The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
NZ_CP023541	Escherichia coli O104:H21 str. CFSAN002236 strain ATCC BAA-178 chromosome, complete genome	4884467	1297769	1370495	4884467	head,integrase,lysis,terminase,tail,transposase,tRNA,protease	Enterobacteria_phage(36.11%)	74	1333793:1333839	1361969:1362015
WP_001157961.1|1297769_1298864_-|tRNA	tRNA 2-selenouridine(34) synthase MnmH	tRNA	NA	NA	NA	NA
WP_000460145.1|1298932_1299859_-	HTH-type transcriptional activator AllS	NA	NA	NA	NA	NA
WP_000776388.1|1300088_1300571_+	ureidoglycolate lyase	NA	NA	NA	NA	NA
WP_000141276.1|1300648_1301464_+	HTH-type transcriptional repressor AllR	NA	NA	NA	NA	NA
WP_021293187.1|1301553_1303335_+	glyoxylate carboligase	NA	E4WLQ6	Ostreococcus_tauri_virus	27.1	1.2e-38
WP_000943556.1|1303347_1304124_+	hydroxypyruvate isomerase	NA	NA	NA	NA	NA
WP_000765839.1|1304223_1305102_+	2-hydroxy-3-oxopropionate reductase	NA	NA	NA	NA	NA
WP_021293188.1|1305270_1306725_+	putative allantoin permease	NA	NA	NA	NA	NA
WP_000878014.1|1306927_1307947_+|transposase	IS110 family transposase	transposase	NA	NA	NA	NA
WP_000006887.1|1308226_1309588_+	allantoinase AllB	NA	NA	NA	NA	NA
WP_001371630.1|1309644_1310946_+	uracil/xanthine transporter	NA	NA	NA	NA	NA
WP_000706355.1|1310967_1312113_+	glycerate 3-kinase	NA	W6LM47	Streptococcus_phage	41.9	1.8e-48
WP_000540949.1|1312340_1313126_-	(S)-ureidoglycine aminohydrolase	NA	NA	NA	NA	NA
WP_001377891.1|1313136_1314372_-	allantoate deiminase	NA	NA	NA	NA	NA
WP_000703909.1|1314393_1315443_-	ureidoglycolate dehydrogenase	NA	NA	NA	NA	NA
WP_000580860.1|1315759_1317427_+	acyl-CoA synthetase FdrA	NA	NA	NA	NA	NA
WP_000495408.1|1317436_1318696_+	DUF1116 domain-containing protein	NA	NA	NA	NA	NA
WP_031314883.1|1318706_1319501_+	DUF2877 domain-containing protein	NA	NA	NA	NA	NA
WP_032317192.1|1319518_1320412_+	carbamate kinase	NA	NA	NA	NA	NA
WP_021292879.1|1320548_1321616_-	5-(carboxyamino)imidazole ribonucleotide synthase	NA	NA	NA	NA	NA
WP_001295318.1|1321612_1322122_-	5-(carboxyamino)imidazole ribonucleotide mutase	NA	NA	NA	NA	NA
WP_000212252.1|1322239_1322962_-	UDP-2,3-diacylglucosamine diphosphatase	NA	NA	NA	NA	NA
WP_000256002.1|1322964_1323459_-	peptidylprolyl isomerase B	NA	NA	NA	NA	NA
WP_000912345.1|1323632_1325018_+|tRNA	cysteine--tRNA ligase	tRNA	M1PG92	Moumouvirus	34.8	3.9e-45
WP_001143552.1|1325053_1325575_-	metal-dependent hydrolase	NA	NA	NA	NA	NA
WP_000190288.1|1325682_1325895_-	ribosome-associated protein YbcJ	NA	NA	NA	NA	NA
WP_000729160.1|1325896_1326763_-	bifunctional methylenetetrahydrofolate dehydrogenase/methenyltetrahydrofolate cyclohydrolase FolD	NA	A0A249XZQ2	Enterococcus_phage	37.5	1.7e-30
WP_000776555.1|1327242_1327785_+	type 1 fimbrial protein subunit FimA	NA	NA	NA	NA	NA
WP_000988366.1|1328004_1328697_+	type 1 fimbria chaperone FimC	NA	NA	NA	NA	NA
WP_024199693.1|1328727_1331337_+	fimbrial biogenesis usher protein	NA	NA	NA	NA	NA
WP_021292878.1|1331349_1332357_+	type 1 fimbrin D-mannose specific adhesin FimH	NA	NA	NA	NA	NA
WP_001255228.1|1332367_1332883_+	fimbria assembly protein	NA	NA	NA	NA	NA
WP_021292877.1|1332885_1333518_-	fimbria biosynthesis transcriptional regulator FimZ	NA	NA	NA	NA	NA
1333793:1333839	attL	CTTCTAAGTCGTGGGCCGCAGGTTCGAATCCTGCAGGGCGCGCCATT	NA	NA	NA	NA
WP_000051902.1|1333852_1335016_-|integrase	site-specific integrase	integrase	A0A088CD23	Shigella_phage	86.6	3.0e-200
WP_000206811.1|1335242_1335548_-	hypothetical protein	NA	U5P0J0	Shigella_phage	96.0	4.9e-49
WP_021292876.1|1335547_1335910_-	phage protein	NA	K7PH61	Enterobacteria_phage	97.4	1.9e-63
WP_000008165.1|1335900_1336437_-	5'-deoxynucleotidase	NA	U5P0T3	Shigella_phage	98.3	4.8e-100
WP_000081287.1|1336564_1337389_-	DUF2303 family protein	NA	U5P439	Shigella_phage	100.0	6.0e-150
WP_001546523.1|1337454_1337817_-	hypothetical protein	NA	U5P4J6	Shigella_phage	99.2	3.3e-60
WP_000559922.1|1338286_1338802_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000848748.1|1339016_1339691_-	LexA family transcriptional repressor	NA	U5P0T5	Shigella_phage	100.0	1.2e-132
WP_000649477.1|1339781_1339982_+	transcriptional regulator	NA	U5P445	Shigella_phage	100.0	7.9e-32
WP_000515829.1|1340025_1340583_+	protein YmfL	NA	S5FXP0	Shigella_phage	96.2	1.1e-96
WP_001250269.1|1340758_1340938_+	DUF4222 domain-containing protein	NA	S5M7S5	Escherichia_phage	68.5	7.8e-15
WP_001356227.1|1340927_1341869_+	helix-turn-helix domain-containing protein	NA	U5P0A0	Shigella_phage	93.0	4.9e-140
WP_001300314.1|1341865_1342360_+	PerC family transcriptional regulator	NA	A0A0P0ZCF0	Stx2-converting_phage	98.1	3.6e-86
WP_001204780.1|1343094_1343478_+	antitermination protein QuuD	NA	A0A088CD47	Shigella_phage	84.2	4.0e-56
WP_000737283.1|1343667_1344765_-	porin	NA	Q1MVN1	Enterobacteria_phage	76.3	4.8e-155
WP_000670959.1|1345353_1345569_+|lysis	phage lysis protein EssD	lysis	A5LH82	Enterobacteria_phage	98.6	3.4e-33
WP_001135281.1|1345568_1346066_+	lysozyme RrrD	NA	M1FJA0	Enterobacteria_phage	98.2	1.1e-90
WP_001228697.1|1346282_1346465_+|lysis	prophage lysis lipoprotein RzoD	lysis	K7PHU6	Enterobacteria_phage	78.3	1.4e-16
WP_000738500.1|1346555_1346849_-	serum resistance lipoprotein Bor	NA	A0A2R2X2B2	Escherichia_phage	97.9	5.7e-47
WP_001403557.1|1347139_1347550_-	DUF1398 domain-containing protein	NA	C6ZCX4	Enterobacteria_phage	99.3	9.4e-72
WP_001031427.1|1347835_1348042_+	hypothetical protein	NA	A0A0K2FJ18	Enterobacteria_phage	100.0	5.8e-30
WP_001300120.1|1348206_1348401_-	YlcI/YnfO family protein	NA	A0A0K2FIR8	Escherichia_phage	98.4	1.5e-27
WP_000453576.1|1348789_1349335_+	DNA-packaging protein	NA	A0A0K2FIG2	Enterobacteria_phage	99.4	4.7e-95
WP_021292874.1|1349309_1350854_+|terminase	phage terminase large subunit family protein	terminase	A0A0K2FJ14	Enterobacteria_phage	99.4	1.6e-305
WP_000198149.1|1350807_1351014_+|head,tail	Lambda prophage-derived head-to-tail joining protein W	head,tail	A0A2R9YJL2	Escherichia_phage	100.0	5.8e-30
WP_000847355.1|1351954_1352284_+|tail	phage tail protein	tail	A0A2R9YJM0	Escherichia_phage	96.3	1.5e-56
WP_016230622.1|1352283_1352982_+|tail	phage minor tail protein L	tail	A0A0K2FJ01	Enterobacteria_phage	98.7	6.2e-132
WP_001441739.1|1352987_1353731_+|tail	phage tail protein	tail	K7PLW1	Enterobacteria_phage	97.2	1.1e-147
WP_000090891.1|1353667_1354300_+|tail	tail assembly protein	tail	A0A2R9YJH6	Escherichia_phage	99.5	2.2e-96
WP_000885616.1|1355348_1355924_+|tail	tail fiber assembly protein	tail	K7PMH7	Enterobacteria_phage	95.3	6.5e-103
WP_000086514.1|1356019_1356610_-	recombinase family protein	NA	A0A0A7NPV4	Enterobacteria_phage	38.8	7.3e-25
WP_000836768.1|1356926_1357160_-	cold shock protein YdfK	NA	A0A192Y6D5	Salmonella_phage	88.3	1.1e-32
WP_120795384.1|1357228_1357342_-	Rac prophage; protein YnaM	NA	A0A1C9IHU6	Salmonella_phage	80.6	8.4e-07
WP_000239874.1|1357707_1358376_-	class I SAM-dependent methyltransferase	NA	NA	NA	NA	NA
WP_001226378.1|1358921_1360406_-	alpha/beta hydrolase	NA	NA	NA	NA	NA
WP_001201825.1|1360592_1361546_-|protease	omptin family outer membrane protease OmpT	protease	NA	NA	NA	NA
WP_001177469.1|1362058_1362820_-	DNA-binding transcriptional regulator EnvY	NA	NA	NA	NA	NA
1361969:1362015	attR	CTTCTAAGTCGTGGGCCGCAGGTTCGAATCCTGCAGGGCGCGCCATT	NA	NA	NA	NA
WP_021292871.1|1363002_1363893_-	DUF4434 family protein	NA	NA	NA	NA	NA
WP_032317189.1|1363893_1366866_-	bacteriophage adsorption protein NfrA	NA	NA	NA	NA	NA
WP_000383951.1|1366852_1369090_-	phage adsorption protein NrfB	NA	NA	NA	NA	NA
WP_000394594.1|1369358_1370495_-|transposase	ISAs1 family transposase	transposase	NA	NA	NA	NA
>prophage 2
NZ_CP023541	Escherichia coli O104:H21 str. CFSAN002236 strain ATCC BAA-178 chromosome, complete genome	4884467	1969255	1983504	4884467	head,portal,integrase,terminase,capsid,protease	uncultured_Caudovirales_phage(92.31%)	23	1969177:1969191	1970533:1970547
1969177:1969191	attL	TTGTTTCACGTTGTA	NA	NA	NA	NA
WP_032317082.1|1969255_1970485_+|integrase	site-specific integrase	integrase	A0A2H4JB45	uncultured_Caudovirales_phage	55.6	3.4e-133
WP_000953271.1|1970859_1971048_+	AlpA family transcriptional regulator	NA	A0A2H4JB58	uncultured_Caudovirales_phage	64.2	5.9e-13
1970533:1970547	attR	TACAACGTGAAACAA	NA	NA	NA	NA
WP_000182306.1|1971291_1971495_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000103621.1|1971552_1971732_-	hypothetical protein	NA	A0A2H4JB52	uncultured_Caudovirales_phage	58.6	1.5e-10
WP_000201463.1|1972237_1972417_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001398590.1|1972609_1973173_+	host cell division inhibitor Icd-like protein	NA	Q8SBF3	Shigella_phage	40.0	8.0e-13
WP_032279725.1|1973159_1973360_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000728896.1|1973365_1973665_+	DUF4222 domain-containing protein	NA	NA	NA	NA	NA
WP_000833612.1|1973661_1975059_+	AAA family ATPase	NA	A0A2H4JFA4	uncultured_Caudovirales_phage	49.2	1.5e-113
WP_001288030.1|1975249_1975513_+	hypothetical protein	NA	NA	NA	NA	NA
WP_021293490.1|1975509_1975824_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000126663.1|1975833_1976244_+	single-stranded DNA-binding protein	NA	NA	NA	NA	NA
WP_000233314.1|1976254_1976503_+	PerC family transcriptional regulator	NA	NA	NA	NA	NA
WP_001142405.1|1976644_1976869_+	hypothetical protein	NA	NA	NA	NA	NA
WP_021293489.1|1977161_1978319_+|capsid	phage major capsid protein	capsid	A0A2H4JED2	uncultured_Caudovirales_phage	64.9	6.2e-137
WP_000504057.1|1978358_1978931_+|head,protease	HK97 family phage prohead protease	head,protease	A0A2H4JB68	uncultured_Caudovirales_phage	63.0	3.6e-61
WP_000267604.1|1978932_1980144_+|portal	phage portal protein	portal	A0A2H4JFJ9	uncultured_Caudovirales_phage	79.2	9.6e-189
WP_001020660.1|1980140_1980479_+|head	phage head closure protein	head	A0A2H4JHK5	uncultured_Caudovirales_phage	52.7	1.9e-30
WP_000134113.1|1980475_1980772_+	hypothetical protein	NA	A0A2H4JD08	uncultured_Caudovirales_phage	65.3	4.0e-32
WP_001145905.1|1980771_1981212_+	HNH endonuclease	NA	A0A2H4JAS8	uncultured_Caudovirales_phage	72.6	2.5e-62
WP_000174068.1|1981195_1981378_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000113645.1|1981502_1981859_+|terminase	phage terminase small subunit P27 family	terminase	A0A2H4JHS3	uncultured_Caudovirales_phage	81.4	9.4e-52
WP_021292931.1|1981842_1983504_+|terminase	terminase large subunit	terminase	A0A2H4JB64	uncultured_Caudovirales_phage	81.0	8.3e-276
>prophage 3
NZ_CP023541	Escherichia coli O104:H21 str. CFSAN002236 strain ATCC BAA-178 chromosome, complete genome	4884467	2093003	2160410	4884467	head,integrase,terminase,tail,capsid,protease,holin	Stx2-converting_phage(28.57%)	74	2092840:2092867	2146605:2146632
2092840:2092867	attL	CAGTGTGGTACATGGATATCGATACCAC	NA	NA	NA	NA
WP_024199680.1|2093003_2094134_-|integrase	tyrosine-type recombinase/integrase	integrase	O21940	Phage_21	51.7	1.8e-104
WP_000113186.1|2094111_2094360_-	excisionase	NA	NA	NA	NA	NA
WP_021293386.1|2094424_2096896_-	exonuclease	NA	A0A192Y6E0	Salmonella_phage	56.6	2.0e-55
WP_000092782.1|2096991_2097180_-	DUF1482 family protein	NA	NA	NA	NA	NA
WP_000450222.1|2097176_2097365_-	cell division inhibitor	NA	NA	NA	NA	NA
WP_024199679.1|2098149_2098518_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000380317.1|2098529_2098682_-	DUF1391 family protein	NA	M4QQ57	Salicola_phage	53.2	5.1e-07
WP_021293150.1|2098846_2099254_-	helix-turn-helix domain-containing protein	NA	K7PM82	Enterobacteria_phage	53.1	2.9e-12
WP_021293151.1|2099337_2099568_+	dicB transcriptional regulator DicC	NA	NA	NA	NA	NA
WP_000705131.1|2099551_2100073_+	hypothetical protein	NA	NA	NA	NA	NA
WP_032317158.1|2100053_2101019_+	phage O protein family	NA	U5P0A0	Shigella_phage	60.6	1.9e-54
WP_021293152.1|2101025_2101766_+	ATP-binding protein	NA	A0A088CBP4	Shigella_phage	82.3	5.8e-112
WP_000450858.1|2101795_2102557_+	DUF1627 domain-containing protein	NA	A0A088CE47	Shigella_phage	64.0	8.4e-74
WP_000215513.1|2102616_2102811_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000211993.1|2103152_2103704_+	ORF6N domain-containing protein	NA	A0A0N7C203	Escherichia_phage	53.3	5.5e-43
WP_000882661.1|2103918_2104131_+	type I toxin-antitoxin system Hok family toxin	NA	A0A0U2QV81	Escherichia_phage	94.3	5.6e-28
WP_000042395.1|2104233_2104551_-	DNA-binding transcriptional regulator	NA	NA	NA	NA	NA
WP_000701093.1|2105172_2105367_+	hypothetical protein	NA	NA	NA	NA	NA
WP_024199763.1|2105420_2105690_+	hypothetical protein	NA	I6PCV7	Cronobacter_phage	52.5	1.2e-11
WP_021293154.1|2105691_2106741_+	DUF968 domain-containing protein	NA	U5P0K4	Shigella_phage	54.3	4.5e-110
WP_000904136.1|2106753_2107116_+	RusA family crossover junction endodeoxyribonuclease	NA	V5URS4	Shigella_phage	61.9	2.4e-34
WP_021293385.1|2107108_2107774_+	antiterminator	NA	I6PDF8	Cronobacter_phage	51.6	4.6e-60
WP_000342737.1|2108027_2108741_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000917733.1|2108914_2109112_+	hypothetical protein	NA	S5MQK8	Escherichia_phage	96.9	6.8e-28
WP_039259629.1|2109281_2110322_+	site-specific DNA-methyltransferase	NA	S5MDR0	Escherichia_phage	98.6	3.8e-202
WP_000271631.1|2110801_2111230_+	cell envelope integrity protein TolA	NA	NA	NA	NA	NA
WP_000382065.1|2111925_2112651_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_039259635.1|2114513_2116478_+	SASA family carbohydrate esterase	NA	A0A0P0ZBH7	Stx2-converting_phage	79.1	2.2e-296
WP_000142780.1|2116612_2116792_+	DUF1378 family protein	NA	A0A2R2Z345	Escherichia_phage	93.2	5.4e-24
WP_001290207.1|2116832_2117105_+	DUF826 domain-containing protein	NA	A0A0P0ZC09	Stx2-converting_phage	95.6	1.3e-21
WP_000284506.1|2117181_2117397_+|holin	holin	holin	Q9ZWW2	Enterobacteria_phage	100.0	6.9e-34
WP_001041945.1|2117400_2118192_+	DUF1327 domain-containing protein	NA	Q08JA0	Stx2-converting_phage	85.5	5.7e-33
WP_001092875.1|2118703_2119237_+	lysozyme	NA	Q08J98	Stx2-converting_phage	95.5	1.1e-99
WP_000788411.1|2119429_2119576_+	hypothetical protein	NA	NA	NA	NA	NA
WP_071974579.1|2119944_2120151_+	hypothetical protein	NA	H6WRZ6	Salmonella_phage	63.2	4.6e-11
WP_000735655.1|2120215_2120440_+	hypothetical protein	NA	NA	NA	NA	NA
WP_021293099.1|2120784_2121111_+	TonB family protein	NA	H6WZK5	Escherichia_phage	97.2	3.2e-54
WP_000095744.1|2121242_2121443_-	YlcI/YnfO family protein	NA	H6WZK6	Escherichia_phage	97.0	1.3e-29
WP_000829191.1|2121484_2121850_+	HNH endonuclease	NA	B6ETE5	Enterobacteria_phage	95.9	1.0e-61
WP_000958387.1|2122138_2122702_+|terminase	terminase small subunit	terminase	A0A0N7KZJ8	Stx2-converting_phage	100.0	8.1e-90
WP_001376400.1|2122698_2124360_+|terminase	terminase large subunit	terminase	A0A0P0ZEI4	Stx2-converting_phage	99.8	0.0e+00
WP_000172990.1|2124423_2126361_+|capsid	phage major capsid protein	capsid	Q6H9U8	Enterobacteria_phage	99.7	0.0e+00
WP_001063099.1|2126405_2126627_+	hypothetical protein	NA	B6DZA0	Enterobacteria_phage	100.0	5.8e-36
WP_000125990.1|2129153_2129480_+|head,tail	phage gp6-like head-tail connector protein	head,tail	A0A0P0ZBH1	Stx2-converting_phage	100.0	9.2e-54
WP_001029274.1|2129489_2129840_+|head	phage head closure protein	head	A0A0P0ZB28	Stx2-converting_phage	99.1	6.0e-59
WP_000573358.1|2129836_2130283_+	HK97 gp10 family phage protein	NA	A0A0N7KZI9	Stx2-converting_phage	99.3	2.0e-75
WP_000133383.1|2130279_2130624_+	DUF3168 domain-containing protein	NA	A0A0P0ZC17	Stx2-converting_phage	99.1	4.2e-57
WP_001275432.1|2130690_2131407_+|tail	tail protein	tail	A0A0P0ZDV1	Stx2-converting_phage	99.6	6.2e-127
WP_000710934.1|2131421_2131796_+|tail	tail assembly protein	tail	A0A0P0ZE84	Stx2-converting_phage	99.2	7.8e-65
WP_122993267.1|2131891_2132101_+	DUF4035 domain-containing protein	NA	H6WZM0	Escherichia_phage	98.6	1.5e-33
WP_000212965.1|2132148_2135391_+|tail	phage tail tape measure protein	tail	A0A0P0ZCJ4	Stx2-converting_phage	89.2	0.0e+00
WP_000343411.1|2135383_2135725_+|tail	phage tail protein	tail	A0A0P0ZDL9	Stx2-converting_phage	82.3	6.9e-52
WP_032308176.1|2135724_2136423_+|tail	phage minor tail protein L	tail	S5M7Q4	Escherichia_phage	97.0	3.4e-130
WP_032308177.1|2136433_2137177_+|tail	phage tail protein	tail	S5MQI8	Escherichia_phage	96.4	1.9e-147
WP_000246333.1|2137074_2137719_+|tail	tail assembly protein	tail	Q9EYE5	Enterobacteria_phage	73.9	1.3e-88
WP_039259655.1|2138629_2142325_+	DUF1983 domain-containing protein	NA	Q6H9T2	Enterobacteria_phage	84.3	0.0e+00
WP_001270056.1|2142393_2143017_+	Ail/Lom family outer membrane beta-barrel protein	NA	A0A1U8QHD6	Enterobacteria_phage	59.9	2.0e-65
WP_000216448.1|2143166_2144435_+|tail	phage tail protein	tail	S5MDN9	Escherichia_phage	99.1	6.5e-55
WP_001049910.1|2144503_2145175_+	DUF4376 domain-containing protein	NA	S5MBX6	Escherichia_phage	82.5	8.1e-105
WP_001079509.1|2146782_2147289_-	ferritin-like domain-containing protein	NA	NA	NA	NA	NA
2146605:2146632	attR	CAGTGTGGTACATGGATATCGATACCAC	NA	NA	NA	NA
WP_001056491.1|2147334_2147835_-	ferritin-like domain-containing protein	NA	NA	NA	NA	NA
WP_000807651.1|2147920_2148100_-	general stress protein	NA	NA	NA	NA	NA
WP_000443056.1|2148480_2149287_-	tryptophan synthase subunit alpha	NA	NA	NA	NA	NA
WP_000209520.1|2149286_2150480_-	tryptophan synthase subunit beta	NA	NA	NA	NA	NA
WP_001297118.1|2150491_2151850_-	bifunctional indole-3-glycerol-phosphate synthase TrpC/phosphoribosylanthranilate isomerase TrpF	NA	A0A0P0IR83	Acinetobacter_phage	40.7	8.6e-37
WP_000763511.1|2151853_2153449_-	bifunctional anthranilate synthase glutamate amidotransferase component TrpG/anthranilate phosphoribosyltransferase TrpD	NA	A0A0N7IRD9	Acinetobacter_phage	38.5	3.8e-52
WP_001194590.1|2153448_2155011_-	anthranilate synthase component I	NA	NA	NA	NA	NA
WP_001700591.1|2155102_2155147_-	trp operon leader peptide	NA	NA	NA	NA	NA
WP_001285661.1|2155284_2156166_+	5'-3' exoribonuclease	NA	NA	NA	NA	NA
WP_001295575.1|2156162_2156783_+	threonylcarbamoyl-AMP synthase	NA	NA	NA	NA	NA
WP_001291216.1|2156883_2157756_+	23S rRNA pseudouridine(2605) synthase RluB	NA	NA	NA	NA	NA
WP_001278904.1|2157795_2158386_-	cob(I)yrinic acid a,c-diamide adenosyltransferase	NA	NA	NA	NA	NA
WP_000559280.1|2158382_2159141_-	YciK family oxidoreductase	NA	A0A0N9R355	Chrysochromulina_ericina_virus	25.0	1.5e-06
WP_000422045.1|2159360_2160410_+|protease	protease SohB	protease	A0A2H4UUF9	Bodo_saltans_virus	31.5	1.3e-21
>prophage 4
NZ_CP023541	Escherichia coli O104:H21 str. CFSAN002236 strain ATCC BAA-178 chromosome, complete genome	4884467	3001097	3111425	4884467	head,portal,integrase,lysis,terminase,tail,capsid,tRNA,holin	Enterobacteria_phage(42.65%)	112	3058245:3058265	3108931:3108951
WP_000476011.1|3001097_3002459_+|tRNA	tRNA 5-hydroxyuridine modification protein YegQ	tRNA	Q6DW11	Phage_TP	100.0	1.1e-217
WP_000716757.1|3002788_3003106_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000807362.1|3003520_3004420_+	lipid kinase YegS	NA	A0A1V0SBJ0	Catovirus	29.0	1.3e-12
WP_000178552.1|3004501_3005281_-	DeoR/GlpR transcriptional regulator	NA	NA	NA	NA	NA
WP_000844200.1|3005380_3006421_-	galactitol-1-phosphate 5-dehydrogenase	NA	NA	NA	NA	NA
WP_021292845.1|3006468_3007824_-	PTS galactitol transporter subunit IIC	NA	NA	NA	NA	NA
WP_000823272.1|3007827_3008112_-	PTS galactitol transporter subunit IIB	NA	NA	NA	NA	NA
WP_000182904.1|3008142_3008595_-	PTS galactitol transporter subunit IIA	NA	NA	NA	NA	NA
WP_021292846.1|3008604_3009867_-	tagatose-bisphosphate aldolase subunit GatZ	NA	NA	NA	NA	NA
WP_000289788.1|3009895_3010750_-	tagatose-bisphosphate aldolase subunit GatY	NA	NA	NA	NA	NA
WP_000129551.1|3011059_3012112_-	class I fructose-bisphosphate aldolase	NA	NA	NA	NA	NA
WP_000858484.1|3012368_3013646_+	nucleoside permease	NA	NA	NA	NA	NA
WP_001585875.1|3013642_3014647_+	ADP-ribosylglycohydrolase family protein	NA	A0A1S6UB21	Serratia_phage	28.7	2.4e-12
WP_000012008.1|3014643_3015609_+	kinase	NA	NA	NA	NA	NA
WP_000434038.1|3015582_3016329_-	GntR family transcriptional regulator	NA	NA	NA	NA	NA
WP_001297420.1|3016380_3017199_-	glycoside hydrolase family 25 protein	NA	D0R7H8	Paenibacillus_phage	38.5	2.3e-24
WP_000822274.1|3017263_3018064_-	bifunctional hydroxymethylpyrimidine kinase/phosphomethylpyrimidine kinase	NA	NA	NA	NA	NA
WP_001195605.1|3018060_3018849_-	hydroxyethylthiazole kinase	NA	NA	NA	NA	NA
WP_024199760.1|3019188_3019434_+	hypothetical protein	NA	NA	NA	NA	NA
WP_021293134.1|3019629_3020292_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_000005468.1|3020346_3020517_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001306377.1|3020536_3020725_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000065228.1|3022712_3023252_+	recombinase family protein	NA	Q2A092	Sodalis_phage	41.9	4.2e-27
WP_024190854.1|3023418_3023883_-	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_000737404.1|3023993_3024341_+	hypothetical protein	NA	NA	NA	NA	NA
WP_021293132.1|3024729_3026301_-	DUF262 domain-containing protein	NA	E5E3X3	Burkholderia_phage	57.7	2.6e-178
WP_021293394.1|3026400_3027708_-|integrase	tyrosine-type recombinase/integrase	integrase	NA	NA	NA	NA
WP_000019944.1|3027961_3028234_-	Ni(II)/Co(II)-binding transcriptional repressor RcnR	NA	NA	NA	NA	NA
WP_000134569.1|3028354_3029179_+	nickel/cobalt efflux protein RcnA	NA	NA	NA	NA	NA
WP_000153067.1|3029397_3029736_+	Ni(II)/Co(II) efflux transporter accessory subunit RcnB	NA	NA	NA	NA	NA
WP_000405711.1|3029817_3030852_-	putative fimbrial-like adhesin protein	NA	NA	NA	NA	NA
WP_000945409.1|3030867_3033348_-	fimbrial biogenesis outer membrane usher protein	NA	NA	NA	NA	NA
WP_021293131.1|3033363_3034038_-	fimbria/pilus periplasmic chaperone	NA	NA	NA	NA	NA
WP_000830468.1|3034118_3034661_-	fimbrial protein	NA	NA	NA	NA	NA
WP_001447395.1|3034953_3035235_-	YehE family protein	NA	NA	NA	NA	NA
WP_001005448.1|3035497_3036607_-	iron-sulfur cluster carrier protein ApbC	NA	NA	NA	NA	NA
WP_001295427.1|3036738_3038772_+|tRNA	methionine--tRNA ligase	tRNA	A0A1V0SDF2	Indivirus	27.6	1.8e-54
WP_021293414.1|3038912_3042707_+	WGR and DUF4132 domain-containing protein	NA	NA	NA	NA	NA
WP_021293413.1|3042716_3046349_+	DUF4132 domain-containing protein	NA	NA	NA	NA	NA
WP_000636926.1|3046409_3046730_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000074859.1|3047912_3049001_+	MoxR family ATPase	NA	NA	NA	NA	NA
WP_001294395.1|3049011_3051291_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001292767.1|3051283_3052420_+	VWA domain-containing protein	NA	Q9EYF7	Enterobacteria_phage	97.1	4.6e-161
WP_001295429.1|3054555_3055017_+	YehR family lipoprotein	NA	Q9EYF5	Enterobacteria_phage	100.0	1.9e-76
WP_001295430.1|3055057_3055528_-	DUF1456 family protein	NA	Q9EYF4	Enterobacteria_phage	100.0	1.8e-82
WP_000598641.1|3055574_3056294_-	two-component system response regulator BtsR	NA	NA	NA	NA	NA
WP_001295431.1|3056290_3057976_-	two-component regulatory system sensor histidine kinase BtsS	NA	Q9EYF3	Enterobacteria_phage	99.6	2.5e-304
3058245:3058265	attL	CCCTGTCACGTTACGCGCGTG	NA	NA	NA	NA
WP_001217533.1|3058490_3058739_+	DinI-like family protein	NA	S5MQI1	Escherichia_phage	86.6	1.0e-33
WP_001373129.1|3059008_3059683_-	DUF4376 domain-containing protein	NA	S5MBX6	Escherichia_phage	90.1	3.3e-114
WP_000438829.1|3059694_3059907_-	hypothetical protein	NA	NA	NA	NA	NA
WP_024199706.1|3059916_3061629_-|tail	phage tail protein	tail	S5MDN9	Escherichia_phage	51.7	7.7e-67
WP_000078853.1|3061773_3061914_-	Hok/Gef family protein	NA	S5M7Q0	Escherichia_phage	95.7	2.9e-17
WP_039259876.1|3062112_3065799_-	DUF1983 domain-containing protein	NA	S5MW25	Escherichia_phage	87.9	0.0e+00
WP_122996641.1|3066709_3067342_-|tail	tail assembly protein	tail	Q9EYE5	Enterobacteria_phage	88.6	2.4e-98
WP_000194792.1|3067287_3068031_-|tail	phage tail protein	tail	S5MQI8	Escherichia_phage	96.0	1.8e-145
WP_001373202.1|3068041_3068740_-|tail	phage minor tail protein L	tail	S5M7Q4	Escherichia_phage	97.4	1.2e-130
WP_000847280.1|3068739_3069069_-|tail	phage tail protein	tail	S5MW28	Escherichia_phage	99.1	1.2e-58
WP_000082508.1|3069065_3071645_-|tail	phage tail tape measure protein	tail	S5MBY3	Escherichia_phage	79.8	0.0e+00
WP_000533452.1|3071625_3072039_-|tail	phage tail assembly protein T	tail	S5MDP5	Escherichia_phage	84.8	1.9e-43
WP_001373378.1|3072065_3072497_-|tail	phage minor tail protein G	tail	A0A0K2FIQ8	Enterobacteria_phage	68.1	8.2e-42
WP_000235126.1|3072512_3073262_-|tail	phage tail protein	tail	S5M7Q5	Escherichia_phage	94.4	1.6e-130
WP_000683075.1|3073269_3073665_-|tail	tail protein	tail	A0A2R9YJI2	Escherichia_phage	80.9	2.2e-57
WP_000974993.1|3073661_3074237_-|tail	tail protein	tail	A0A2R9YJK4	Escherichia_phage	57.8	2.9e-50
WP_001204531.1|3074252_3074606_-|tail	tail attachment protein	tail	A0A0K2FJB7	Enterobacteria_phage	69.2	2.8e-40
WP_001373367.1|3074598_3074982_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000522634.1|3075033_3076062_-|capsid	major capsid protein	capsid	C6ZCY2	Enterobacteria_phage	62.2	1.3e-114
WP_000256800.1|3076119_3076467_-|head	head decoration protein	head	A0A2R9YJN3	Escherichia_phage	58.1	2.0e-22
WP_021293161.1|3076502_3078008_-	S49 family peptidase	NA	A0A2I6TC87	Escherichia_phage	53.5	3.0e-99
WP_021293160.1|3077997_3079590_-|portal	phage portal protein	portal	K7P6U7	Enterobacteria_phage	61.6	3.4e-186
WP_000259002.1|3079586_3079793_-|head,tail	head-tail joining protein	head,tail	K7PM10	Enterobacteria_phage	56.9	7.9e-11
WP_096780415.1|3079776_3081747_-|terminase	phage terminase large subunit family protein	terminase	A0A0K2FJ14	Enterobacteria_phage	67.4	3.1e-261
WP_001102148.1|3081676_3082225_-|terminase	terminase small subunit	terminase	A0A0U2S671	Escherichia_phage	82.7	1.0e-57
WP_021293159.1|3082899_3083430_-	Rha family transcriptional regulator	NA	A0A088CBJ5	Shigella_phage	98.9	1.1e-96
WP_032209690.1|3083632_3084070_-|lysis	lysis protein	lysis	A0A0P0ZFH2	Escherichia_phage	97.9	4.7e-69
WP_000443009.1|3084072_3084222_-	hypothetical protein	NA	A0A0P0ZG36	Escherichia_phage	79.6	6.7e-12
WP_001056888.1|3084221_3084794_-	hypothetical protein	NA	A0A088CD55	Shigella_phage	88.4	9.0e-97
WP_001092876.1|3085068_3085602_-	lysozyme	NA	Q6H9V6	Enterobacteria_phage	94.9	6.9e-99
WP_024199769.1|3085736_3086024_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001041949.1|3086112_3086904_-	DUF1327 domain-containing protein	NA	Q08JA0	Stx2-converting_phage	85.5	5.7e-33
WP_000284490.1|3086907_3087123_-|holin	holin	holin	Q9ZWW2	Enterobacteria_phage	98.6	2.0e-33
WP_021293493.1|3087617_3089582_-	SASA family carbohydrate esterase	NA	A0A0P0ZBH7	Stx2-converting_phage	78.8	8.5e-296
WP_021293268.1|3089825_3090149_+	anti-adapter protein IraM	NA	Q8HAJ1	Enterobacteria_phage	98.1	1.0e-60
WP_000738072.1|3090446_3090716_-	Shiga toxin Stx2a subunit B	NA	Q6DWN4	Enterobacteria_phage	100.0	1.2e-43
WP_001365055.1|3090727_3091687_-	Shiga toxin Stx2d subunit A	NA	Q6DWN9	Enterobacteria_phage	100.0	1.6e-175
WP_039259884.1|3092069_3093128_-	site-specific DNA-methyltransferase	NA	A0A0N7KZF8	Stx2-converting_phage	92.3	1.6e-192
WP_000917741.1|3093278_3093476_-	hypothetical protein	NA	A0A0P0ZDH6	Stx2-converting_phage	100.0	8.0e-29
WP_021293442.1|3093710_3094328_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001204795.1|3094394_3094787_-	antitermination protein Q	NA	Q8W638	Enterobacteria_phage	57.6	2.7e-36
WP_021293223.1|3094804_3095794_-	DUF968 domain-containing protein	NA	A0A291AWV9	Escherichia_phage	97.9	5.8e-192
WP_001065352.1|3095846_3096104_-	hypothetical protein	NA	Q8W639	Enterobacteria_phage	71.1	1.2e-21
WP_000203855.1|3096100_3097501_-	replicative DNA helicase	NA	Q8W640	Enterobacteria_phage	92.2	6.4e-245
WP_021293224.1|3097497_3098376_-	ATP-binding protein	NA	Q8W641	Enterobacteria_phage	96.0	3.5e-140
WP_039259893.1|3098386_3099379_-	hypothetical protein	NA	Q8W642	Enterobacteria_phage	90.1	1.3e-53
WP_021293441.1|3099375_3099702_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000618002.1|3099698_3099923_-	hypothetical protein	NA	A0A1C9II64	Salmonella_phage	52.1	9.8e-15
WP_039259895.1|3099919_3100771_-	peptidase	NA	K7PLX4	Enterobacteria_phage	83.6	1.3e-123
WP_000794367.1|3100767_3101592_-	transporter	NA	Q8W644	Enterobacteria_phage	99.6	1.0e-157
WP_021293226.1|3101644_3102352_-	DNA-binding protein	NA	Q8W645	Enterobacteria_phage	80.9	8.5e-105
WP_000944728.1|3102433_3102667_-	Cro/Cl family transcriptional regulator	NA	A0A1B5FPK9	Escherichia_phage	77.0	1.2e-28
WP_000800142.1|3102823_3103513_+	LexA family transcriptional regulator	NA	A0A1B5FPF4	Escherichia_phage	87.8	6.8e-115
WP_021293227.1|3103660_3104362_+	helix-turn-helix domain-containing protein	NA	A0A1B5FPB8	Escherichia_phage	63.6	1.1e-38
WP_000147364.1|3104358_3104559_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000553979.1|3104757_3104940_+	hypothetical protein	NA	Q8W652	Enterobacteria_phage	50.9	3.8e-09
WP_001365075.1|3104945_3105518_+	hypothetical protein	NA	Q8W653	Enterobacteria_phage	71.3	5.5e-78
WP_021293439.1|3105887_3106715_+	hypothetical protein	NA	Q8W654	Enterobacteria_phage	99.3	2.1e-131
WP_024199692.1|3106755_3107127_+	DUF5406 family protein	NA	Q8W655	Enterobacteria_phage	95.1	8.8e-61
WP_001193439.1|3107318_3107573_+	DUF1233 family excisionase	NA	Q859D3	Escherichia_coli_phage	98.8	1.1e-43
WP_021293230.1|3107606_3108893_+|integrase	site-specific integrase	integrase	A0A0N7KZF5	Stx2-converting_phage	99.8	3.8e-252
WP_042101647.1|3108928_3109615_+	HTH-type transcriptional regulator MlrA	NA	Q9EYF2	Enterobacteria_phage	99.5	3.8e-102
3108931:3108951	attR	CCCTGTCACGTTACGCGCGTG	NA	NA	NA	NA
WP_001216963.1|3109674_3109782_+	protein YohO	NA	NA	NA	NA	NA
WP_000783120.1|3109762_3110494_-	glycine betaine ABC transporter permease YehW	NA	NA	NA	NA	NA
WP_000569361.1|3110498_3111425_-	glycine betaine ABC transporter ATP binding protein YehX	NA	G3M9Y6	Bacillus_virus	30.8	1.7e-23
>prophage 5
NZ_CP023541	Escherichia coli O104:H21 str. CFSAN002236 strain ATCC BAA-178 chromosome, complete genome	4884467	3311031	3356529	4884467	portal,head,integrase,terminase,tail,capsid,plate,tRNA,holin	Enterobacteria_phage(86.05%)	54	3314037:3314056	3350589:3350608
WP_001283581.1|3311031_3311844_-|tRNA	tRNA pseudouridine(38-40) synthase TruA	tRNA	NA	NA	NA	NA
WP_001289165.1|3311843_3312857_-	aspartate-semialdehyde dehydrogenase	NA	NA	NA	NA	NA
WP_000004833.1|3312922_3314080_-	4-phosphoerythronate dehydrogenase PdxB	NA	A0A2R8FDS8	Brazilian_cedratvirus	29.1	7.9e-23
3314037:3314056	attL	TTTTCATCAACAAGGATTTT	NA	NA	NA	NA
WP_000023404.1|3314239_3315244_-|integrase	tyrosine-type recombinase/integrase	integrase	A0A0M4RTQ0	Salmonella_phage	55.7	5.8e-99
WP_001390705.1|3315340_3315661_-	helix-turn-helix transcriptional regulator	NA	Q1JS37	Enterobacteria_phage	43.2	1.4e-14
WP_000004249.1|3315774_3316062_+	hypothetical protein	NA	A0A0M4RCW1	Salmonella_phage	52.6	4.3e-23
WP_000200503.1|3316068_3316275_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000813360.1|3316527_3316869_+	DUF4761 family protein	NA	A0A0A7NV42	Enterobacteria_phage	91.4	1.1e-54
WP_000158965.1|3316879_3317167_+	hypothetical protein	NA	A0A0A7NRX5	Enterobacteria_phage	76.8	6.0e-33
WP_000514277.1|3317178_3317421_+	DUF4754 family protein	NA	A0A0A7NQ71	Enterobacteria_phage	100.0	2.3e-38
WP_000021652.1|3317417_3317531_+	hypothetical protein	NA	A0A0A7NPW7	Enterobacteria_phage	97.3	3.3e-11
WP_000985157.1|3317617_3317821_+	hypothetical protein	NA	A0A0A7NPS8	Enterobacteria_phage	83.6	2.5e-25
WP_000153703.1|3317817_3318084_+	winged helix-turn-helix transcriptional regulator	NA	A0A0A7NV47	Enterobacteria_phage	76.1	2.6e-30
WP_000104314.1|3318080_3318380_+	hypothetical protein	NA	A0A0A7NRX6	Enterobacteria_phage	87.9	1.4e-40
WP_157839288.1|3318391_3319009_+	hypothetical protein	NA	S5MQL6	Escherichia_phage	45.7	9.0e-10
WP_000599381.1|3319005_3319371_+	hypothetical protein	NA	A0A0A7NRY1	Enterobacteria_phage	96.7	3.9e-61
WP_014639488.1|3319377_3322185_+	replication endonuclease	NA	A0A0A7NQ77	Enterobacteria_phage	95.9	0.0e+00
WP_021293096.1|3322261_3323221_+	recombinase	NA	A0A0A7NPX4	Enterobacteria_phage	99.4	5.8e-181
WP_000211289.1|3323225_3323537_+	chromosome partitioning protein	NA	A0A0A7NPT5	Enterobacteria_phage	95.1	1.2e-47
WP_001289967.1|3323600_3324191_+	ead/Ea22-like family protein	NA	Q8HAA6	Salmonella_phage	51.3	3.6e-32
WP_000087812.1|3324681_3325728_-|portal	phage portal protein	portal	A0A0A7NPT9	Enterobacteria_phage	100.0	1.5e-206
WP_021293368.1|3325727_3327479_-|terminase	terminase	terminase	A0A0A7NV54	Enterobacteria_phage	97.9	0.0e+00
WP_001262688.1|3327633_3328470_+|capsid	phage capsid scaffolding protein	capsid	A0A0A7NRY7	Enterobacteria_phage	80.6	1.5e-119
WP_021293094.1|3328493_3329546_+|capsid	phage major capsid protein, P2 family	capsid	A0A0A7NQ82	Enterobacteria_phage	96.6	9.5e-193
WP_021293093.1|3329591_3330392_+|terminase	terminase	terminase	A0A0A7NPX9	Enterobacteria_phage	98.9	2.1e-139
WP_000063103.1|3330493_3330988_+|head	head completion/stabilization protein	head	A0A0A7NPU2	Enterobacteria_phage	99.4	1.2e-89
WP_000864901.1|3330987_3331188_+|tail	tail protein	tail	A0A0A7NV57	Enterobacteria_phage	100.0	3.5e-32
WP_000104344.1|3331190_3331514_+|holin	holin	holin	A0A0A7NRY9	Enterobacteria_phage	92.5	4.8e-47
WP_000836746.1|3331568_3332114_+	glycoside hydrolase family 108 protein	NA	A0A0U2S643	Escherichia_phage	86.6	2.4e-91
WP_000780595.1|3332110_3332518_+	DUF2570 domain-containing protein	NA	A0A0A7NPY2	Enterobacteria_phage	94.8	6.1e-63
WP_000920594.1|3332655_3333123_+|tail	phage tail protein	tail	A0A0A7NPU6	Enterobacteria_phage	100.0	2.6e-86
WP_000356343.1|3333115_3333751_+	phage virion morphogenesis protein	NA	A0A0A7NV60	Enterobacteria_phage	99.5	3.1e-114
WP_001271930.1|3333747_3334329_+|plate	phage baseplate assembly protein V	plate	A0A0A7NRZ3	Enterobacteria_phage	97.9	5.6e-102
WP_000213447.1|3334325_3334676_+|plate	baseplate assembly protein	plate	A0A0A7NQ90	Enterobacteria_phage	100.0	9.2e-60
WP_021293092.1|3334679_3335576_+|plate	baseplate assembly protein	plate	A0A0A7NPY5	Enterobacteria_phage	98.3	6.0e-156
WP_021293091.1|3335568_3336099_+|tail	phage tail protein I	tail	A0A0A7NPV1	Enterobacteria_phage	99.4	5.1e-94
WP_021293090.1|3336101_3338213_+|tail	phage tail protein	tail	A0A0A7NV63	Enterobacteria_phage	98.1	5.7e-112
WP_000885631.1|3338212_3338812_+|tail	tail fiber assembly protein	tail	K7PMH7	Enterobacteria_phage	91.7	2.7e-99
WP_001100987.1|3338906_3340085_+	glycosyltransferase family 9 protein	NA	NA	NA	NA	NA
WP_000979954.1|3340181_3340670_-|tail	phage tail protein	tail	A0A0A7NV65	Enterobacteria_phage	100.0	1.6e-86
WP_000853443.1|3340682_3343490_-|tail	phage tail tape measure protein	tail	A0A0A7NRZ9	Enterobacteria_phage	89.7	0.0e+00
WP_000333495.1|3343476_3343632_-|tail	GpE family phage tail protein	tail	A0A0A7NQ96	Enterobacteria_phage	100.0	8.8e-23
WP_000665308.1|3343640_3344006_-|tail	tail protein	tail	A0A0A7NPZ0	Enterobacteria_phage	97.5	3.8e-56
WP_000290450.1|3344060_3344573_-|tail	phage major tail tube protein	tail	A0A0A7NPV8	Enterobacteria_phage	100.0	3.2e-93
WP_000005451.1|3344572_3345757_-|tail	phage tail sheath family protein	tail	A0A0A7NV69	Enterobacteria_phage	98.7	1.1e-224
WP_021293088.1|3345914_3347024_+	phage late control D family protein	NA	A0A0A7NQ97	Enterobacteria_phage	94.0	5.3e-194
WP_021293365.1|3347144_3348167_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001372884.1|3348358_3348619_+	ogr/Delta-like zinc finger family protein	NA	NA	NA	NA	NA
WP_000078920.1|3348809_3348950_+	Hok/Gef family protein	NA	A0A0A7NPZ4	Enterobacteria_phage	100.0	7.0e-19
WP_001173927.1|3349211_3349544_+	zinc ribbon domain-containing protein	NA	NA	NA	NA	NA
WP_000789404.1|3349548_3350442_+	type VI secretion protein	NA	NA	NA	NA	NA
WP_000127781.1|3351700_3352879_-	MFS transporter	NA	NA	NA	NA	NA
3350589:3350608	attR	TTTTCATCAACAAGGATTTT	NA	NA	NA	NA
WP_000817178.1|3353143_3354364_-	beta-ketoacyl-ACP synthase I	NA	NA	NA	NA	NA
WP_000683796.1|3354522_3356529_+|tRNA	bifunctional tRNA (5-methylaminomethyl-2-thiouridine)(34)-methyltransferase MnmD/FAD-dependent 5-carboxymethylaminomethyl-2-thiouridine(34) oxidoreductase MnmC	tRNA	NA	NA	NA	NA
>prophage 6
NZ_CP023541	Escherichia coli O104:H21 str. CFSAN002236 strain ATCC BAA-178 chromosome, complete genome	4884467	3651742	3659506	4884467	transposase,integrase	Escherichia_phage(66.67%)	6	3649530:3649543	3656643:3656656
3649530:3649543	attL	CGACTATTTGAACT	NA	NA	NA	NA
WP_000162574.1|3651742_3652225_+	SsrA-binding protein SmpB	NA	W5RAM5	Staphylococcus_phage	46.8	4.0e-29
WP_001341819.1|3652967_3654197_+|integrase	tyrosine-type recombinase/integrase	integrase	A0A1B5FPC6	Escherichia_phage	100.0	1.5e-234
WP_000448925.1|3654235_3654652_+	hypothetical protein	NA	A0A1B5FPM5	Escherichia_phage	100.0	1.1e-72
WP_000214990.1|3654723_3656472_-	hypothetical protein	NA	A0A1B5FPH1	Escherichia_phage	99.8	0.0e+00
WP_000577254.1|3656473_3658192_-	ATP-binding protein	NA	A0A1B5FPD5	Escherichia_phage	99.8	3.2e-307
3656643:3656656	attR	AGTTCAAATAGTCG	NA	NA	NA	NA
WP_087599250.1|3658343_3659506_-|transposase	IS3-like element IS3 family transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	40.6	3.1e-51
>prophage 7
NZ_CP023541	Escherichia coli O104:H21 str. CFSAN002236 strain ATCC BAA-178 chromosome, complete genome	4884467	3729401	3736541	4884467		Escherichia_phage(83.33%)	6	NA	NA
WP_001272898.1|3729401_3731963_+	DNA mismatch repair protein MutS	NA	E3T5Q7	Cafeteria_roenbergensis_virus	20.6	1.3e-30
WP_001141330.1|3732068_3732725_+	protein-serine/threonine phosphatase	NA	A0A222YWF0	Escherichia_phage	46.7	4.3e-50
WP_001297141.1|3732775_3733543_-	DeoR/GlpR transcriptional regulator	NA	A0A077SK06	Escherichia_phage	56.7	3.3e-70
WP_000847985.1|3733738_3734647_+	NAD(P)-dependent oxidoreductase	NA	A0A077SLF7	Escherichia_phage	76.9	3.0e-118
WP_000590392.1|3734643_3735906_+	3-oxo-tetronate kinase	NA	A0A077SLJ7	Escherichia_phage	61.4	1.3e-135
WP_001278994.1|3735902_3736541_+	aldolase	NA	A0A077SK32	Escherichia_phage	75.0	1.4e-82
>prophage 1
NZ_CP023542	Escherichia coli O104:H21 str. CFSAN002236 strain ATCC BAA-178 plasmid pO104_H21, complete sequence	161452	59312	114319	161452	integrase,protease,transposase	Enterobacteria_phage(15.38%)	49	73929:73988	125521:126027
WP_000878014.1|59312_60332_-|transposase	IS110 family transposase	transposase	NA	NA	NA	NA
WP_077629773.1|60856_61759_-	DUF1281 domain-containing protein	NA	NA	NA	NA	NA
WP_000618108.1|62034_62283_+	DinI-like family protein	NA	Q2A098	Sodalis_phage	46.7	4.1e-14
WP_021293182.1|62279_62717_+	translesion error-prone DNA polymerase V autoproteolytic subunit	NA	A0A1W6JNS2	Morganella_phage	47.6	3.2e-25
WP_000587689.1|64166_64793_+	ParA family plasmid-partitioning AAA ATPase	NA	E5FFJ3	Burkholderia_phage	31.1	2.0e-17
WP_001245884.1|64789_65092_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000194574.1|65731_66322_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000142449.1|66341_66689_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000762580.1|66807_67155_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001283354.1|67172_69053_-	colicin	NA	NA	NA	NA	NA
WP_000448923.1|69331_69997_-	hypothetical protein	NA	NA	NA	NA	NA
WP_024199761.1|70725_72699_+	TonB-dependent receptor	NA	NA	NA	NA	NA
WP_000977390.1|72717_73509_+	DUF4198 domain-containing protein	NA	NA	NA	NA	NA
73929:73988	attL	GTAAGCGTAAACCGACCGCCGTATGTAGCCATTAGACAAGAATTGGTAATTTAGACGCCC	NA	NA	NA	NA
WP_021293190.1|74013_74439_+	IS66 family insertion sequence hypothetical protein	NA	Q6H9S5	Enterobacteria_phage	97.9	3.4e-48
WP_000624677.1|74435_74786_+	IS66 family insertion sequence element accessory protein TnpB	NA	A0A0P0ZBY2	Stx2-converting_phage	66.4	1.8e-39
WP_040118371.1|74816_76409_+|transposase	IS66 family transposase	transposase	A0A0P0ZEB3	Stx2-converting_phage	62.0	3.6e-175
WP_001278818.1|76613_77030_-	recombinase	NA	NA	NA	NA	NA
WP_000688510.1|77022_78003_-	Plasmid segregation protein parM	NA	A0A0A7NPX4	Enterobacteria_phage	51.4	1.7e-79
WP_000030199.1|78417_78726_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001144036.1|78812_79457_-	ParA family protein	NA	NA	NA	NA	NA
WP_000016966.1|79637_80444_-|integrase	phage integrase family protein	integrase	I3WFA4	Macacine_betaherpesvirus	95.6	1.2e-54
WP_021293254.1|80444_80750_-	type II toxin-antitoxin system toxin CcdB	NA	NA	NA	NA	NA
WP_000813639.1|80751_80970_-	type II toxin-antitoxin system antitoxin CcdA	NA	NA	NA	NA	NA
WP_000343102.1|81565_81826_+	hypothetical protein	NA	NA	NA	NA	NA
WP_021293255.1|81822_82413_+	hypothetical protein	NA	NA	NA	NA	NA
WP_033817147.1|82430_82778_-	hypothetical protein	NA	NA	NA	NA	NA
WP_021292998.1|82906_83242_+	colicin transporter	NA	NA	NA	NA	NA
WP_000850413.1|83678_84410_-	complement resistance protein TraT	NA	NA	NA	NA	NA
WP_024199652.1|85580_86558_+	RepB family plasmid replication initiator protein	NA	J9Q7H0	Salmonella_phage	64.5	7.2e-102
WP_040118372.1|87224_87455_-	hypothetical protein	NA	NA	NA	NA	NA
WP_096780417.1|87504_88733_-|transposase	IS3 family transposase	transposase	Q9ZXG3	Shigella_phage	96.3	1.1e-171
WP_021293003.1|88908_89403_-	MarR family transcriptional regulator	NA	NA	NA	NA	NA
WP_021293303.1|89523_90963_-	enterohemolysin T1SS ABC transporter subunit EhxD	NA	NA	NA	NA	NA
WP_072094473.1|90966_93087_-	enterohemolysin T1SS ABC transporter permease/ATPase EhxB	NA	W8CYL7	Bacillus_phage	30.4	9.3e-46
WP_021293304.1|93136_96133_-	enterohemolysin EhxA	NA	NA	NA	NA	NA
WP_001365635.1|96134_96650_-	enterohemolysin-activating lysine-acyltransferase EhxC	NA	NA	NA	NA	NA
WP_040118373.1|97077_97881_-	OmpA family protein	NA	NA	NA	NA	NA
WP_024199654.1|97905_102234_-	hemagglutinin	NA	NA	NA	NA	NA
WP_040118374.1|102250_102532_-	transcriptional regulator	NA	NA	NA	NA	NA
WP_040118375.1|103627_105184_+	L-lactate permease	NA	NA	NA	NA	NA
WP_001102093.1|105234_105954_+	(Fe-S)-binding protein	NA	NA	NA	NA	NA
WP_000054160.1|105964_107380_+	iron-sulfur cluster-binding protein	NA	NA	NA	NA	NA
WP_021293086.1|107384_108083_+	lactate utilization protein C	NA	NA	NA	NA	NA
WP_077787444.1|108426_108891_-|transposase	IS3 family transposase	transposase	A0A2I6AZV9	Macacine_betaherpesvirus	60.1	1.7e-45
WP_000203483.1|109006_109318_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000264906.1|109345_109537_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001379349.1|109546_109912_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000855713.1|110045_110255_+	hypothetical protein	NA	NA	NA	NA	NA
WP_040118376.1|110416_114319_-|protease	serine protease autotransporter EspP	protease	Q9LA58	Enterobacterial_phage	40.5	2.5e-238
125521:126027	attR	GTAAGCGTAAACCGACCGCCGTATGTAGCCATTAGACAAGAATTGGTAATTTAGACGCCCATCTGACACAGACGGACATCTAAGTATGGAATTACAGGACTGGCGAAAAGAACCTCGTAAAAAGTATTCGAATGAATTCAAACTTCGTATGGTGGAACTGGCATCACAACCCGGAGCTTGTGTTGCACAGATTGCACGTGAAAATGGCGTCAATGATAATGTTATTTTCAAATGGCTCAGGCTCTGGCAGAACGAAGGGCGTGTTTCGCGGCGTCTTCCGGTAACGACCTCTTCTGACACTGGCATTGAATTATTACCTGTAGAGATAACGCCGGGTGAACAGAAAGAACCTGTGGCGGCCATTGCGCCGTCTTTATCCACTTCCACTCAGACCAGAGTCAGTGCCAGCTCCTGCAAGGTGGAGTTCCGTCACGGTAACATGACGCTGGAAAATCCTTCACCAGAGCTGCTCACTGTATTGATTCGTGAACTGACCGGGAGGGGAAG	NA	NA	NA	NA
>prophage 2
NZ_CP023542	Escherichia coli O104:H21 str. CFSAN002236 strain ATCC BAA-178 plasmid pO104_H21, complete sequence	161452	118565	131996	161452	transposase	Acinetobacter_phage(22.22%)	10	NA	NA
WP_021293450.1|118565_119948_-	autoagglutinating adhesin Saa	NA	A0A2C9CZB7	Yersinia_phage	34.9	1.8e-05
WP_096780418.1|120357_121519_+|transposase	IS3-like element IS3 family transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	40.6	6.8e-51
WP_001223214.1|122351_124439_+	bifunctional siderophore receptor/adhesin Iha	NA	A0A0P0I887	Acinetobacter_phage	32.2	6.8e-09
WP_001212725.1|124699_125122_-	Exc2 family lipoprotein	NA	NA	NA	NA	NA
WP_021293190.1|125605_126031_+	IS66 family insertion sequence hypothetical protein	NA	Q6H9S5	Enterobacteria_phage	97.9	3.4e-48
WP_000624677.1|126027_126378_+	IS66 family insertion sequence element accessory protein TnpB	NA	A0A0P0ZBY2	Stx2-converting_phage	66.4	1.8e-39
WP_040118371.1|126408_128001_+|transposase	IS66 family transposase	transposase	A0A0P0ZEB3	Stx2-converting_phage	62.0	3.6e-175
WP_001373081.1|128691_129117_-	subtilase AB5 cytotoxin subunit B	NA	A0A0U2KD34	Escherichia_phage	45.2	2.1e-26
WP_000912970.1|129133_130177_-	subtilase AB5 cytotoxin subunit A	NA	A0A1B0T6A2	Bacillus_phage	28.3	3.5e-06
WP_021293235.1|131570_131996_-	IS66 family insertion sequence hypothetical protein	NA	Q6H9S5	Enterobacteria_phage	74.2	9.5e-35
