU7	Paenibacillus_phage	54.3	2.5e-16
WP_026587187.1|2363985_2364216_+	DNA-binding protein	NA	A0A2H4JDR0	uncultured_Caudovirales_phage	55.2	1.6e-12
WP_026587188.1|2364238_2364559_-	YolD-like family protein	NA	O64030	Bacillus_phage	36.9	2.2e-12
WP_026587189.1|2364710_2365286_-	hypothetical protein	NA	Q9ZXD6	Bacillus_phage	42.1	3.0e-31
>prophage 6
NZ_CP048273	Bacillus sp. NSP9.1 chromosome, complete genome	4543164	2541407	2550807	4543164		Streptococcus_phage(50.0%)	8	NA	NA
WP_026587350.1|2541407_2543045_-	AMP-binding protein	NA	Q75ZG1	Hepacivirus	28.4	7.6e-48
WP_026587351.1|2543076_2544237_-	acyl-CoA dehydrogenase	NA	NA	NA	NA	NA
WP_026587352.1|2544593_2545865_-	glutamate-5-semialdehyde dehydrogenase	NA	A0A1X9I5D4	Streptococcus_phage	51.4	1.1e-105
WP_026587353.1|2545891_2547013_-	glutamate 5-kinase	NA	A0A1X9I5D0	Streptococcus_phage	42.4	6.8e-72
WP_026587354.1|2547053_2547905_-	pyrroline-5-carboxylate reductase	NA	A0A1X9I6T5	Streptococcus_phage	33.2	1.1e-26
WP_026587356.1|2548234_2548912_-	DUF421 domain-containing protein	NA	NA	NA	NA	NA
WP_026587357.1|2549053_2549647_-	adenylyl-sulfate kinase	NA	A0A2K9L4R9	Tupanvirus	41.7	1.2e-27
WP_026587358.1|2549643_2550807_-	sulfate adenylyltransferase	NA	A0A2K9L0F0	Tupanvirus	31.5	3.9e-46
>prophage 7
NZ_CP048273	Bacillus sp. NSP9.1 chromosome, complete genome	4543164	2871076	2877292	4543164		Staphylococcus_phage(66.67%)	9	NA	NA
WP_026587670.1|2871076_2871670_-	SMC-Scp complex subunit ScpB	NA	A0A1B1IVT7	uncultured_Mediterranean_phage	37.0	1.2e-14
WP_026587671.1|2871659_2872418_-	segregation/condensation protein A	NA	A0A1B1IVW1	uncultured_Mediterranean_phage	25.9	3.6e-08
WP_077736562.1|2872598_2872694_+	YjcZ family sporulation protein	NA	NA	NA	NA	NA
WP_026587672.1|2872833_2873361_+	DUF309 domain-containing protein	NA	NA	NA	NA	NA
WP_026587673.1|2873371_2873746_-	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_026587674.1|2873847_2874312_-	6,7-dimethyl-8-ribityllumazine synthase	NA	A0A2H4PQS3	Staphylococcus_phage	71.3	2.6e-46
WP_026587675.1|2874346_2875543_-	bifunctional 3,4-dihydroxy-2-butanone-4-phosphate synthase/GTP cyclohydrolase II	NA	A0A2H4PQS2	Staphylococcus_phage	53.9	4.8e-116
WP_026587676.1|2875562_2876210_-	riboflavin synthase	NA	A0A2H4PQS5	Staphylococcus_phage	40.6	6.3e-38
WP_035428352.1|2876221_2877292_-	bifunctional diaminohydroxyphosphoribosylaminopyrimidine deaminase/5-amino-6-(5-phosphoribosylamino)uracil reductase RibD	NA	A0A2H4PQS8	Staphylococcus_phage	38.4	6.1e-62
>prophage 8
NZ_CP048273	Bacillus sp. NSP9.1 chromosome, complete genome	4543164	3849463	3859361	4543164		Synechococcus_phage(50.0%)	9	NA	NA
WP_026589686.1|3849463_3851002_-	bifunctional phosphoribosylaminoimidazolecarboxamide formyltransferase/IMP cyclohydrolase	NA	Q58MG4	Prochlorococcus_phage	53.0	5.1e-78
WP_026589687.1|3850998_3851586_-	phosphoribosylglycinamide formyltransferase	NA	M4QRX9	Synechococcus_phage	37.3	2.3e-26
WP_026589688.1|3851582_3852623_-	phosphoribosylformylglycinamidine cyclo-ligase	NA	A0A0E3F760	Synechococcus_phage	42.5	1.6e-62
WP_026589689.1|3852720_3854151_-	amidophosphoribosyltransferase	NA	A0A0M3SGR2	Mollivirus	32.1	2.5e-50
WP_026589690.1|3854126_3856355_-	phosphoribosylformylglycinamidine synthase subunit PurL	NA	A6N228	Microbacterium_phage	41.7	1.7e-162
WP_026589691.1|3856338_3857022_-	phosphoribosylformylglycinamidine synthase subunit PurQ	NA	NA	NA	NA	NA
WP_026589692.1|3857018_3857273_-	phosphoribosylformylglycinamidine synthase subunit PurS	NA	A0A0E3FJ99	Synechococcus_phage	34.6	8.0e-05
WP_026589693.1|3857274_3857991_-	phosphoribosylaminoimidazolesuccinocarboxamide synthase	NA	A0A0E3G7P8	Synechococcus_phage	43.2	4.8e-47
WP_026589694.1|3858065_3859361_-	adenylosuccinate lyase	NA	A0A2H4UUU6	Bodo_saltans_virus	26.8	7.7e-19
>prophage 9
NZ_CP048273	Bacillus sp. NSP9.1 chromosome, complete genome	4543164	4255066	4261448	4543164	protease	Caulobacter_phage(50.0%)	7	NA	NA
WP_026585807.1|4255066_4256176_-|protease	cysteine protease StiP family protein	protease	A0A172Q0S8	Acinetobacter_phage	33.8	6.1e-41
WP_035427883.1|4256165_4257488_-	hypothetical protein	NA	A0A172Q0Y1	Acinetobacter_phage	27.2	2.8e-08
WP_026585806.1|4257477_4258671_-	HpcH/HpaI aldolase/citrate lyase family protein	NA	NA	NA	NA	NA
WP_026585805.1|4258756_4259530_-	TerC family protein	NA	S5MAL1	Bacillus_phage	65.2	1.8e-79
WP_026585804.1|4259600_4260179_-	TerD family protein	NA	K4JRX3	Caulobacter_phage	35.7	5.3e-28
WP_026585803.1|4260236_4260818_-	TerD family protein	NA	K4JRX3	Caulobacter_phage	39.9	3.7e-29
WP_026585802.1|4260845_4261448_-	TerD family protein	NA	K4JRX3	Caulobacter_phage	30.5	2.2e-24
