The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
NC_022269	Vibrio campbellii ATCC BAA-1116 chromosome I, complete sequence	3746887	68914	120389	3746887	transposase	Leptospira_phage(18.18%)	39	NA	NA
WP_011999457.1|68914_70459_-|transposase	IS66 family transposase	transposase	S5VTD3	Leptospira_phage	34.9	2.7e-71
WP_011998799.1|70519_70873_-	IS66 family insertion sequence element accessory protein TnpB	NA	S5VXZ8	Leptospira_phage	44.6	7.0e-15
WP_021017678.1|70869_71181_-	IS66 family insertion sequence hypothetical protein	NA	NA	NA	NA	NA
WP_005428553.1|72961_73588_+	TetR/AcrR family transcriptional regulator	NA	NA	NA	NA	NA
WP_012128249.1|73657_75943_+	acyl-CoA dehydrogenase	NA	NA	NA	NA	NA
WP_005529200.1|76122_77325_+	trans-2-enoyl-CoA reductase family protein	NA	NA	NA	NA	NA
WP_012128248.1|77439_79122_-	aspartate:alanine antiporter	NA	NA	NA	NA	NA
WP_005428550.1|79304_79571_-	GrxA family glutaredoxin	NA	A0A2I7SAE2	Vibrio_phage	74.4	1.7e-26
WP_005444542.1|81253_82108_-	MurR/RpiR family transcriptional regulator	NA	NA	NA	NA	NA
WP_021017679.1|82419_84066_-	putative pyridoxal-dependent aspartate 1-decarboxylase	NA	S4W1T5	Pandoravirus	26.4	2.0e-19
WP_012128245.1|84190_84700_-	hypothetical protein	NA	NA	NA	NA	NA
WP_012128244.1|84909_85815_-	lysine exporter LysO family protein	NA	NA	NA	NA	NA
WP_005529189.1|85922_86843_-	HDOD domain-containing protein	NA	A0A1C3NFB0	Phage_NCTB	22.9	2.7e-10
WP_012128243.1|87213_87801_+	TfoX/Sxy family DNA transformation protein	NA	NA	NA	NA	NA
WP_012128242.1|88015_88564_-	hypothetical protein	NA	NA	NA	NA	NA
WP_012128241.1|88771_89269_-	response regulator	NA	NA	NA	NA	NA
WP_012128240.1|89265_91206_-	cyclic nucleotide-binding domain-containing protein	NA	NA	NA	NA	NA
WP_012128239.1|91391_92654_+	DUF945 family protein	NA	NA	NA	NA	NA
WP_041853175.1|92785_93880_+	3-phosphoserine/phosphohydroxythreonine transaminase	NA	M1Q1P2	Streptococcus_phage	48.2	3.4e-92
WP_012128235.1|95221_97168_+	diguanylate cyclase	NA	NA	NA	NA	NA
WP_012128234.1|97237_97624_-	hypothetical protein	NA	NA	NA	NA	NA
WP_012128233.1|98062_99043_-	transcriptional regulator	NA	NA	NA	NA	NA
WP_012128232.1|99626_100574_-	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_012128228.1|100845_101607_-|transposase	IS5 family transposase	transposase	A0A0N9SHJ4	Paenibacillus_phage	44.0	8.8e-15
WP_012128230.1|102265_103069_+	EAL domain-containing protein	NA	NA	NA	NA	NA
WP_012128228.1|103279_104041_+|transposase	IS5 family transposase	transposase	A0A0N9SHJ4	Paenibacillus_phage	44.0	8.8e-15
WP_012128225.1|105098_106430_+	D-serine ammonia-lyase	NA	NA	NA	NA	NA
WP_012128224.1|106692_108417_-	cysteine/glutathione ABC transporter ATP-binding protein/permease CydC	NA	W8CYL7	Bacillus_phage	27.7	1.9e-25
WP_012128223.1|108409_110197_-	cysteine/glutathione ABC transporter permease/ATP-binding protein CydD	NA	W8CYL7	Bacillus_phage	24.5	4.3e-28
WP_012128222.1|110300_111260_-	thioredoxin-disulfide reductase	NA	A0A2I2L5E1	Orpheovirus	43.9	3.2e-62
WP_012129842.1|111438_112467_-|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_012130156.1|113213_114368_-|transposase	IS110 family transposase	transposase	NA	NA	NA	NA
WP_012128217.1|114540_114798_+	type II toxin-antitoxin system Phd/YefM family antitoxin	NA	NA	NA	NA	NA
WP_012128216.1|114785_115088_+	type II toxin-antitoxin system RelE/ParE family toxin	NA	NA	NA	NA	NA
WP_080514140.1|115125_115242_+	DUF3265 domain-containing protein	NA	NA	NA	NA	NA
WP_012128212.1|117624_117906_+	type II toxin-antitoxin system Phd/YefM family antitoxin	NA	NA	NA	NA	NA
WP_012128211.1|117902_118190_+	type II toxin-antitoxin system RelE/ParE family toxin	NA	NA	NA	NA	NA
WP_012128210.1|118581_119163_-	DUF2913 family protein	NA	NA	NA	NA	NA
WP_021017684.1|119375_120389_-|transposase	IS110 family transposase	transposase	NA	NA	NA	NA
>prophage 2
NC_022269	Vibrio campbellii ATCC BAA-1116 chromosome I, complete sequence	3746887	217790	277602	3746887	transposase,tRNA	Enterobacteria_phage(20.0%)	49	NA	NA
WP_011999328.1|217790_218990_+|transposase	IS4 family transposase	transposase	A0A0F7LAS3	uncultured_marine_virus	48.0	5.2e-102
WP_162471671.1|219165_219900_-	type IV pilus biogenesis/stability protein PilW	NA	NA	NA	NA	NA
WP_005433939.1|221480_222422_-	homoserine O-succinyltransferase	NA	NA	NA	NA	NA
WP_041853335.1|223849_225160_+	group II intron reverse transcriptase/maturase	NA	NA	NA	NA	NA
WP_021017700.1|225479_225881_+	hypothetical protein	NA	NA	NA	NA	NA
WP_012128126.1|225880_226360_+	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_012128125.1|226533_227226_+	hypothetical protein	NA	NA	NA	NA	NA
WP_005433741.1|227358_227712_+	multidrug efflux SMR transporter	NA	NA	NA	NA	NA
WP_012128124.1|227782_229210_-	amino acid permease	NA	NA	NA	NA	NA
WP_012128122.1|229733_230363_-	LysE family translocator	NA	NA	NA	NA	NA
WP_012128121.1|230793_231741_+	LpxL/LpxP family Kdo(2)-lipid IV(A) lauroyl/palmitoleoyl acyltransferase	NA	A0A1W6JP29	Morganella_phage	42.2	9.5e-59
WP_021017701.1|231842_232286_+	fosfomycin resistance glutathione transferase	NA	NA	NA	NA	NA
WP_011999348.1|232254_233448_-|transposase	IS4 family transposase	transposase	A4KWT9	Enterobacteria_phage	38.4	1.3e-68
WP_012128119.1|233591_234113_+	RNA 2',3'-cyclic phosphodiesterase	NA	NA	NA	NA	NA
WP_012128118.1|234170_234743_+	hypothetical protein	NA	NA	NA	NA	NA
WP_012128117.1|234792_236265_-	carboxypeptidase M32	NA	NA	NA	NA	NA
WP_012128116.1|236681_237317_+	LysE family translocator	NA	NA	NA	NA	NA
WP_012128115.1|237316_237883_+	hypothetical protein	NA	NA	NA	NA	NA
WP_012128114.1|237965_239435_-	aerolysin family beta-barrel pore-forming toxin	NA	NA	NA	NA	NA
WP_012128113.1|239719_240388_-	ParA family protein	NA	NA	NA	NA	NA
WP_012128112.1|240571_242044_-	aerolysin family beta-barrel pore-forming toxin	NA	NA	NA	NA	NA
WP_005433926.1|242547_243009_-	hypothetical protein	NA	NA	NA	NA	NA
WP_012128111.1|243005_243758_-	winged helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_005433933.1|244200_245577_-	sodium:alanine symporter family protein	NA	NA	NA	NA	NA
WP_005434065.1|246324_246483_+	hypothetical protein	NA	NA	NA	NA	NA
WP_005434001.1|246514_247249_+	chromosome segregation ATPase	NA	NA	NA	NA	NA
WP_021017703.1|247360_247744_-	hypothetical protein	NA	NA	NA	NA	NA
WP_021017704.1|247870_248233_-	glyoxalase	NA	NA	NA	NA	NA
WP_012128108.1|248346_250284_-	LTA synthase family protein	NA	NA	NA	NA	NA
WP_080654496.1|250523_251540_-|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_012128105.1|251790_252873_+	hypothetical protein	NA	NA	NA	NA	NA
WP_012128104.1|252869_254771_+	DUF3857 and transglutaminase domain-containing protein	NA	NA	NA	NA	NA
WP_012128103.1|255105_256479_+|tRNA	cysteine--tRNA ligase	tRNA	F1C979	Terra1_virus	31.3	1.1e-34
WP_012128101.1|257572_259453_+	cyclic nucleotide-binding/CBS domain-containing protein	NA	NA	NA	NA	NA
WP_012128100.1|259449_260199_+	3'-5' exonuclease	NA	NA	NA	NA	NA
WP_005433884.1|260435_262100_+	BCCT family transporter	NA	A0A2I7QNT1	Vibrio_phage	25.1	3.2e-25
WP_041853181.1|262443_262977_+	diaminobutyrate acetyltransferase	NA	NA	NA	NA	NA
WP_012128097.1|263010_264276_+	diaminobutyrate--2-oxoglutarate transaminase	NA	NA	NA	NA	NA
WP_012128096.1|264289_264676_+	ectoine synthase	NA	NA	NA	NA	NA
WP_012128095.1|264764_266189_+	aspartate kinase	NA	NA	NA	NA	NA
WP_021017707.1|267586_269179_+	S8 family peptidase	NA	A0A2K9L1P3	Tupanvirus	32.8	4.4e-32
WP_012128092.1|269359_270808_+	trypsin-like peptidase domain-containing protein	NA	NA	NA	NA	NA
WP_011999114.1|271011_271932_+|transposase	IS5 family transposase	transposase	A0A1V0E8E1	Vibrio_phage	96.4	2.3e-171
WP_012128091.1|272312_272570_+	hypothetical protein	NA	NA	NA	NA	NA
WP_012128089.1|273476_273806_-	hypothetical protein	NA	NA	NA	NA	NA
WP_021017708.1|274137_275682_-|transposase	IS66 family transposase	transposase	S5VTD3	Leptospira_phage	34.7	1.0e-70
WP_080654490.1|275828_276095_-	IS66 family insertion sequence element accessory protein TnpB	NA	S5VXZ8	Leptospira_phage	49.2	2.7e-11
WP_011999494.1|276091_276403_-	IS66 family insertion sequence hypothetical protein	NA	NA	NA	NA	NA
WP_086028378.1|276470_277602_+|transposase	IS3 family transposase	transposase	Q6H9S3	Enterobacteria_phage	32.6	9.7e-26
>prophage 3
NC_022269	Vibrio campbellii ATCC BAA-1116 chromosome I, complete sequence	3746887	417891	427315	3746887		Vibrio_phage(91.67%)	12	NA	NA
WP_005531371.1|417891_418077_-	DUF3018 family protein	NA	A0A2I7RE17	Vibrio_phage	37.3	4.0e-06
WP_021017732.1|418685_420071_-	hypothetical protein	NA	Q783T9	Vibrio_phage	83.3	1.2e-232
WP_021017733.1|420075_420420_-	DUF2523 domain-containing protein	NA	Q783U0	Vibrio_phage	69.3	1.2e-40
WP_012127993.1|420421_421519_-	hypothetical protein	NA	Q783U1	Vibrio_phage	61.2	3.1e-85
WP_012127990.1|422044_422293_-	hypothetical protein	NA	Q783U2	Vibrio_phage	81.7	3.6e-26
WP_012127989.1|422298_422529_-	hypothetical protein	NA	Q783U3	Vibrio_phage	90.8	8.2e-33
WP_012127988.1|422534_422894_-	DUF1293 family protein	NA	Q783U4	Vibrio_phage	95.8	7.2e-60
WP_012127987.1|422897_424043_-	replication initiation factor domain-containing protein	NA	A0A1W6UG38	Vibrio_phage	92.4	1.4e-213
WP_005531344.1|424026_424242_-	hypothetical protein	NA	A0A1W6UGD1	Vibrio_phage	87.3	7.2e-31
WP_021017735.1|424245_424869_-	3'-5' exonuclease	NA	W6ASW5	Vibrio_phage	47.6	1.4e-37
WP_012127985.1|425046_425415_+	hypothetical protein	NA	Q858Q3	Vibrio_phage	74.6	1.1e-44
WP_012127984.1|425584_427315_-	response regulator	NA	A0A1V0SGX0	Hokovirus	31.5	3.3e-41
>prophage 4
NC_022269	Vibrio campbellii ATCC BAA-1116 chromosome I, complete sequence	3746887	545624	776562	3746887	tail,plate,tRNA,head,terminase,lysis,integrase,portal,transposase,capsid	Vibrio_phage(28.77%)	200	720260:720282	779483:779505
WP_012127024.1|545624_547004_-|transposase	IS4 family transposase	transposase	Q9JMP3	Wolbachia_phage	26.9	2.9e-48
WP_009697431.1|547532_547871_-	hypothetical protein	NA	NA	NA	NA	NA
WP_012127146.1|548658_549852_-|transposase	IS4 family transposase	transposase	A4KWT9	Enterobacteria_phage	38.1	2.8e-68
WP_012127891.1|550416_551079_-	DUF2726 domain-containing protein	NA	NA	NA	NA	NA
WP_012127890.1|551277_551946_-	maleylacetoacetate isomerase	NA	NA	NA	NA	NA
WP_012127889.1|551966_553004_-	fumarylacetoacetate hydrolase family protein	NA	NA	NA	NA	NA
WP_012127888.1|553013_554144_-	homogentisate 1,2-dioxygenase	NA	NA	NA	NA	NA
WP_005427851.1|554136_555210_-	4-hydroxyphenylpyruvate dioxygenase	NA	NA	NA	NA	NA
WP_012127887.1|555598_556063_+	TetR family transcriptional regulator	NA	NA	NA	NA	NA
WP_012127886.1|556279_557311_+|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_012127885.1|557752_558859_+	M20/M25/M40 family metallo-hydrolase	NA	NA	NA	NA	NA
WP_162471672.1|560344_561380_-|transposase	IS630 family transposase	transposase	M4M9P8	Vibrio_phage	63.2	1.1e-12
WP_012127146.1|562232_563426_+|transposase	IS4 family transposase	transposase	A4KWT9	Enterobacteria_phage	38.1	2.8e-68
WP_158500853.1|563432_564299_+	hypothetical protein	NA	NA	NA	NA	NA
WP_158500855.1|564371_565451_+	hypothetical protein	NA	NA	NA	NA	NA
WP_012127880.1|565609_566038_+	hypothetical protein	NA	NA	NA	NA	NA
WP_012127879.1|566151_567021_-	beta-carotene 15,15'-dioxygenase, Brp/Blh family	NA	NA	NA	NA	NA
WP_012127878.1|567017_568175_-	lycopene cyclase	NA	NA	NA	NA	NA
WP_021017758.1|568161_569076_-	phytoene/squalene synthase family protein	NA	NA	NA	NA	NA
WP_012127876.1|569056_570670_-	phytoene desaturase	NA	NA	NA	NA	NA
WP_041853191.1|570659_571523_-	polyprenyl synthetase family protein	NA	A0A1V0SE37	Indivirus	23.4	4.2e-05
WP_012127874.1|571610_572525_-	bacteriorhodopsin	NA	NA	NA	NA	NA
WP_012127872.1|572666_573515_+|transposase	IS5 family transposase	transposase	A0A1V0E8E1	Vibrio_phage	96.3	1.7e-152
WP_086028371.1|573540_574336_+|transposase	IS5 family transposase	transposase	NA	NA	NA	NA
WP_012127870.1|575638_576511_-	hypothetical protein	NA	NA	NA	NA	NA
WP_021017760.1|576521_577667_-	hypothetical protein	NA	NA	NA	NA	NA
WP_012127501.1|578036_578957_+|transposase	IS5 family transposase	transposase	A0A1V0E8E1	Vibrio_phage	96.4	3.6e-172
WP_012127868.1|579171_580365_+|transposase	IS4 family transposase	transposase	A4KWT9	Enterobacteria_phage	38.1	1.3e-68
WP_012127867.1|580392_580794_+	hypothetical protein	NA	NA	NA	NA	NA
WP_021017762.1|582697_583864_-	23S rRNA (adenine(1618)-N(6))-methyltransferase RlmF	NA	NA	NA	NA	NA
WP_012127862.1|583850_584366_-	M48 family metallopeptidase	NA	NA	NA	NA	NA
WP_012127861.1|584505_584733_+	glutaredoxin family protein	NA	NA	NA	NA	NA
WP_021017764.1|584776_586321_-|transposase	IS66 family transposase	transposase	S5VTD3	Leptospira_phage	34.2	2.7e-71
WP_011998799.1|586381_586735_-	IS66 family insertion sequence element accessory protein TnpB	NA	S5VXZ8	Leptospira_phage	44.6	7.0e-15
WP_011999494.1|586731_587043_-	IS66 family insertion sequence hypothetical protein	NA	NA	NA	NA	NA
WP_012127860.1|587372_588242_-	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_012127859.1|588354_589566_+	MFS transporter	NA	NA	NA	NA	NA
WP_012127858.1|589648_590230_+	DUF1415 domain-containing protein	NA	NA	NA	NA	NA
WP_041853192.1|590338_590914_+	nucleoside triphosphate pyrophosphohydrolase family protein	NA	A0A088C537	Shewanella_sp._phage	43.0	2.4e-33
WP_012127856.1|590996_591413_-	DUF1311 domain-containing protein	NA	NA	NA	NA	NA
WP_169563909.1|591502_592534_+|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_012127855.1|592547_593315_-	vitamin B12 ABC transporter ATP-binding protein BtuD	NA	A0A2K9L407	Tupanvirus	24.5	2.8e-08
WP_012127854.1|593301_594297_-	vitamin B12 ABC transporter permease BtuC	NA	NA	NA	NA	NA
WP_012127853.1|594399_595428_-	succinylglutamate desuccinylase	NA	NA	NA	NA	NA
WP_012127852.1|595666_597466_-	M3 family oligoendopeptidase	NA	NA	NA	NA	NA
WP_005528211.1|597548_598163_-	alpha-ribazole phosphatase	NA	NA	NA	NA	NA
WP_012127851.1|598159_598708_-	bifunctional adenosylcobinamide kinase/adenosylcobinamide-phosphate guanylyltransferase	NA	NA	NA	NA	NA
WP_021017765.1|598704_599511_-	adenosylcobinamide-GDP ribazoletransferase	NA	NA	NA	NA	NA
WP_012127849.1|599510_600554_-	nicotinate-nucleotide--dimethylbenzimidazole phosphoribosyltransferase	NA	NA	NA	NA	NA
WP_012127846.1|601850_602546_+	NAD(P)H-binding protein	NA	NA	NA	NA	NA
WP_005528200.1|602739_604113_+	L-cystine transporter	NA	NA	NA	NA	NA
WP_005528198.1|604340_605021_+	DUF1826 domain-containing protein	NA	NA	NA	NA	NA
WP_005528196.1|605182_606604_+	exodeoxyribonuclease I	NA	NA	NA	NA	NA
WP_012127845.1|606662_607037_+	CidA/LrgA family protein	NA	NA	NA	NA	NA
WP_009705896.1|607038_607716_+	LrgB family protein	NA	NA	NA	NA	NA
WP_012127844.1|607980_608868_+	cytidine deaminase	NA	NA	NA	NA	NA
WP_012127843.1|609015_610191_+	formate-dependent phosphoribosylglycinamide formyltransferase	NA	NA	NA	NA	NA
WP_005533410.1|610277_610928_-	thiopurine S-methyltransferase	NA	NA	NA	NA	NA
WP_021017766.1|611265_612066_+	RelA/SpoT domain-containing protein	NA	NA	NA	NA	NA
WP_005427969.1|612202_612499_-	integration host factor subunit alpha	NA	A0A0H3UZA0	Geobacillus_virus	38.9	2.1e-12
WP_041853358.1|613976_614720_+	metallophosphoesterase	NA	NA	NA	NA	NA
WP_005533415.1|617442_618387_+	iron chelate uptake ABC transporter family permease subunit	NA	A0A2H4IY97	uncultured_Caudovirales_phage	36.2	1.5e-59
WP_012127838.1|618383_619337_+	iron chelate uptake ABC transporter family permease subunit	NA	NA	NA	NA	NA
WP_012127837.1|619393_620377_+	siderophore ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_012127836.1|620515_622708_+	TonB-dependent receptor	NA	NA	NA	NA	NA
WP_012127835.1|622783_625912_+	non-ribosomal peptide synthetase	NA	A0A2K9KZV5	Tupanvirus	26.9	2.5e-47
WP_041853194.1|626780_628106_-	anguibactin biosynthesis histamine N-monooxygenase AngU	NA	NA	NA	NA	NA
WP_012127832.1|628222_631099_-	peptide synthetase	NA	NA	NA	NA	NA
WP_012127831.1|631690_632851_+	histidine decarboxylase	NA	A0A2P0VP20	Tetraselmis_virus	37.1	2.4e-64
WP_012127830.1|632970_634575_+	ABC transporter ATP-binding protein	NA	G3M9Y6	Bacillus_virus	31.2	1.4e-14
WP_012127829.1|634571_636245_+	ABC transporter ATP-binding protein	NA	W8CYL7	Bacillus_phage	27.3	8.1e-21
WP_011999494.1|637177_637489_+	IS66 family insertion sequence hypothetical protein	NA	NA	NA	NA	NA
WP_021017768.1|637485_637827_+	IS66 family insertion sequence element accessory protein TnpB	NA	S5VXZ8	Leptospira_phage	48.0	1.1e-14
WP_021017769.1|637859_639425_+|transposase	IS66 family transposase	transposase	S5VTD3	Leptospira_phage	34.2	1.6e-71
WP_012127826.1|639825_642246_-|tRNA	phenylalanine--tRNA ligase subunit beta	tRNA	A0A1L3IZU3	BeAn_58058_virus	26.5	3.9e-08
WP_012127825.1|642264_643248_-|tRNA	phenylalanine--tRNA ligase subunit alpha	tRNA	A0A2H4UW22	Bodo_saltans_virus	39.5	1.3e-37
WP_012127824.1|643935_644745_-	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_012127823.1|645296_645611_-	heavy metal-binding domain-containing protein	NA	NA	NA	NA	NA
WP_012127820.1|646001_646382_-	RidA family protein	NA	NA	NA	NA	NA
WP_012127819.1|646400_646685_-	nucleotide pyrophosphohydrolase	NA	NA	NA	NA	NA
WP_011998779.1|647444_647798_+	IS66 family insertion sequence element accessory protein TnpB	NA	S5VXZ8	Leptospira_phage	44.6	7.0e-15
WP_021017772.1|647858_649403_+|transposase	IS66 family transposase	transposase	S5VTD3	Leptospira_phage	34.2	2.7e-71
WP_004727974.1|649529_649883_-	50S ribosomal protein L20	NA	NA	NA	NA	NA
WP_005428085.1|649923_650118_-	50S ribosomal protein L35	NA	NA	NA	NA	NA
WP_080514128.1|650235_650787_-	translation initiation factor IF-3	NA	A0A2L0UZ54	Agrobacterium_phage	35.8	1.9e-11
WP_012127814.1|650790_652719_-|tRNA	threonine--tRNA ligase	tRNA	A0A2K9L297	Tupanvirus	37.3	1.1e-127
WP_012127813.1|653014_654004_+	DUF3187 family protein	NA	NA	NA	NA	NA
WP_012127812.1|654009_654753_-	sporulation protein	NA	NA	NA	NA	NA
WP_012127811.1|654946_655654_+	histidine utilization repressor	NA	NA	NA	NA	NA
WP_012127810.1|655774_657025_+	imidazolonepropionase	NA	NA	NA	NA	NA
WP_041853195.1|657026_658040_+	formimidoylglutamase	NA	NA	NA	NA	NA
WP_012127808.1|658152_659850_+	urocanate hydratase	NA	NA	NA	NA	NA
WP_005536173.1|659861_661397_+	histidine ammonia-lyase	NA	A0A1V0S940	Catovirus	39.0	1.7e-89
WP_012127806.1|661495_663112_-	hypothetical protein	NA	NA	NA	NA	NA
WP_012127805.1|663117_665409_-	hypothetical protein	NA	NA	NA	NA	NA
WP_012127804.1|665459_666200_-	hypothetical protein	NA	NA	NA	NA	NA
WP_010647461.1|666309_667083_-	hypothetical protein	NA	NA	NA	NA	NA
WP_012127802.1|667096_667846_-	NAD+--arginine ADP-ribosyltransferase Vis	NA	NA	NA	NA	NA
WP_012127801.1|667861_670504_-	hypothetical protein	NA	NA	NA	NA	NA
WP_005533480.1|671428_672154_+	DUF3581 domain-containing protein	NA	NA	NA	NA	NA
WP_012127800.1|672315_672777_-	isoprenylcysteine carboxylmethyltransferase family protein	NA	NA	NA	NA	NA
WP_012127799.1|672869_675905_-	FAD-binding oxidoreductase	NA	NA	NA	NA	NA
WP_010647449.1|676162_676846_+	DUF3334 family protein	NA	NA	NA	NA	NA
WP_012127798.1|677000_677696_+	DUF2786 domain-containing protein	NA	NA	NA	NA	NA
WP_010647445.1|677852_678521_+	OmpA family protein	NA	NA	NA	NA	NA
WP_012127796.1|678597_679578_+	molecular chaperone DnaJ	NA	NA	NA	NA	NA
WP_010647442.1|679756_679942_+	hypothetical protein	NA	NA	NA	NA	NA
WP_012127794.1|680207_680495_+	hypothetical protein	NA	NA	NA	NA	NA
WP_005533471.1|680964_681357_+	hypothetical protein	NA	NA	NA	NA	NA
WP_144080935.1|681513_681798_-	hypothetical protein	NA	NA	NA	NA	NA
WP_144080910.1|682037_682304_-	hypothetical protein	NA	NA	NA	NA	NA
WP_012127790.1|682342_687907_-	RHS repeat-associated core domain-containing protein	NA	NA	NA	NA	NA
WP_011998779.1|689526_689880_-	IS66 family insertion sequence element accessory protein TnpB	NA	S5VXZ8	Leptospira_phage	44.6	7.0e-15
WP_011999494.1|689876_690188_-	IS66 family insertion sequence hypothetical protein	NA	NA	NA	NA	NA
WP_021017773.1|690253_692002_-	hypothetical protein	NA	S5WIG9	Leptospira_phage	31.0	8.2e-16
WP_021017774.1|692013_692391_-	hypothetical protein	NA	NA	NA	NA	NA
WP_012127786.1|692407_692740_-	hypothetical protein	NA	NA	NA	NA	NA
WP_086028365.1|693089_694623_+|transposase	IS3 family transposase	transposase	NA	NA	NA	NA
WP_021017776.1|694817_695165_-	hypothetical protein	NA	NA	NA	NA	NA
WP_021017777.1|696017_696365_-	hypothetical protein	NA	NA	NA	NA	NA
WP_012127782.1|697212_698316_+	phosphoribosylaminoimidazolesuccinocarboxamide synthase	NA	NA	NA	NA	NA
WP_012127781.1|698410_700084_-	alkaline phosphatase D family protein	NA	A0A2K9KZV0	Tupanvirus	25.9	2.2e-05
WP_012127780.1|700370_700748_-	hypothetical protein	NA	NA	NA	NA	NA
WP_012127779.1|700983_701703_-	phospholipase A	NA	NA	NA	NA	NA
WP_012127778.1|701859_704214_-	ATP-dependent RNA helicase	NA	A0A2H4UU36	Bodo_saltans_virus	27.2	9.4e-31
WP_005533465.1|704450_706139_+	NAD-dependent malic enzyme	NA	NA	NA	NA	NA
WP_005533464.1|706305_707040_+	YdcF family protein	NA	NA	NA	NA	NA
WP_012127777.1|707286_708657_+	DASS family sodium-coupled anion symporter	NA	NA	NA	NA	NA
WP_012127776.1|708835_710182_-	GGDEF domain-containing protein	NA	A0A127AWB9	Bacillus_phage	33.3	4.4e-17
WP_041853197.1|710520_711357_+	DUF2797 domain-containing protein	NA	NA	NA	NA	NA
WP_012127774.1|711664_712303_+	2OG-Fe dioxygenase family protein	NA	NA	NA	NA	NA
WP_012127773.1|712280_713519_+	cysteine desulfurase-like protein	NA	NA	NA	NA	NA
WP_011998779.1|715272_715626_-	IS66 family insertion sequence element accessory protein TnpB	NA	S5VXZ8	Leptospira_phage	44.6	7.0e-15
WP_011999494.1|715622_715934_-	IS66 family insertion sequence hypothetical protein	NA	NA	NA	NA	NA
WP_012127769.1|716076_717105_+|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_012127766.1|719094_719964_-	hypothetical protein	NA	NA	NA	NA	NA
720260:720282	attL	AAAGTGCCACGGGTAAAAATTCA	NA	NA	NA	NA
WP_021017779.1|720345_721890_-|transposase	IS66 family transposase	transposase	S5VTD3	Leptospira_phage	34.0	1.0e-70
WP_011998779.1|721950_722304_-	IS66 family insertion sequence element accessory protein TnpB	NA	S5VXZ8	Leptospira_phage	44.6	7.0e-15
WP_011999494.1|722300_722612_-	IS66 family insertion sequence hypothetical protein	NA	NA	NA	NA	NA
WP_021017780.1|723048_723435_-	DUF1311 domain-containing protein	NA	NA	NA	NA	NA
WP_021017781.1|724101_725574_+	group II intron reverse transcriptase/maturase	NA	A0A0U4J920	Pseudomonas_phage	49.6	1.9e-130
WP_012127146.1|725676_726870_-|transposase	IS4 family transposase	transposase	A4KWT9	Enterobacteria_phage	38.1	2.8e-68
WP_012127759.1|726960_728178_-|transposase	IS4 family transposase	transposase	A0A0F7LAS3	uncultured_marine_virus	48.0	2.6e-101
WP_011999328.1|729176_730376_+|transposase	IS4 family transposase	transposase	A0A0F7LAS3	uncultured_marine_virus	48.0	5.2e-102
WP_080514125.1|730370_730487_-	DUF3265 domain-containing protein	NA	NA	NA	NA	NA
WP_011999463.1|730579_731623_+|transposase	IS110 family transposase	transposase	NA	NA	NA	NA
WP_012127757.1|732093_732924_-	hypothetical protein	NA	NA	NA	NA	NA
WP_012127756.1|733161_734118_+|integrase	integron integrase	integrase	A0A1P8DJJ6	Virus_Rctr41k	41.8	4.9e-55
WP_012127755.1|734344_735358_-	hypothetical protein	NA	A2I2Y5	Vibrio_virus	50.4	5.3e-92
WP_012127754.1|735348_735570_-	hypothetical protein	NA	NA	NA	NA	NA
WP_012127753.1|735566_735968_-|tail	phage tail protein	tail	B0ZSH2	Halomonas_phage	40.6	1.4e-19
WP_012127752.1|735964_738958_-|tail	phage tail tape measure protein	tail	A2I2Y1	Vibrio_virus	44.9	1.5e-70
WP_012127751.1|739076_739670_-|tail	phage tail assembly protein	tail	NA	NA	NA	NA
WP_137282510.1|739743_740226_-	hypothetical protein	NA	B0ZSG9	Halomonas_phage	35.5	2.7e-17
WP_012127749.1|740249_741413_-|tail	tail protein	tail	Q6R4W2	Vibrio_virus	55.6	6.1e-116
WP_012127748.1|741416_741614_-	hypothetical protein	NA	NA	NA	NA	NA
WP_012127747.1|741700_741934_-	hypothetical protein	NA	NA	NA	NA	NA
WP_012127746.1|741936_742665_-	hypothetical protein	NA	Q6R4W1	Vibrio_virus	25.7	5.9e-08
WP_012127745.1|742677_743211_-	hypothetical protein	NA	K7RVY3	Vibrio_phage	47.1	4.4e-37
WP_021017782.1|743207_743963_-|tail	phage tail protein I	tail	NA	NA	NA	NA
WP_012127743.1|743928_744942_-|plate	baseplate J/gp47 family protein	plate	A0A1I9KG27	Aeromonas_phage	33.5	6.0e-43
WP_012127742.1|744951_745302_-|plate	phage baseplate protein	plate	A2I2X7	Vibrio_virus	52.0	2.8e-24
WP_012127741.1|745301_745940_-|plate	phage baseplate assembly protein V	plate	A2I2X5	Vibrio_virus	52.6	2.8e-38
WP_012127740.1|745905_746472_-	hypothetical protein	NA	NA	NA	NA	NA
WP_144080912.1|746452_747109_-	hypothetical protein	NA	D4HTU8	Vibrio_phage	35.2	2.9e-22
WP_021017783.1|747092_747461_-	hypothetical protein	NA	NA	NA	NA	NA
WP_012127737.1|747511_748003_-	hypothetical protein	NA	NA	NA	NA	NA
WP_012127736.1|748068_749106_-|capsid	major capsid protein	capsid	C6ZCY2	Enterobacteria_phage	41.8	1.9e-68
WP_012127735.1|749144_749486_-|head	head decoration protein	head	NA	NA	NA	NA
WP_012127734.1|749499_750852_-	S49 family peptidase	NA	A0A2I6TC87	Escherichia_phage	42.6	1.9e-89
WP_012127733.1|750844_752401_-|portal	phage portal protein	portal	A0A0K2FJC0	Enterobacteria_phage	56.0	7.0e-160
WP_005424556.1|752400_752610_-|head,tail	head-tail joining protein	head,tail	NA	NA	NA	NA
WP_144080913.1|752606_754583_-|terminase	phage terminase large subunit family protein	terminase	A0A1I9KF19	Aeromonas_phage	39.6	2.3e-123
WP_012127731.1|754470_755073_-	hypothetical protein	NA	D4HTU0	Vibrio_phage	37.0	1.6e-19
WP_012127730.1|755187_755670_-|lysis	lysis protein	lysis	A0A1P8DTG0	Proteus_phage	48.8	2.1e-22
WP_012127729.1|755651_756131_-	lysozyme	NA	A0A1U9GSH3	Vibrio_phage	58.7	3.8e-48
WP_005376950.1|756117_756309_-	hypothetical protein	NA	A0A1V1FD92	Vibrio_phage	54.1	1.7e-12
WP_012127728.1|756463_757132_-	hypothetical protein	NA	R9TRM8	Vibrio_phage	65.6	2.1e-81
WP_012127727.1|757436_758078_-	hypothetical protein	NA	NA	NA	NA	NA
WP_012127724.1|759107_759872_+	hypothetical protein	NA	NA	NA	NA	NA
WP_021017785.1|759986_760445_-	hypothetical protein	NA	NA	NA	NA	NA
WP_012127722.1|761007_761835_-	hypothetical protein	NA	NA	NA	NA	NA
WP_012127721.1|761843_763193_-	hypothetical protein	NA	NA	NA	NA	NA
WP_021017786.1|766316_767081_-	hypothetical protein	NA	NA	NA	NA	NA
WP_012127718.1|767506_768478_-	DUF968 domain-containing protein	NA	R9TRM9	Vibrio_phage	43.9	6.1e-61
WP_012127717.1|768470_768782_-	hypothetical protein	NA	R9TNL4	Vibrio_phage	89.1	3.6e-47
WP_021017787.1|768778_769474_-	phage antirepressor KilAC domain-containing protein	NA	R9TMN1	Vibrio_phage	68.0	3.0e-78
WP_005376941.1|769467_769680_-	hypothetical protein	NA	A0A1V0E856	Vibrio_phage	51.8	3.6e-11
WP_012127715.1|769690_770647_-	helix-turn-helix domain-containing protein	NA	R9TPU9	Vibrio_phage	72.5	2.2e-124
WP_012127714.1|770646_771168_-	hypothetical protein	NA	R9TNL7	Vibrio_phage	91.3	3.8e-94
WP_012127713.1|771160_771325_-	hypothetical protein	NA	NA	NA	NA	NA
WP_012127712.1|771324_771594_-	hypothetical protein	NA	NA	NA	NA	NA
WP_012127711.1|771590_772043_-	hypothetical protein	NA	R9TRN6	Vibrio_phage	64.9	1.7e-42
WP_012127710.1|772032_772299_-	helix-turn-helix transcriptional regulator	NA	A0A1V0E8C7	Vibrio_phage	50.7	3.4e-14
WP_012127709.1|772408_773074_+	LexA family transcriptional regulator	NA	A0A1V0E8B5	Vibrio_phage	59.6	1.4e-72
WP_012127707.1|773389_773785_+	hypothetical protein	NA	R9TMP0	Vibrio_phage	89.3	1.9e-61
WP_012127706.1|773825_774644_+	DUF2303 family protein	NA	R9TRN9	Vibrio_phage	81.6	2.3e-125
WP_012127705.1|774696_774909_+	hypothetical protein	NA	A0A1V0E8D5	Vibrio_phage	43.3	1.4e-10
WP_010648742.1|775096_775327_+	excisionase family protein	NA	NA	NA	NA	NA
WP_012127704.1|775326_776562_+|integrase	tyrosine-type recombinase/integrase	integrase	A0A0U2JGI6	Escherichia_phage	41.4	3.8e-76
779483:779505	attR	TGAATTTTTACCCGTGGCACTTT	NA	NA	NA	NA
>prophage 5
NC_022269	Vibrio campbellii ATCC BAA-1116 chromosome I, complete sequence	3746887	782358	833990	3746887	transposase,tRNA	Leptospira_phage(40.0%)	48	NA	NA
WP_012127343.1|782358_782493_+|transposase	transposase domain-containing protein	transposase	NA	NA	NA	NA
WP_012127701.1|782461_783331_+	hypothetical protein	NA	NA	NA	NA	NA
WP_012127700.1|783790_784051_+	hypothetical protein	NA	NA	NA	NA	NA
WP_021017794.1|784091_785636_-|transposase	IS66 family transposase	transposase	S5VTP8	Leptospira_phage	39.5	3.8e-25
WP_011998799.1|785695_786049_-	IS66 family insertion sequence element accessory protein TnpB	NA	S5VXZ8	Leptospira_phage	44.6	7.0e-15
WP_012127695.1|786397_786793_-	hypothetical protein	NA	NA	NA	NA	NA
WP_012127694.1|787290_787734_+	hypothetical protein	NA	NA	NA	NA	NA
WP_021017764.1|788092_789637_-|transposase	IS66 family transposase	transposase	S5VTD3	Leptospira_phage	34.2	2.7e-71
WP_012126950.1|789697_790051_-	IS66 family insertion sequence element accessory protein TnpB	NA	S5VXZ8	Leptospira_phage	43.5	2.6e-14
WP_011999494.1|790047_790359_-	IS66 family insertion sequence hypothetical protein	NA	NA	NA	NA	NA
WP_011999463.1|790580_791624_-|transposase	IS110 family transposase	transposase	NA	NA	NA	NA
WP_012127692.1|791798_792998_-|transposase	IS4 family transposase	transposase	A0A0F7LAS3	uncultured_marine_virus	47.5	7.4e-101
WP_021017796.1|793216_793567_+	hypothetical protein	NA	NA	NA	NA	NA
WP_012127690.1|793763_794036_+	hypothetical protein	NA	NA	NA	NA	NA
WP_012127689.1|794291_794765_-	DUF2947 domain-containing protein	NA	NA	NA	NA	NA
WP_012127688.1|794778_795366_-	HD domain-containing protein	NA	NA	NA	NA	NA
WP_012127687.1|795366_795951_-	ribosomal protein S5-alanine N-acetyltransferase	NA	NA	NA	NA	NA
WP_012127686.1|796034_797579_-	transcriptional regulator TyrR	NA	NA	NA	NA	NA
WP_012127685.1|797679_798720_-	TIGR01620 family protein	NA	NA	NA	NA	NA
WP_012127684.1|798716_800093_-	YcjX family protein	NA	NA	NA	NA	NA
WP_005433708.1|800249_800435_-	hypothetical protein	NA	NA	NA	NA	NA
WP_041853198.1|800664_802182_-	fumarate hydratase	NA	NA	NA	NA	NA
WP_012127682.1|802475_803846_+	aminodeoxychorismate synthase component I	NA	S4VT78	Pandoravirus	41.1	1.6e-43
WP_012127679.1|805706_806267_-	heme NO-binding domain-containing protein	NA	NA	NA	NA	NA
WP_012127678.1|806391_806991_+	CoA pyrophosphatase	NA	NA	NA	NA	NA
WP_021017797.1|807337_808591_+	septum formation initiator	NA	NA	NA	NA	NA
WP_012127676.1|808687_810049_+	L-serine ammonia-lyase	NA	NA	NA	NA	NA
WP_021017798.1|810171_811494_+|transposase	IS4 family transposase	transposase	NA	NA	NA	NA
WP_012127672.1|811717_813433_+	EAL domain-containing protein	NA	NA	NA	NA	NA
WP_012127671.1|813539_814007_+	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_005534756.1|814078_814216_-	hypothetical protein	NA	NA	NA	NA	NA
WP_012127670.1|814473_815259_+	response regulator transcription factor	NA	NA	NA	NA	NA
WP_005376896.1|815428_815791_-	6-carboxytetrahydropterin synthase QueD	NA	S4U060	uncultured_phage	38.6	4.1e-10
WP_012127669.1|816287_816458_+	hypothetical protein	NA	NA	NA	NA	NA
WP_041853376.1|817348_818749_+|tRNA	asparagine--tRNA ligase	tRNA	A0A2K9V902	Bandra_megavirus	37.6	5.1e-85
WP_012127667.1|818876_819290_-	hypothetical protein	NA	NA	NA	NA	NA
WP_010649555.1|819320_819542_-	hypothetical protein	NA	NA	NA	NA	NA
WP_012127666.1|819640_821032_-	PLP-dependent aminotransferase family protein	NA	NA	NA	NA	NA
WP_005429733.1|821211_821442_+	hypothetical protein	NA	NA	NA	NA	NA
WP_005429731.1|821642_821942_+	hypothetical protein	NA	NA	NA	NA	NA
WP_005429727.1|822705_823896_+	aspartate/tyrosine/aromatic aminotransferase	NA	NA	NA	NA	NA
WP_005429724.1|824010_824652_-	porin family protein	NA	NA	NA	NA	NA
WP_005429722.1|824871_826761_+	cyclic nucleotide-binding/CBS domain-containing protein	NA	NA	NA	NA	NA
WP_012127661.1|826769_827489_+	3'-5' exonuclease	NA	NA	NA	NA	NA
WP_012127658.1|827653_829537_-	methyl-accepting chemotaxis protein	NA	A0A2H4J162	uncultured_Caudovirales_phage	44.8	9.2e-21
WP_021017801.1|829764_831336_-	BCCT family transporter	NA	A0A2I7QNT1	Vibrio_phage	25.7	4.8e-23
WP_005429716.1|831731_832208_+	MarR family transcriptional regulator	NA	NA	NA	NA	NA
WP_169563909.1|832958_833990_+|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
>prophage 6
NC_022269	Vibrio campbellii ATCC BAA-1116 chromosome I, complete sequence	3746887	898131	978081	3746887	protease,transposase,tRNA	Leptospira_phage(13.33%)	58	NA	NA
WP_005528841.1|898131_899001_-|protease	protease HtpX	protease	NA	NA	NA	NA
WP_010449198.1|899360_899528_+	hypothetical protein	NA	NA	NA	NA	NA
WP_041853385.1|899601_900912_-	group II intron reverse transcriptase/maturase	NA	NA	NA	NA	NA
WP_012127613.1|901507_902191_-	ATP-dependent dethiobiotin synthetase BioD	NA	NA	NA	NA	NA
WP_012127612.1|902187_902994_-	malonyl-ACP O-methyltransferase BioC	NA	NA	NA	NA	NA
WP_012127611.1|902993_904145_-	8-amino-7-oxononanoate synthase	NA	NA	NA	NA	NA
WP_021017808.1|904131_905184_-	biotin synthase BioB	NA	NA	NA	NA	NA
WP_012127609.1|905314_906592_+	adenosylmethionine--8-amino-7-oxononanoate transaminase	NA	A0A1V0SKB7	Klosneuvirus	27.0	4.3e-22
WP_012127608.1|906729_906996_-	DksA/TraR family C4-type zinc finger protein	NA	A0A1S6UBD1	Serratia_phage	46.6	3.6e-16
WP_012127607.1|907133_907574_-	hypothetical protein	NA	NA	NA	NA	NA
WP_012127606.1|907567_908299_-	ATPase	NA	NA	NA	NA	NA
WP_162471673.1|908488_909523_+|transposase	IS630 family transposase	transposase	M4M9P8	Vibrio_phage	65.5	8.6e-13
WP_048814299.1|911018_912368_-	replication-associated recombination protein A	NA	G3MBE0	Bacillus_virus	43.4	1.3e-85
WP_012127603.1|912374_913001_-	outer membrane lipoprotein chaperone LolA	NA	NA	NA	NA	NA
WP_021017811.1|913062_916425_-	DNA translocase FtsK	NA	A0A218M9A2	Mycobacterium_phage	49.1	1.3e-86
WP_005528862.1|916577_917072_-	leucine-responsive transcriptional regulator Lrp	NA	NA	NA	NA	NA
WP_012127601.1|917228_918353_+	alanine dehydrogenase	NA	NA	NA	NA	NA
WP_012127600.1|918446_919643_-	methyltransferase	NA	NA	NA	NA	NA
WP_012127598.1|921008_921773_+	hypothetical protein	NA	NA	NA	NA	NA
WP_021017812.1|921899_922679_+|tRNA	tRNA isopentenyl-2-thiomethyl-A-37 hydroxylase MiaE	tRNA	NA	NA	NA	NA
WP_012126704.1|923128_924154_-|transposase	IS110 family transposase	transposase	NA	NA	NA	NA
WP_041853203.1|924259_925288_-	metal-dependent hydrolase	NA	NA	NA	NA	NA
WP_010646166.1|925434_925692_-	hypothetical protein	NA	NA	NA	NA	NA
WP_012127595.1|926086_927487_+	guanine deaminase	NA	NA	NA	NA	NA
WP_012127594.1|927581_929939_-	collagenase	NA	NA	NA	NA	NA
WP_011999494.1|929995_930307_+	IS66 family insertion sequence hypothetical protein	NA	NA	NA	NA	NA
WP_011998779.1|930303_930657_+	IS66 family insertion sequence element accessory protein TnpB	NA	S5VXZ8	Leptospira_phage	44.6	7.0e-15
WP_021017813.1|930717_932262_+|transposase	IS66 family transposase	transposase	S5VTD3	Leptospira_phage	34.2	2.7e-71
WP_012127592.1|932668_933556_-	hypothetical protein	NA	NA	NA	NA	NA
WP_012127590.1|933569_934706_-	DUF3696 domain-containing protein	NA	NA	NA	NA	NA
WP_012127589.1|934706_936659_-	DUF262 domain-containing protein	NA	NA	NA	NA	NA
WP_012127588.1|936777_937938_-	DNA cytosine methyltransferase	NA	A0A1P8CX13	Bacillus_phage	29.2	5.3e-19
WP_041853204.1|938226_939555_+	sphingomyelin phosphodiesterase	NA	A0A1P8L6H7	Staphylococcus_phage	32.7	1.6e-27
WP_012127586.1|939551_940550_+	hypothetical protein	NA	NA	NA	NA	NA
WP_012127585.1|942633_943656_-|tRNA	tryptophan--tRNA ligase	tRNA	NA	NA	NA	NA
WP_012127584.1|944453_946634_+	catalase/peroxidase HPI	NA	NA	NA	NA	NA
WP_144080916.1|946776_948207_-	transporter substrate-binding domain-containing protein	NA	A0A1P8CWQ1	Bacillus_phage	38.2	8.8e-08
WP_021017817.1|948176_948314_+	hypothetical protein	NA	NA	NA	NA	NA
WP_012126577.1|948534_949296_+|transposase	IS5 family transposase	transposase	A0A0N9SHJ4	Paenibacillus_phage	44.0	8.8e-15
WP_012127580.1|949361_950318_+	AEC family transporter	NA	NA	NA	NA	NA
WP_012127579.1|950384_951245_-	(2Fe-2S)-binding protein	NA	NA	NA	NA	NA
WP_012127578.1|951244_952048_-	ABC transporter ATP-binding protein	NA	F2Y2R6	Organic_Lake_phycodnavirus	30.0	6.4e-16
WP_012127577.1|952047_953010_-	iron ABC transporter permease	NA	A0A2H4IY97	uncultured_Caudovirales_phage	24.8	4.5e-08
WP_012127574.1|955078_957223_+	TonB-dependent receptor	NA	NA	NA	NA	NA
WP_012127573.1|957319_958021_-	DUF1028 domain-containing protein	NA	NA	NA	NA	NA
WP_021017822.1|958042_959434_-	YfcC family protein	NA	NA	NA	NA	NA
WP_012127571.1|959567_960815_-	allantoate amidohydrolase	NA	NA	NA	NA	NA
WP_021017823.1|961023_961770_+	FadR family transcriptional regulator	NA	NA	NA	NA	NA
WP_005426166.1|961799_962252_-	MarR family transcriptional regulator	NA	NA	NA	NA	NA
WP_021017824.1|962547_965709_-	multidrug efflux RND transporter permease subunit	NA	NA	NA	NA	NA
WP_012127568.1|965711_966848_-	efflux RND transporter periplasmic adaptor subunit	NA	NA	NA	NA	NA
WP_012127566.1|967203_968841_-	methyl-accepting chemotaxis protein	NA	A0A2H4J162	uncultured_Caudovirales_phage	34.8	6.3e-34
WP_041853205.1|969031_969499_-	hypothetical protein	NA	NA	NA	NA	NA
WP_005426222.1|969672_970008_-	alkylphosphonate utilization protein	NA	NA	NA	NA	NA
WP_012127563.1|970717_971836_+	hypothetical protein	NA	NA	NA	NA	NA
WP_012127562.1|971902_975595_+	RHS repeat protein	NA	NA	NA	NA	NA
WP_012127561.1|975584_976715_+	RHS repeat-associated core domain-containing protein	NA	A0A1W5K0N1	Bacteriophage	42.4	4.5e-23
WP_011999187.1|976755_978081_-|transposase	IS4 family transposase	transposase	NA	NA	NA	NA
>prophage 7
NC_022269	Vibrio campbellii ATCC BAA-1116 chromosome I, complete sequence	3746887	1001389	1117186	3746887	transposase,tRNA	Leptospira_phage(28.57%)	97	NA	NA
WP_169563912.1|1001389_1002421_-|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_012127534.1|1005157_1006318_-	VopS family T3SS effector adenosine monophosphate-protein transferase	NA	NA	NA	NA	NA
WP_005426173.1|1006321_1006759_-	CesT family type III secretion system chaperone	NA	NA	NA	NA	NA
WP_012127533.1|1007042_1009946_-	hypothetical protein	NA	NA	NA	NA	NA
WP_005426189.1|1009949_1010345_-	hypothetical protein	NA	NA	NA	NA	NA
WP_012127532.1|1010571_1011207_-	HrpE/YscL family type III secretion apparatus protein	NA	NA	NA	NA	NA
WP_012127531.1|1011185_1011851_-	type III secretion system sorting platform protein VscK	NA	NA	NA	NA	NA
WP_005426229.1|1011843_1012602_-	type III secretion inner membrane ring lipoprotein SctJ	NA	NA	NA	NA	NA
WP_012127530.1|1012607_1012952_-	type III secretion system inner rod subunit SctI	NA	NA	NA	NA	NA
WP_012127529.1|1012960_1013623_-	YopR family T3SS polymerization control protein	NA	NA	NA	NA	NA
WP_012127528.1|1013622_1013979_-	YscG family type III secretion system chaperone	NA	NA	NA	NA	NA
WP_005528964.1|1013982_1014231_-	type III secretion system needle filament subunit SctF	NA	NA	NA	NA	NA
WP_005426287.1|1014247_1014454_-	EscE/YscE/SsaE family type III secretion system needle protein co-chaperone	NA	NA	NA	NA	NA
WP_012127527.1|1014440_1015742_-	type III secretion system inner membrane ring subunit SctD	NA	NA	NA	NA	NA
WP_012127526.1|1015747_1017619_-	type III secretion system outer membrane ring subunit SctC	NA	NA	NA	NA	NA
WP_012127525.1|1017618_1018047_-	YscB family type III secretion system chaperone	NA	NA	NA	NA	NA
WP_005426156.1|1018059_1019040_-	T3SS regulon anti-activator ExsD family protein	NA	NA	NA	NA	NA
WP_012127524.1|1019183_1020044_-	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_021017830.1|1020641_1021049_-	YscW family type III secretion system pilotin	NA	NA	NA	NA	NA
WP_012127520.1|1021407_1021854_+	CesT family type III secretion system chaperone	NA	NA	NA	NA	NA
WP_012127519.1|1021861_1022161_+	T3SS regulon translocated regulator ExsE2	NA	NA	NA	NA	NA
WP_012127518.1|1022305_1022872_-	hypothetical protein	NA	NA	NA	NA	NA
WP_012127517.1|1022868_1024281_-	hypothetical protein	NA	NA	NA	NA	NA
WP_012127516.1|1024273_1027213_-	hypothetical protein	NA	NA	NA	NA	NA
WP_012127515.1|1027216_1027996_-	hypothetical protein	NA	NA	NA	NA	NA
WP_012127514.1|1028198_1029053_+	WYL domain-containing protein	NA	NA	NA	NA	NA
WP_021017798.1|1029186_1030509_+|transposase	IS4 family transposase	transposase	NA	NA	NA	NA
WP_012127512.1|1030664_1031003_-	hypothetical protein	NA	NA	NA	NA	NA
WP_012127511.1|1031005_1032019_-	hypothetical protein	NA	NA	NA	NA	NA
WP_012127508.1|1033078_1033462_-	hypothetical protein	NA	NA	NA	NA	NA
WP_012127507.1|1033609_1034182_-	hypothetical protein	NA	NA	NA	NA	NA
WP_086028364.1|1037585_1038763_-|transposase	IS3 family transposase	transposase	Q716C2	Shigella_phage	63.3	6.8e-115
WP_012127504.1|1038907_1039396_-	type III toxin-antitoxin system ToxN/AbiQ family toxin	NA	NA	NA	NA	NA
WP_080514117.1|1039392_1044267_-	RHS repeat-associated core domain-containing protein	NA	A0A1W5K0N1	Bacteriophage	26.8	8.0e-101
WP_012127502.1|1044551_1045673_-	hypothetical protein	NA	NA	NA	NA	NA
WP_012127501.1|1045991_1046912_-|transposase	IS5 family transposase	transposase	A0A1V0E8E1	Vibrio_phage	96.4	3.6e-172
WP_012127499.1|1047842_1048964_+|transposase	ISAs1-like element ISVha1 family transposase	transposase	NA	NA	NA	NA
WP_012127498.1|1049244_1050138_-	hypothetical protein	NA	NA	NA	NA	NA
WP_086028361.1|1051645_1052769_-|transposase	IS3 family transposase	transposase	Q6H9S3	Enterobacteria_phage	32.6	9.6e-26
WP_011998813.1|1053921_1055121_+|transposase	IS4 family transposase	transposase	A0A0F7LAS3	uncultured_marine_virus	47.8	1.5e-101
WP_012127495.1|1055335_1056256_-|transposase	IS5 family transposase	transposase	A0A1V0E8E1	Vibrio_phage	95.7	7.6e-170
WP_012127494.1|1056555_1057518_-|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_011999494.1|1057574_1057886_+	IS66 family insertion sequence hypothetical protein	NA	NA	NA	NA	NA
WP_012127165.1|1057882_1058236_+	IS66 family insertion sequence element accessory protein TnpB	NA	S5VXZ8	Leptospira_phage	42.7	1.8e-15
WP_012127491.1|1058295_1059828_+|transposase	IS66 family transposase	transposase	S5VTP8	Leptospira_phage	40.1	7.7e-26
WP_080514115.1|1060205_1060997_-	LysM peptidoglycan-binding domain-containing protein	NA	NA	NA	NA	NA
WP_012127487.1|1060938_1061982_-	hypothetical protein	NA	NA	NA	NA	NA
WP_144080937.1|1061962_1062661_-	pilus assembly protein	NA	NA	NA	NA	NA
WP_012127485.1|1062665_1065401_-	TcfC E-set like domain-containing protein	NA	NA	NA	NA	NA
WP_021017835.1|1065420_1065948_-	hypothetical protein	NA	NA	NA	NA	NA
WP_012127483.1|1065999_1066587_-	hypothetical protein	NA	NA	NA	NA	NA
WP_021017836.1|1066927_1067239_+	IS66 family insertion sequence hypothetical protein	NA	NA	NA	NA	NA
WP_011998779.1|1067235_1067589_+	IS66 family insertion sequence element accessory protein TnpB	NA	S5VXZ8	Leptospira_phage	44.6	7.0e-15
WP_021017837.1|1067649_1069194_+|transposase	IS66 family transposase	transposase	S5VTD3	Leptospira_phage	34.0	1.0e-70
WP_021017838.1|1069339_1070245_-|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_012127146.1|1070404_1071598_+|transposase	IS4 family transposase	transposase	A4KWT9	Enterobacteria_phage	38.1	2.8e-68
WP_012127477.1|1071743_1072340_-	hypothetical protein	NA	NA	NA	NA	NA
WP_144080917.1|1072442_1075097_-	hypothetical protein	NA	NA	NA	NA	NA
WP_012127475.1|1075253_1076138_-	hypothetical protein	NA	NA	NA	NA	NA
WP_012127474.1|1076571_1077096_-	hypothetical protein	NA	NA	NA	NA	NA
WP_012127473.1|1077083_1077845_-	winged helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_012127472.1|1078019_1078733_-	EAL domain-containing protein	NA	NA	NA	NA	NA
WP_012127471.1|1079447_1080848_+	hypothetical protein	NA	NA	NA	NA	NA
WP_012127470.1|1081602_1083564_-	acetate--CoA ligase	NA	A0A2H4PQU7	Staphylococcus_phage	38.0	1.3e-81
WP_051184939.1|1083608_1084325_-	acetoacetate decarboxylase	NA	NA	NA	NA	NA
WP_021017841.1|1084409_1085480_-	butyrate kinase	NA	NA	NA	NA	NA
WP_012127467.1|1085492_1086395_-	phosphate acetyltransferase	NA	NA	NA	NA	NA
WP_012127466.1|1086451_1087639_-	acetyl-CoA C-acetyltransferase	NA	NA	NA	NA	NA
WP_021017842.1|1087724_1087901_-	hypothetical protein	NA	NA	NA	NA	NA
WP_021017843.1|1090420_1091965_-|transposase	IS66 family transposase	transposase	S5VTP8	Leptospira_phage	40.1	7.8e-26
WP_011998779.1|1092025_1092379_-	IS66 family insertion sequence element accessory protein TnpB	NA	S5VXZ8	Leptospira_phage	44.6	7.0e-15
WP_011999494.1|1092375_1092687_-	IS66 family insertion sequence hypothetical protein	NA	NA	NA	NA	NA
WP_012127460.1|1092752_1093139_-	DUF4102 domain-containing protein	NA	A5VW56	Enterobacteria_phage	47.8	1.4e-05
WP_010646956.1|1093683_1094133_-	L-alanine exporter AlaE	NA	NA	NA	NA	NA
WP_012127459.1|1094573_1096994_-	hybrid sensor histidine kinase/response regulator	NA	A0A1V0SGX0	Hokovirus	34.2	1.4e-53
WP_041853393.1|1097089_1097659_+	YecA family protein	NA	NA	NA	NA	NA
WP_012127457.1|1097726_1098893_-	glutathionylspermidine synthase family protein	NA	B2ZXR7	Ralstonia_phage	43.9	1.8e-83
WP_021017844.1|1098898_1099468_-	DUF1190 domain-containing protein	NA	NA	NA	NA	NA
WP_005426232.1|1099476_1099893_-	DUF350 domain-containing protein	NA	NA	NA	NA	NA
WP_012127455.1|1099892_1100936_-	potassium channel family protein	NA	NA	NA	NA	NA
WP_012127454.1|1101063_1102125_-	quinolinate synthase NadA	NA	NA	NA	NA	NA
WP_021017845.1|1102421_1103177_-	tol-pal system protein YbgF	NA	NA	NA	NA	NA
WP_012127451.1|1103192_1103714_-	peptidoglycan-associated lipoprotein Pal	NA	NA	NA	NA	NA
WP_080514114.1|1103745_1105098_-	Tol-Pal system protein TolB	NA	NA	NA	NA	NA
WP_012127449.1|1105108_1106137_-	cell envelope integrity protein TolA	NA	NA	NA	NA	NA
WP_012127448.1|1106150_1106594_-	ExbD/TolR family protein	NA	NA	NA	NA	NA
WP_005426224.1|1106597_1107296_-	protein TolQ	NA	NA	NA	NA	NA
WP_005426200.1|1107285_1107705_-	tol-pal system-associated acyl-CoA thioesterase	NA	NA	NA	NA	NA
WP_012127446.1|1107876_1108179_-	cyd operon protein YbgE	NA	NA	NA	NA	NA
WP_000270284.1|1108171_1108279_-	cytochrome bd-I oxidase subunit CydX	NA	NA	NA	NA	NA
WP_005426257.1|1108291_1109428_-	cytochrome d ubiquinol oxidase subunit II	NA	NA	NA	NA	NA
WP_012127445.1|1109445_1111032_-	cytochrome ubiquinol oxidase subunit I	NA	NA	NA	NA	NA
WP_005426235.1|1111493_1112498_-	Holliday junction branch migration DNA helicase RuvB	NA	A0A127AWE7	Bacillus_phage	25.0	1.5e-09
WP_041853208.1|1112519_1113134_-	Holliday junction branch migration protein RuvA	NA	NA	NA	NA	NA
WP_012127443.1|1113212_1114664_-	chemotaxis protein	NA	A0A2H4J162	uncultured_Caudovirales_phage	38.7	4.6e-12
WP_005426231.1|1114786_1115308_-	crossover junction endodeoxyribonuclease RuvC	NA	G3MA90	Bacillus_virus	33.3	1.0e-09
WP_012127442.1|1115407_1117186_-|tRNA	aspartate--tRNA ligase	tRNA	A0A2K9L3L6	Tupanvirus	27.7	1.4e-10
>prophage 8
NC_022269	Vibrio campbellii ATCC BAA-1116 chromosome I, complete sequence	3746887	1221043	1243539	3746887	transposase	Leptospira_phage(50.0%)	17	NA	NA
WP_086028361.1|1221043_1222167_-|transposase	IS3 family transposase	transposase	Q6H9S3	Enterobacteria_phage	32.6	9.6e-26
WP_021017851.1|1224072_1224264_+	hypothetical protein	NA	NA	NA	NA	NA
WP_041853323.1|1224287_1224554_+	winged helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_012127365.1|1225029_1226778_-	arsenical pump-driving ATPase	NA	NA	NA	NA	NA
WP_012127364.1|1226787_1227150_-	arsenite efflux transporter metallochaperone ArsD	NA	NA	NA	NA	NA
WP_011999494.1|1228792_1229104_+	IS66 family insertion sequence hypothetical protein	NA	NA	NA	NA	NA
WP_011998779.1|1229100_1229454_+	IS66 family insertion sequence element accessory protein TnpB	NA	S5VXZ8	Leptospira_phage	44.6	7.0e-15
WP_012127343.1|1231070_1231205_+|transposase	transposase domain-containing protein	transposase	NA	NA	NA	NA
WP_012127701.1|1231173_1232043_+	hypothetical protein	NA	NA	NA	NA	NA
WP_012127700.1|1232502_1232763_+	hypothetical protein	NA	NA	NA	NA	NA
WP_012127359.1|1232803_1234357_-|transposase	IS66 family transposase	transposase	S5VTP8	Leptospira_phage	40.1	7.8e-26
WP_011998799.1|1234416_1234770_-	IS66 family insertion sequence element accessory protein TnpB	NA	S5VXZ8	Leptospira_phage	44.6	7.0e-15
WP_012127357.1|1235806_1236574_-	sulfurtransferase	NA	NA	NA	NA	NA
WP_012127356.1|1236675_1236981_-	hypothetical protein	NA	NA	NA	NA	NA
WP_012127146.1|1237620_1238814_-|transposase	IS4 family transposase	transposase	A4KWT9	Enterobacteria_phage	38.1	2.8e-68
WP_011999328.1|1239753_1240953_+|transposase	IS4 family transposase	transposase	A0A0F7LAS3	uncultured_marine_virus	48.0	5.2e-102
WP_011999463.1|1242495_1243539_+|transposase	IS110 family transposase	transposase	NA	NA	NA	NA
>prophage 9
NC_022269	Vibrio campbellii ATCC BAA-1116 chromosome I, complete sequence	3746887	1495799	1625264	3746887	integrase,transposase,tRNA	Staphylococcus_phage(22.58%)	102	1571431:1571445	1598344:1598358
WP_012126704.1|1495799_1496825_+|transposase	IS110 family transposase	transposase	NA	NA	NA	NA
WP_012127183.1|1497445_1498696_-	serine hydroxymethyltransferase	NA	A0A240F3L3	Aeromonas_phage	50.3	1.5e-96
WP_012127182.1|1499043_1499646_+	YitT family protein	NA	NA	NA	NA	NA
WP_012127181.1|1499724_1501410_-	alpha,alpha-phosphotrehalase	NA	NA	NA	NA	NA
WP_012127180.1|1501518_1502925_-	PTS trehalose transporter subunit IIBC	NA	NA	NA	NA	NA
WP_012127179.1|1503100_1504048_-	HTH-type transcriptional regulator TreR	NA	NA	NA	NA	NA
WP_010648250.1|1504122_1504674_-	D-glycero-beta-D-manno-heptose 1,7-bisphosphate 7-phosphatase	NA	NA	NA	NA	NA
WP_005530689.1|1505017_1506052_+	methionine ABC transporter ATP-binding protein MetN	NA	G9BWD6	Planktothrix_phage	40.0	2.6e-33
WP_012127178.1|1506041_1506719_+	ABC transporter permease	NA	NA	NA	NA	NA
WP_005530685.1|1506751_1507561_+	MetQ/NlpA family lipoprotein	NA	NA	NA	NA	NA
WP_012127177.1|1507645_1508836_-	YibE/F family protein	NA	NA	NA	NA	NA
WP_012127173.1|1511434_1512211_-	Zn-ribbon-containing protein	NA	NA	NA	NA	NA
WP_005530679.1|1512213_1512759_-	SecY-interacting protein	NA	NA	NA	NA	NA
WP_010648239.1|1512866_1513712_+	NADPH-dependent 7-cyano-7-deazaguanine reductase QueF	NA	A0A2I7SAX1	Vibrio_phage	40.0	5.0e-43
WP_012127172.1|1513871_1516157_+	hypothetical protein	NA	NA	NA	NA	NA
WP_012127171.1|1516255_1517821_+	GGDEF domain-containing protein	NA	NA	NA	NA	NA
WP_005530670.1|1518039_1519416_+	LOG family protein	NA	NA	NA	NA	NA
WP_012127170.1|1519474_1520257_+	flap endonuclease Xni	NA	NA	NA	NA	NA
WP_162471674.1|1520429_1521186_+|transposase	IS5 family transposase	transposase	A0A0N9SHJ4	Paenibacillus_phage	44.0	1.1e-14
WP_010648228.1|1521218_1522310_-	23S rRNA (cytidine(2498)-2'-O)-methyltransferase RlmM	NA	NA	NA	NA	NA
WP_010648226.1|1522306_1522705_-	DUF423 domain-containing protein	NA	NA	NA	NA	NA
WP_012127167.1|1522694_1523318_-	alpha/beta fold hydrolase	NA	NA	NA	NA	NA
WP_005447583.1|1523298_1524219_-	transcriptional regulator GcvA	NA	NA	NA	NA	NA
WP_012127359.1|1524607_1526161_-|transposase	IS66 family transposase	transposase	S5VTP8	Leptospira_phage	40.1	7.8e-26
WP_011998799.1|1526220_1526574_-	IS66 family insertion sequence element accessory protein TnpB	NA	S5VXZ8	Leptospira_phage	44.6	7.0e-15
WP_011999494.1|1526570_1526882_-	IS66 family insertion sequence hypothetical protein	NA	NA	NA	NA	NA
WP_012127164.1|1527149_1528598_-|tRNA	tRNA 4-thiouridine(8) synthase ThiI	tRNA	NA	NA	NA	NA
WP_005530654.1|1528795_1529740_-	flagellar motor protein MotB	NA	NA	NA	NA	NA
WP_005530650.1|1529755_1530517_-	flagellar motor protein PomA	NA	NA	NA	NA	NA
WP_005427560.1|1530782_1531025_+	exodeoxyribonuclease VII small subunit	NA	NA	NA	NA	NA
WP_012127163.1|1531046_1531931_+	(2E,6E)-farnesyl diphosphate synthase	NA	NA	NA	NA	NA
WP_012127162.1|1531950_1533816_+	1-deoxy-D-xylulose-5-phosphate synthase	NA	NA	NA	NA	NA
WP_012127161.1|1533920_1534424_-	phosphatidylglycerophosphatase A	NA	NA	NA	NA	NA
WP_005530642.1|1534481_1535447_-	thiamine-phosphate kinase	NA	NA	NA	NA	NA
WP_005440182.1|1535525_1535993_-	transcription antitermination factor NusB	NA	NA	NA	NA	NA
WP_005440184.1|1535992_1536463_-	6,7-dimethyl-8-ribityllumazine synthase	NA	A0A2H4PQS3	Staphylococcus_phage	49.3	1.7e-32
WP_012127160.1|1536632_1537742_-	bifunctional 3,4-dihydroxy-2-butanone-4-phosphate synthase/GTP cyclohydrolase II	NA	A0A2H4PQS2	Staphylococcus_phage	39.8	3.0e-64
WP_005424876.1|1537901_1538555_-	riboflavin synthase	NA	A0A2H4PQS5	Staphylococcus_phage	38.0	3.3e-34
WP_012127159.1|1538566_1539691_-	bifunctional diaminohydroxyphosphoribosylaminopyrimidine deaminase/5-amino-6-(5-phosphoribosylamino)uracil reductase RibD	NA	A0A2H4PQS8	Staphylococcus_phage	35.1	1.7e-43
WP_005424846.1|1539698_1540148_-	transcriptional regulator NrdR	NA	NA	NA	NA	NA
WP_041853231.1|1540275_1541526_-	glutamate-5-semialdehyde dehydrogenase	NA	A0A1X9I5D4	Streptococcus_phage	48.2	2.5e-99
WP_005424865.1|1541543_1542683_-	glutamate 5-kinase	NA	A0A1X9I5D0	Streptococcus_phage	41.4	2.9e-62
WP_005424873.1|1542805_1543195_-	sigma factor-binding protein Crl	NA	NA	NA	NA	NA
WP_012127154.1|1543313_1544561_-	esterase FrsA	NA	NA	NA	NA	NA
WP_005424848.1|1544649_1545114_-	oxytetracycline resistance phosphoribosyltransferase domain-containing protein Tet(34)	NA	NA	NA	NA	NA
WP_005424863.1|1545505_1546795_-	NCS2 family permease	NA	A0A0R6PHV4	Moraxella_phage	38.9	8.6e-71
WP_012127153.1|1547827_1549300_+	aminoacyl-histidine dipeptidase	NA	NA	NA	NA	NA
WP_011999187.1|1549436_1550762_+|transposase	IS4 family transposase	transposase	NA	NA	NA	NA
WP_041853232.1|1550823_1551351_-	DUF3332 domain-containing protein	NA	NA	NA	NA	NA
WP_005424857.1|1551691_1552762_+	succinylglutamate desuccinylase/aspartoacylase family protein	NA	NA	NA	NA	NA
WP_012127151.1|1552931_1553357_+	hypothetical protein	NA	NA	NA	NA	NA
WP_041853233.1|1553425_1554187_+|transposase	IS5 family transposase	transposase	A0A0N9SHJ4	Paenibacillus_phage	44.0	1.2e-14
WP_005424867.1|1554312_1554621_-	DUF3622 domain-containing protein	NA	NA	NA	NA	NA
WP_012127148.1|1555125_1559022_-	phosphoribosylformylglycinamidine synthase	NA	A9YX36	Burkholderia_phage	57.9	1.5e-126
WP_005533708.1|1559345_1560950_+	membrane-bound lytic murein transglycosylase MltF	NA	A0A0E3M2X9	Enterobacter_phage	30.7	1.1e-06
WP_012127146.1|1562295_1563489_-|transposase	IS4 family transposase	transposase	A4KWT9	Enterobacteria_phage	38.1	2.8e-68
WP_011998779.1|1564205_1564559_-	IS66 family insertion sequence element accessory protein TnpB	NA	S5VXZ8	Leptospira_phage	44.6	7.0e-15
WP_021017879.1|1564555_1564867_-	IS66 family insertion sequence hypothetical protein	NA	NA	NA	NA	NA
WP_021017880.1|1565177_1565711_-|tRNA	tRNA adenosine(34) deaminase TadA	tRNA	NA	NA	NA	NA
WP_010648303.1|1566089_1567649_-	AbgT family transporter	NA	NA	NA	NA	NA
WP_012127142.1|1567913_1568324_-	prepilin-type N-terminal cleavage/methylation domain-containing protein	NA	NA	NA	NA	NA
WP_012127141.1|1568313_1569555_-	hypothetical protein	NA	NA	NA	NA	NA
WP_021017882.1|1569554_1570181_-	hypothetical protein	NA	NA	NA	NA	NA
WP_041853234.1|1570190_1570706_-	type II transport protein GspH	NA	NA	NA	NA	NA
WP_041853235.1|1570809_1571244_+	prepilin-type N-terminal cleavage/methylation domain-containing protein	NA	NA	NA	NA	NA
WP_012127137.1|1571339_1572485_-	molecular chaperone DnaJ	NA	E3T4P7	Cafeteria_roenbergensis_virus	34.8	3.0e-22
1571431:1571445	attL	GACTCATCAAACTCT	NA	NA	NA	NA
WP_012127136.1|1572686_1574603_-	molecular chaperone DnaK	NA	G8DDB7	Micromonas_pusilla_virus	49.9	1.6e-145
WP_010648318.1|1574928_1576203_-	dicarboxylate/amino acid:cation symporter	NA	NA	NA	NA	NA
WP_021017883.1|1576622_1577219_-	nucleotide exchange factor GrpE	NA	NA	NA	NA	NA
WP_012127134.1|1577364_1578249_+	NAD(+) kinase	NA	NA	NA	NA	NA
WP_005424702.1|1578679_1580344_+	DNA repair protein RecN	NA	NA	NA	NA	NA
WP_005533738.1|1580365_1580848_+	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_005424693.1|1581095_1581455_+	outer membrane protein assembly factor BamE	NA	NA	NA	NA	NA
WP_012126481.1|1581602_1582982_+|transposase	IS4 family transposase	transposase	Q9JMP3	Wolbachia_phage	27.2	1.3e-48
WP_021017884.1|1583190_1584570_+|transposase	IS4 family transposase	transposase	Q9JMP3	Wolbachia_phage	26.9	1.4e-47
WP_005533748.1|1584624_1584981_-	RnfH family protein	NA	NA	NA	NA	NA
WP_005533750.1|1584970_1585414_-	ubiquinone-binding protein	NA	NA	NA	NA	NA
WP_005424760.1|1585532_1586018_+	SsrA-binding protein SmpB	NA	W5RAM5	Staphylococcus_phage	42.4	3.9e-24
WP_012127133.1|1586637_1587870_+|integrase	tyrosine-type recombinase/integrase	integrase	Q7M297	Enterobacteria_phage	36.9	6.3e-71
WP_012127132.1|1588007_1588253_+	AlpA family phage regulatory protein	NA	NA	NA	NA	NA
WP_012127131.1|1588821_1589076_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_011999187.1|1593183_1594509_-|transposase	IS4 family transposase	transposase	NA	NA	NA	NA
WP_012127128.1|1594843_1596046_-	restriction endonuclease subunit S	NA	A0A2H4PQP5	Staphylococcus_phage	39.2	3.5e-26
WP_012127127.1|1596047_1598636_-	type I restriction-modification system subunit M	NA	A0A2H4PQP4	Staphylococcus_phage	40.3	3.1e-88
1598344:1598358	attR	GACTCATCAAACTCT	NA	NA	NA	NA
WP_012127126.1|1598725_1598896_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_012127123.1|1601147_1603484_-	DEAD/DEAH box helicase family protein	NA	A0A2K9R7J3	Dishui_lake_phycodnavirus	31.7	2.3e-37
WP_021017886.1|1603653_1604601_+	competence protein CoiA	NA	NA	NA	NA	NA
WP_012127121.1|1604661_1605201_-	hypothetical protein	NA	NA	NA	NA	NA
WP_012127120.1|1605604_1606936_+	ATP-binding protein	NA	NA	NA	NA	NA
WP_012127119.1|1607450_1608344_+	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_012127118.1|1608443_1610486_+	FUSC family protein	NA	NA	NA	NA	NA
WP_012127117.1|1610631_1611207_+	DedA family protein	NA	NA	NA	NA	NA
WP_012127116.1|1611384_1612752_+	Na+/H+ antiporter NhaC family protein	NA	NA	NA	NA	NA
WP_012130296.1|1613560_1615102_-|transposase	IS66 family transposase	transposase	S5VTP8	Leptospira_phage	40.1	7.7e-26
WP_011998779.1|1615161_1615515_-	IS66 family insertion sequence element accessory protein TnpB	NA	S5VXZ8	Leptospira_phage	44.6	7.0e-15
WP_011999494.1|1615511_1615823_-	IS66 family insertion sequence hypothetical protein	NA	NA	NA	NA	NA
WP_012127114.1|1615888_1616092_-	GIY-YIG nuclease family protein	NA	NA	NA	NA	NA
WP_012127110.1|1617510_1618356_-	3-keto-5-aminohexanoate cleavage protein	NA	NA	NA	NA	NA
WP_086028355.1|1620246_1621369_+|transposase	IS3 family transposase	transposase	Q6H9S3	Enterobacteria_phage	33.0	7.4e-26
WP_021017686.1|1622478_1623951_+	group II intron reverse transcriptase/maturase	NA	A0A0U4J920	Pseudomonas_phage	49.1	1.3e-131
WP_011998872.1|1623866_1624064_-	hypothetical protein	NA	NA	NA	NA	NA
WP_012127105.1|1624235_1625264_-|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
>prophage 10
NC_022269	Vibrio campbellii ATCC BAA-1116 chromosome I, complete sequence	3746887	1885808	1894240	3746887	transposase,tRNA	Leptospira_phage(33.33%)	8	NA	NA
WP_041853246.1|1885808_1886825_-|tRNA	tRNA (adenosine(37)-N6)-threonylcarbamoyltransferase complex transferase subunit TsaD	tRNA	A0A0R6PI74	Moraxella_phage	58.0	3.7e-109
WP_001145625.1|1887055_1887271_+	30S ribosomal protein S21	NA	NA	NA	NA	NA
WP_012126953.1|1887299_1887743_+	GatB/YqeY domain-containing protein	NA	A0A292GL36	Xanthomonas_phage	45.0	2.3e-23
WP_012126952.1|1887891_1889652_+	DNA primase	NA	A0A1S5RFN0	Helicobacter_phage	32.0	4.5e-46
WP_005528793.1|1889751_1891614_+	RNA polymerase sigma factor RpoD	NA	A0A2I7SAT0	Vibrio_phage	32.9	4.2e-34
WP_021017902.1|1891973_1892285_+	IS66 family insertion sequence hypothetical protein	NA	NA	NA	NA	NA
WP_012126950.1|1892281_1892635_+	IS66 family insertion sequence element accessory protein TnpB	NA	S5VXZ8	Leptospira_phage	43.5	2.6e-14
WP_021017903.1|1892695_1894240_+|transposase	IS66 family transposase	transposase	S5VTD3	Leptospira_phage	34.4	9.3e-72
>prophage 11
NC_022269	Vibrio campbellii ATCC BAA-1116 chromosome I, complete sequence	3746887	2145584	2208456	3746887	bacteriocin,transposase,tRNA,integrase	Enterobacteria_phage(18.18%)	45	2158477:2158493	2215465:2215481
WP_010650498.1|2145584_2146019_-|tRNA	D-tyrosyl-tRNA(Tyr) deacylase	tRNA	NA	NA	NA	NA
WP_012126767.1|2145990_2146935_-	virulence factor BrkB family protein	NA	NA	NA	NA	NA
WP_005529068.1|2146970_2147612_+	DUF2959 domain-containing protein	NA	NA	NA	NA	NA
WP_021017924.1|2147701_2148256_-	AAA family ATPase	NA	NA	NA	NA	NA
WP_005430066.1|2148331_2150161_-	translational GTPase TypA	NA	A0A1B0RXH7	Streptococcus_phage	42.1	6.2e-22
WP_012126764.1|2150692_2152102_+	glutamate--ammonia ligase	NA	NA	NA	NA	NA
WP_009707978.1|2153638_2154220_+	DUF4124 domain-containing protein	NA	NA	NA	NA	NA
WP_005430202.1|2154350_2155397_+	nitrogen regulation protein NR(II)	NA	Q8QKV7	Ectocarpus_siliculosus_virus	27.9	4.8e-11
WP_012126762.1|2155457_2156861_+	nitrogen regulation protein NR(I)	NA	NA	NA	NA	NA
WP_012126761.1|2156973_2159520_+	EAL domain-containing protein	NA	NA	NA	NA	NA
2158477:2158493	attL	GGTGATGAATTTGCGGT	NA	NA	NA	NA
WP_012126760.1|2159671_2160676_+	adenosine deaminase	NA	NA	NA	NA	NA
WP_012126759.1|2160743_2162135_-	oxygen-independent coproporphyrinogen III oxidase	NA	NA	NA	NA	NA
WP_012126758.1|2162320_2162809_-	DUF2489 domain-containing protein	NA	NA	NA	NA	NA
WP_012126757.1|2162816_2163359_-	Der GTPase-activating protein YihI	NA	NA	NA	NA	NA
WP_012126756.1|2163358_2163997_-	class I SAM-dependent methyltransferase	NA	NA	NA	NA	NA
WP_005430024.1|2164771_2165389_-	cytochrome c4	NA	NA	NA	NA	NA
WP_005429993.1|2165548_2166208_+	YihA family ribosome biogenesis GTP-binding protein	NA	NA	NA	NA	NA
WP_012126752.1|2166965_2169758_-	DNA polymerase I	NA	A0A218MKQ4	uncultured_virus	32.0	4.3e-75
WP_012126751.1|2170378_2170813_-	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_005429984.1|2170938_2172000_-	porphobilinogen synthase	NA	NA	NA	NA	NA
WP_012126749.1|2172186_2172951_+	TatD family hydrolase	NA	NA	NA	NA	NA
WP_005429982.1|2173537_2174287_-	twin-arginine translocase subunit TatC	NA	A0A1B1IVR7	uncultured_Mediterranean_phage	32.9	3.1e-28
WP_005430029.1|2174355_2174754_-	Sec-independent protein translocase subunit TatB	NA	NA	NA	NA	NA
WP_005429959.1|2174757_2175006_-	Sec-independent protein translocase subunit TatA	NA	NA	NA	NA	NA
WP_012126747.1|2175054_2176689_-	ubiquinone biosynthesis regulatory protein kinase UbiB	NA	M4QMK7	Micromonas_pusilla_virus	31.0	2.4e-33
WP_005448553.1|2176685_2177321_-	SCP2 domain-containing protein	NA	NA	NA	NA	NA
WP_012126746.1|2177332_2178112_-	bifunctional demethylmenaquinone methyltransferase/2-methoxy-6-polyprenyl-1,4-benzoquinol methylase UbiE	NA	NA	NA	NA	NA
WP_005430064.1|2178190_2179723_-	DNA recombination protein RmuC	NA	R9RFD7	Alteromonas_phage	80.3	1.1e-21
WP_012126745.1|2179892_2180801_+	DMT family transporter	NA	NA	NA	NA	NA
WP_012126744.1|2180997_2183445_+	EAL domain-containing protein	NA	G3MA91	Bacillus_virus	35.7	2.8e-22
WP_011999187.1|2183475_2184801_-|transposase	IS4 family transposase	transposase	NA	NA	NA	NA
WP_012128228.1|2184993_2185755_-|transposase	IS5 family transposase	transposase	A0A0N9SHJ4	Paenibacillus_phage	44.0	8.8e-15
WP_012126742.1|2185936_2186734_+	substrate-binding domain-containing protein	NA	NA	NA	NA	NA
WP_021017925.1|2186748_2187456_+	hypothetical protein	NA	NA	NA	NA	NA
WP_012126740.1|2187971_2188733_+	hypothetical protein	NA	NA	NA	NA	NA
WP_144080926.1|2188953_2189721_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011999348.1|2189840_2191034_+|transposase	IS4 family transposase	transposase	A4KWT9	Enterobacteria_phage	38.4	1.3e-68
WP_012126736.1|2192889_2195079_+	DUF5011 domain-containing protein	NA	NA	NA	NA	NA
WP_011999348.1|2195684_2196878_+|transposase	IS4 family transposase	transposase	A4KWT9	Enterobacteria_phage	38.4	1.3e-68
WP_012126734.1|2197981_2198845_-	hypothetical protein	NA	NA	NA	NA	NA
WP_012126733.1|2199432_2202012_+	S-type pyocin domain-containing protein	NA	NA	NA	NA	NA
WP_012126732.1|2202008_2202266_+|bacteriocin	bacteriocin immunity protein	bacteriocin	NA	NA	NA	NA
WP_012126731.1|2202297_2202558_-	DNA-directed DNA polymerase	NA	A0A1W6JNT0	Morganella_phage	68.4	1.1e-09
WP_021017927.1|2205398_2207144_-	hypothetical protein	NA	NA	NA	NA	NA
WP_021017928.1|2207136_2208456_-|integrase	site-specific integrase	integrase	NA	NA	NA	NA
2215465:2215481	attR	ACCGCAAATTCATCACC	NA	NA	NA	NA
>prophage 12
NC_022269	Vibrio campbellii ATCC BAA-1116 chromosome I, complete sequence	3746887	2452384	2534871	3746887	protease,transposase,tRNA	Enterobacteria_phage(20.0%)	52	NA	NA
WP_012126570.1|2452384_2453227_+|protease	rhomboid family intramembrane serine protease GlpG	protease	NA	NA	NA	NA
WP_005430919.1|2453327_2453738_-	flagellar basal body-associated protein FliL	NA	NA	NA	NA	NA
WP_005430917.1|2453891_2454431_+	chorismate lyase	NA	NA	NA	NA	NA
WP_012126569.1|2454431_2455286_+	4-hydroxybenzoate octaprenyltransferase	NA	NA	NA	NA	NA
WP_021017945.1|2457263_2459690_-	glycerol-3-phosphate 1-O-acyltransferase PlsB	NA	NA	NA	NA	NA
WP_005438488.1|2460058_2460679_+	repressor LexA	NA	A5LH73	Enterobacteria_phage	43.3	1.4e-10
WP_009695929.1|2460913_2461708_+	class I SAM-dependent methyltransferase	NA	NA	NA	NA	NA
WP_021017946.1|2461763_2463107_+	MATE family efflux transporter DinF	NA	NA	NA	NA	NA
WP_012126563.1|2463175_2464606_-	Si-specific NAD(P)(+) transhydrogenase	NA	NA	NA	NA	NA
WP_005430912.1|2464867_2465509_+	HTH-type transcriptional repressor FabR	NA	NA	NA	NA	NA
WP_005430908.1|2465508_2465874_+	YijD family membrane protein	NA	NA	NA	NA	NA
WP_005451984.1|2465938_2467048_-|tRNA	tRNA (uridine(54)-C5)-methyltransferase TrmA	tRNA	NA	NA	NA	NA
WP_012126562.1|2467491_2469345_+	TonB-dependent receptor	NA	NA	NA	NA	NA
WP_021017947.1|2469853_2470039_+	hypothetical protein	NA	NA	NA	NA	NA
WP_012126558.1|2470548_2471355_+	glutamate racemase	NA	NA	NA	NA	NA
WP_038890960.1|2471317_2471773_-	RNA-binding protein	NA	NA	NA	NA	NA
WP_012126556.1|2478575_2479769_+|transposase	IS4 family transposase	transposase	A4KWT9	Enterobacteria_phage	38.1	3.7e-68
WP_012126555.1|2479946_2481287_-	CDP-diacylglycerol--serine O-phosphatidyltransferase	NA	NA	NA	NA	NA
WP_012126553.1|2481892_2482936_+	UDP-N-acetylmuramate dehydrogenase	NA	NA	NA	NA	NA
WP_012126552.1|2482932_2483898_+	bifunctional biotin--[acetyl-CoA-carboxylase] ligase/biotin operon repressor BirA	NA	NA	NA	NA	NA
WP_038893024.1|2483914_2484838_-	type I pantothenate kinase	NA	A0A1B1ISL9	uncultured_Mediterranean_phage	33.8	5.6e-32
WP_012126548.1|2487012_2487393_+	preprotein translocase subunit SecE	NA	NA	NA	NA	NA
WP_005451123.1|2487406_2487955_+	transcription termination/antitermination protein NusG	NA	NA	NA	NA	NA
WP_005451125.1|2488096_2488525_+	50S ribosomal protein L11	NA	NA	NA	NA	NA
WP_005384683.1|2488529_2489231_+	50S ribosomal protein L1	NA	NA	NA	NA	NA
WP_005533792.1|2489524_2490019_+	50S ribosomal protein L10	NA	NA	NA	NA	NA
WP_005451128.1|2490076_2490445_+	50S ribosomal protein L7/L12	NA	NA	NA	NA	NA
WP_005433641.1|2490695_2494724_+	DNA-directed RNA polymerase subunit beta	NA	A0A2P0VMZ3	Tetraselmis_virus	27.2	6.7e-21
WP_012126546.1|2494830_2499033_+	DNA-directed RNA polymerase subunit beta'	NA	A0A2I7QNZ7	Vibrio_phage	28.3	3.1e-69
WP_010650836.1|2499586_2500078_-	Rsd/AlgQ family anti-sigma factor	NA	NA	NA	NA	NA
WP_005433638.1|2500256_2501039_+	NAD(+) diphosphatase	NA	NA	NA	NA	NA
WP_021017952.1|2501160_2501652_+	hypothetical protein	NA	NA	NA	NA	NA
WP_012126543.1|2501656_2502400_+	hypothetical protein	NA	NA	NA	NA	NA
WP_005433634.1|2502703_2503771_+	uroporphyrinogen decarboxylase	NA	NA	NA	NA	NA
WP_012126541.1|2504010_2504583_-	uracil-DNA glycosylase family protein	NA	NA	NA	NA	NA
WP_012126540.1|2504590_2505514_-	D-2-hydroxyacid dehydrogenase	NA	NA	NA	NA	NA
WP_005433631.1|2505580_2506168_+	DUF416 family protein	NA	NA	NA	NA	NA
WP_012126539.1|2506248_2507382_-	HlyC/CorC family transporter	NA	NA	NA	NA	NA
WP_005433627.1|2507635_2507908_+	DNA-binding protein HU-alpha	NA	A7KV42	Bacillus_phage	60.7	3.5e-22
WP_012126537.1|2507947_2508646_+	DUF1481 domain-containing protein	NA	NA	NA	NA	NA
WP_012126536.1|2508730_2510020_-	phosphoribosylamine--glycine ligase	NA	NA	NA	NA	NA
WP_012126535.1|2510139_2511732_-	bifunctional phosphoribosylaminoimidazolecarboxamide formyltransferase/IMP cyclohydrolase	NA	Q58MG4	Prochlorococcus_phage	50.6	3.9e-73
WP_005433622.1|2511765_2511942_+	hypothetical protein	NA	NA	NA	NA	NA
WP_005433620.1|2511999_2512398_+	Zn(2+)-responsive transcriptional regulator	NA	NA	NA	NA	NA
WP_012126534.1|2512563_2514135_+	lysine decarboxylation/transport transcriptional activator CadC	NA	NA	NA	NA	NA
WP_012126533.1|2514891_2516238_+	cadaverine/lysine antiporter	NA	NA	NA	NA	NA
WP_010444363.1|2516355_2518491_+	lysine decarboxylase CadA	NA	NA	NA	NA	NA
WP_021017953.1|2530222_2530891_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_162471675.1|2530869_2531905_-|transposase	IS630 family transposase	transposase	M4M9P8	Vibrio_phage	63.2	1.1e-12
WP_012126529.1|2532177_2532504_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_012126528.1|2532587_2533328_-	ATP-binding protein	NA	K4HZD4	Acidithiobacillus_phage	43.2	7.7e-48
WP_021017954.1|2533338_2534871_-|transposase	IS21 family transposase	transposase	K4I413	Acidithiobacillus_phage	41.9	9.5e-109
>prophage 13
NC_022269	Vibrio campbellii ATCC BAA-1116 chromosome I, complete sequence	3746887	2903396	2922113	3746887	transposase,tRNA	uncultured_Mediterranean_phage(18.18%)	16	NA	NA
WP_005531665.1|2903396_2905037_+	CTP synthase	NA	A0A1J0FA14	Only_Syngen_Nebraska_virus	52.1	3.6e-154
WP_005425372.1|2905115_2906417_+	phosphopyruvate hydratase	NA	A0A1X9I5Z8	Streptococcus_phage	60.3	3.5e-136
WP_005452106.1|2906820_2907102_+	cell division protein FtsB	NA	NA	NA	NA	NA
WP_041853277.1|2907103_2907814_+	2-C-methyl-D-erythritol 4-phosphate cytidylyltransferase	NA	A0A2H4UTB4	Bodo_saltans_virus	23.1	1.4e-06
WP_005425365.1|2907828_2908305_+	2-C-methyl-D-erythritol 2,4-cyclodiphosphate synthase	NA	NA	NA	NA	NA
WP_012128911.1|2908350_2909394_+|tRNA	tRNA pseudouridine(13) synthase TruD	tRNA	NA	NA	NA	NA
WP_012128910.1|2909393_2910170_+	5'/3'-nucleotidase SurE	NA	A0A1B1ITZ2	uncultured_Mediterranean_phage	54.1	5.4e-68
WP_012128909.1|2910169_2910796_+	protein-L-isoaspartate(D-aspartate) O-methyltransferase	NA	A0A1B1IU40	uncultured_Mediterranean_phage	53.9	1.8e-37
WP_012128908.1|2910810_2911734_+	peptidoglycan DD-metalloendopeptidase family protein	NA	D7RWE0	Brochothrix_phage	36.4	2.4e-06
WP_005425361.1|2911814_2912801_+	RNA polymerase sigma factor RpoS	NA	F4YCU2	Synechococcus_phage	35.2	6.9e-36
WP_041853460.1|2912937_2914260_+|transposase	IS4 family transposase	transposase	NA	NA	NA	NA
WP_012128906.1|2914325_2916887_-	DNA mismatch repair protein MutS	NA	A0A1V0SC35	Catovirus	23.2	3.4e-34
WP_012128905.1|2916972_2917455_+	nicotinamide-nucleotide amidase	NA	B5TK85	Pseudomonas_phage	47.5	2.4e-26
WP_005425359.1|2917655_2918699_+	recombinase RecA	NA	A0A2D1GPX2	Mycobacterium_phage	60.7	1.1e-111
WP_012128903.1|2918905_2919373_+	recombination regulator RecX	NA	NA	NA	NA	NA
WP_012128902.1|2919515_2922113_+|tRNA	alanine--tRNA ligase	tRNA	A0A1V0SK38	Klosneuvirus	37.5	1.2e-76
>prophage 14
NC_022269	Vibrio campbellii ATCC BAA-1116 chromosome I, complete sequence	3746887	3423776	3472428	3746887	transposase	Vibrio_phage(25.0%)	41	NA	NA
WP_012127098.1|3423776_3425099_+|transposase	IS4 family transposase	transposase	NA	NA	NA	NA
WP_012128546.1|3427551_3429360_-	DUF3413 domain-containing protein	NA	NA	NA	NA	NA
WP_005432983.1|3429382_3429610_-	YejL family protein	NA	NA	NA	NA	NA
WP_005432897.1|3429695_3430694_+	nucleoid-associated protein YejK	NA	A0A1V0E8C0	Vibrio_phage	58.3	1.1e-105
WP_011999187.1|3430811_3432137_+|transposase	IS4 family transposase	transposase	NA	NA	NA	NA
WP_012128545.1|3432242_3433592_+	Hpt domain-containing protein	NA	NA	NA	NA	NA
WP_041853300.1|3433703_3434867_+	hypothetical protein	NA	NA	NA	NA	NA
WP_005439709.1|3434968_3436405_-	Na+/H+ antiporter NhaC	NA	NA	NA	NA	NA
WP_010644047.1|3436842_3437973_+	aspartate-semialdehyde dehydrogenase	NA	NA	NA	NA	NA
WP_012128542.1|3438312_3439161_-	ion transporter	NA	NA	NA	NA	NA
WP_005433169.1|3439223_3439862_-	YchE family NAAT transporter	NA	NA	NA	NA	NA
WP_012128541.1|3440513_3443216_+	bifunctional acetaldehyde-CoA/alcohol dehydrogenase	NA	NA	NA	NA	NA
WP_041853479.1|3443854_3445165_+	group II intron reverse transcriptase/maturase	NA	NA	NA	NA	NA
WP_012128539.1|3445252_3445996_-	SDR family oxidoreductase	NA	NA	NA	NA	NA
WP_012128538.1|3446130_3446634_-	hypothetical protein	NA	NA	NA	NA	NA
WP_005536241.1|3446790_3447375_-	superoxide dismutase [Fe]	NA	Q56AR7	Bacillus_thuringiensis_phage	43.7	4.2e-41
WP_009707292.1|3447618_3447954_+	Grx4 family monothiol glutaredoxin	NA	NA	NA	NA	NA
WP_012128536.1|3448171_3449092_-|transposase	IS5 family transposase	transposase	A0A1V0E8E1	Vibrio_phage	96.1	2.3e-171
WP_012128534.1|3449725_3450589_+	sigma-70 family RNA polymerase sigma factor	NA	M4SMP8	Cyanophage	30.8	4.3e-26
WP_012128533.1|3450715_3451609_+	hypothetical protein	NA	NA	NA	NA	NA
WP_012128532.1|3451710_3452547_-	alpha/beta hydrolase	NA	NA	NA	NA	NA
WP_041853483.1|3452616_3452823_+	hypothetical protein	NA	NA	NA	NA	NA
WP_012128530.1|3453047_3454610_+	GGDEF domain-containing protein	NA	A0A127AWB9	Bacillus_phage	41.7	1.5e-21
WP_011999494.1|3454904_3455216_+	IS66 family insertion sequence hypothetical protein	NA	NA	NA	NA	NA
WP_012126950.1|3455212_3455566_+	IS66 family insertion sequence element accessory protein TnpB	NA	S5VXZ8	Leptospira_phage	43.5	2.6e-14
WP_021018019.1|3455626_3457171_+|transposase	IS66 family transposase	transposase	S5VTD3	Leptospira_phage	34.2	2.7e-71
WP_012128529.1|3457189_3458059_-|transposase	IS5 family transposase	transposase	A0A1V0E8E1	Vibrio_phage	96.1	3.0e-160
WP_012128527.1|3458667_3459039_-	hypothetical protein	NA	NA	NA	NA	NA
WP_012128526.1|3459041_3459359_-	hypothetical protein	NA	NA	NA	NA	NA
WP_041853301.1|3459373_3459976_-	lytic transglycosylase domain-containing protein	NA	NA	NA	NA	NA
WP_005430724.1|3460372_3460555_-	TraY domain-containing protein	NA	NA	NA	NA	NA
WP_012128524.1|3460560_3460722_-	hypothetical protein	NA	NA	NA	NA	NA
WP_041853302.1|3461563_3462193_+	DsbA family protein	NA	NA	NA	NA	NA
WP_041853303.1|3462282_3463608_-	Na+/H+ antiporter family protein	NA	NA	NA	NA	NA
WP_005439693.1|3463636_3464281_-	ribonuclease T	NA	L0N6K9	Acaryochloris_phage	24.7	8.3e-06
WP_012128519.1|3464587_3465469_+	OmpA family protein	NA	NA	NA	NA	NA
WP_005536418.1|3465590_3466025_-	DUF2753 domain-containing protein	NA	NA	NA	NA	NA
WP_021018021.1|3466162_3466579_-	lactoylglutathione lyase	NA	NA	NA	NA	NA
WP_012128517.1|3467163_3468636_-	group II intron reverse transcriptase/maturase	NA	A0A0U4J920	Pseudomonas_phage	50.4	5.0e-131
WP_021018022.1|3469381_3470596_-	methyl-accepting chemotaxis protein	NA	A0A2H4J162	uncultured_Caudovirales_phage	29.8	1.7e-20
WP_011999348.1|3471234_3472428_+|transposase	IS4 family transposase	transposase	A4KWT9	Enterobacteria_phage	38.4	1.3e-68
>prophage 15
NC_022269	Vibrio campbellii ATCC BAA-1116 chromosome I, complete sequence	3746887	3520251	3651610	3746887	protease,transposase,tRNA	Enterobacteria_phage(17.39%)	105	NA	NA
WP_012128474.1|3520251_3521211_-|tRNA	tRNA dihydrouridine(16) synthase DusC	tRNA	NA	NA	NA	NA
WP_012128473.1|3521647_3522256_+	SEC-C domain-containing protein	NA	NA	NA	NA	NA
WP_012128472.1|3522332_3522869_-	disulfide bond formation protein DsbB	NA	NA	NA	NA	NA
WP_012128471.1|3522954_3524541_-	Na(+)/H(+) antiporter NhaB	NA	NA	NA	NA	NA
WP_005531443.1|3525180_3526020_+	fatty acid metabolism transcriptional regulator FadR	NA	NA	NA	NA	NA
WP_012128470.1|3526104_3526911_-	hypothetical protein	NA	NA	NA	NA	NA
WP_021018027.1|3527124_3529185_-|tRNA	methionine--tRNA ligase	tRNA	A0A1V0SDF2	Indivirus	30.5	7.6e-61
WP_041853307.1|3529342_3530419_+	iron-sulfur cluster carrier protein ApbC	NA	NA	NA	NA	NA
WP_005433235.1|3530600_3531242_+	uridine kinase	NA	A0A1V0SAA3	Catovirus	39.3	4.6e-33
WP_012128466.1|3531431_3533519_+	AsmA family protein	NA	NA	NA	NA	NA
WP_012128465.1|3533642_3534248_-	cob(I)yrinic acid a,c-diamide adenosyltransferase	NA	NA	NA	NA	NA
WP_012128464.1|3534365_3534815_+	low molecular weight phosphotyrosine protein phosphatase	NA	NA	NA	NA	NA
WP_010645684.1|3534875_3536435_-	SulP family inorganic anion transporter	NA	A0A2H4J153	uncultured_Caudovirales_phage	42.9	5.9e-90
WP_005436634.1|3536821_3538201_+|transposase	IS4 family transposase	transposase	Q9JMP3	Wolbachia_phage	26.9	3.8e-48
WP_012128463.1|3538275_3541383_-	ribonuclease E	NA	NA	NA	NA	NA
WP_041853308.1|3542019_3542964_+	23S rRNA pseudouridine(955/2504/2580) synthase RluC	NA	NA	NA	NA	NA
WP_012128460.1|3544692_3545274_-	septum formation inhibitor Maf	NA	NA	NA	NA	NA
WP_005444794.1|3545424_3545949_+	23S rRNA accumulation protein YceD	NA	NA	NA	NA	NA
WP_005396978.1|3546008_3546179_+	50S ribosomal protein L32	NA	NA	NA	NA	NA
WP_038889875.1|3546189_3547215_+	phosphate acyltransferase PlsX	NA	NA	NA	NA	NA
WP_012128458.1|3547220_3548171_+	ketoacyl-ACP synthase III	NA	NA	NA	NA	NA
WP_021018029.1|3548247_3549171_+	ACP S-malonyltransferase	NA	NA	NA	NA	NA
WP_041853487.1|3549205_3549940_+	3-oxoacyl-ACP reductase FabG	NA	F2NZ40	Diadromus_pulchellus_ascovirus	32.1	5.5e-14
WP_004406112.1|3550185_3550419_+	acyl carrier protein	NA	B2ZXV3	Ralstonia_phage	45.6	4.9e-09
WP_005425696.1|3550512_3551760_+	beta-ketoacyl-ACP synthase II	NA	NA	NA	NA	NA
WP_012128454.1|3551868_3552684_+	aminodeoxychorismate lyase	NA	NA	NA	NA	NA
WP_012128453.1|3552680_3553697_+	endolytic transglycosylase MltG	NA	NA	NA	NA	NA
WP_012128452.1|3553693_3554326_+	dTMP kinase	NA	A0A1L2BX49	Bacteriophage	38.0	1.1e-23
WP_012128451.1|3554350_3555313_+	DNA polymerase III subunit delta'	NA	NA	NA	NA	NA
WP_012128450.1|3555303_3556071_+	TatD family hydrolase	NA	NA	NA	NA	NA
WP_012128449.1|3556515_3557946_+	PTS glucose transporter subunit IIBC	NA	NA	NA	NA	NA
WP_012128448.1|3558212_3558614_+	hypothetical protein	NA	NA	NA	NA	NA
WP_011999278.1|3558652_3559984_-|transposase	IS4 family transposase	transposase	NA	NA	NA	NA
WP_012128447.1|3560121_3560229_-	MetS family NSS transporter small subunit	NA	NA	NA	NA	NA
WP_012128446.1|3560228_3561689_-	sodium-dependent transporter	NA	NA	NA	NA	NA
WP_086028389.1|3562190_3562987_-|transposase	IS5 family transposase	transposase	NA	NA	NA	NA
WP_021018031.1|3563012_3563597_-	outer membrane beta-barrel protein	NA	NA	NA	NA	NA
WP_021018032.1|3563747_3563840_+	YnhF family membrane protein	NA	NA	NA	NA	NA
WP_012128444.1|3563858_3565004_+	patatin-like phospholipase family protein	NA	NA	NA	NA	NA
WP_011999494.1|3565055_3565367_+	IS66 family insertion sequence hypothetical protein	NA	NA	NA	NA	NA
WP_011998779.1|3565363_3565717_+	IS66 family insertion sequence element accessory protein TnpB	NA	S5VXZ8	Leptospira_phage	44.6	7.0e-15
WP_086028361.1|3568380_3569503_+|transposase	IS3 family transposase	transposase	Q6H9S3	Enterobacteria_phage	32.6	9.6e-26
WP_012128441.1|3571111_3571846_+	hypothetical protein	NA	NA	NA	NA	NA
WP_086028365.1|3572801_3574336_-|transposase	IS3 family transposase	transposase	NA	NA	NA	NA
WP_012128439.1|3574889_3577475_+	hypothetical protein	NA	NA	NA	NA	NA
WP_012128438.1|3577560_3579210_+	carboxylesterase family protein	NA	M1PNU1	Moumouvirus	28.2	2.2e-18
WP_012128437.1|3579296_3579509_+	hypothetical protein	NA	NA	NA	NA	NA
WP_012127501.1|3579591_3580512_-|transposase	IS5 family transposase	transposase	A0A1V0E8E1	Vibrio_phage	96.4	3.6e-172
WP_080514143.1|3580608_3581286_+	winged helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_012128435.1|3581248_3581779_+	hypothetical protein	NA	NA	NA	NA	NA
WP_038863406.1|3581873_3583316_-	pyruvate kinase	NA	NA	NA	NA	NA
WP_021018036.1|3583505_3585050_-|transposase	IS66 family transposase	transposase	S5VTD3	Leptospira_phage	34.2	1.4e-70
WP_021018037.1|3585110_3585455_-	IS66 family insertion sequence element accessory protein TnpB	NA	S5VXZ8	Leptospira_phage	44.6	6.8e-15
WP_011999494.1|3585459_3585771_-	IS66 family insertion sequence hypothetical protein	NA	NA	NA	NA	NA
WP_041853309.1|3586022_3587240_+	ROK family protein	NA	NA	NA	NA	NA
WP_012128431.1|3587469_3588411_+	chemotaxis protein CheV	NA	Q56AR1	Bacillus_thuringiensis_phage	30.2	2.7e-29
WP_012128430.1|3588510_3591585_-	error-prone DNA polymerase	NA	A0A0K1Y9G6	Streptomyces_phage	28.3	9.2e-79
WP_012128429.1|3591612_3593016_-	DNA polymerase Y family protein	NA	NA	NA	NA	NA
WP_012128428.1|3593020_3593713_-	translesion DNA synthesis-associated protein ImuA	NA	NA	NA	NA	NA
WP_012128427.1|3593844_3594591_-	YciK family oxidoreductase	NA	NA	NA	NA	NA
WP_012128425.1|3594869_3595931_+|protease	protease SohB	protease	A0A2H4UUF9	Bodo_saltans_virus	34.8	3.3e-20
WP_005533590.1|3596141_3596822_+	(d)CMP kinase	NA	NA	NA	NA	NA
WP_005533588.1|3596932_3598603_+	30S ribosomal protein S1	NA	NA	NA	NA	NA
WP_005431133.1|3598816_3599101_+	integration host factor subunit beta	NA	A0A0H3UZA0	Geobacillus_virus	36.7	3.2e-10
WP_005431104.1|3599241_3599535_+	DUF1049 domain-containing protein	NA	NA	NA	NA	NA
WP_012128423.1|3599553_3600729_+	lipopolysaccharide assembly protein LapB	NA	NA	NA	NA	NA
WP_010645640.1|3600812_3601514_+	orotidine-5'-phosphate decarboxylase	NA	NA	NA	NA	NA
WP_012128422.1|3601937_3603785_+	ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_012128421.1|3603910_3604150_-	hypothetical protein	NA	NA	NA	NA	NA
WP_012128420.1|3604298_3604781_-	SRPBCC domain-containing protein	NA	NA	NA	NA	NA
WP_012128419.1|3604887_3605457_-	membrane integrity-associated transporter subunit PqiC	NA	NA	NA	NA	NA
WP_012128418.1|3605456_3607103_-	intermembrane transport protein PqiB	NA	NA	NA	NA	NA
WP_012128416.1|3608607_3609513_-	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_048814324.1|3609742_3610051_+	hypothetical protein	NA	NA	NA	NA	NA
WP_012128414.1|3610113_3612225_+	thioredoxin family protein	NA	NA	NA	NA	NA
WP_012128413.1|3612221_3612734_+	protein disulfide oxidoreductase	NA	NA	NA	NA	NA
WP_021018038.1|3612839_3613469_+	class I SAM-dependent methyltransferase	NA	NA	NA	NA	NA
WP_012128411.1|3613530_3614250_+	class I SAM-dependent methyltransferase	NA	NA	NA	NA	NA
WP_012127146.1|3614795_3615989_+|transposase	IS4 family transposase	transposase	A4KWT9	Enterobacteria_phage	38.1	2.8e-68
WP_086028387.1|3616116_3616887_+	phospholipase A	NA	NA	NA	NA	NA
WP_012128408.1|3616931_3617456_+	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_012128406.1|3617832_3618969_+	efflux RND transporter periplasmic adaptor subunit	NA	NA	NA	NA	NA
WP_012128405.1|3618961_3620233_+	TolC family protein	NA	NA	NA	NA	NA
WP_012128404.1|3620229_3621474_+	ABC transporter permease	NA	NA	NA	NA	NA
WP_012128403.1|3621476_3622760_+	ABC transporter permease	NA	NA	NA	NA	NA
WP_012128402.1|3622752_3623472_+	ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	40.9	2.0e-40
WP_012128399.1|3624744_3625173_+	CesT family type III secretion system chaperone	NA	NA	NA	NA	NA
WP_012128398.1|3625237_3625852_-	3'-5' exonuclease	NA	A0A0A7RWA3	Clostridium_phage	36.7	1.9e-20
WP_080654497.1|3626352_3626715_-	regulatory protein RecX	NA	NA	NA	NA	NA
WP_012128395.1|3626864_3627071_-	hypothetical protein	NA	NA	NA	NA	NA
WP_021018044.1|3627057_3627339_-	hypothetical protein	NA	NA	NA	NA	NA
WP_086028371.1|3629122_3629918_+|transposase	IS5 family transposase	transposase	NA	NA	NA	NA
WP_012128390.1|3630207_3630513_+	hypothetical protein	NA	NA	NA	NA	NA
WP_012128387.1|3631830_3633024_+|transposase	IS4 family transposase	transposase	A4KWT9	Enterobacteria_phage	37.6	3.5e-66
WP_086028361.1|3633597_3634720_+|transposase	IS3 family transposase	transposase	Q6H9S3	Enterobacteria_phage	32.6	9.6e-26
WP_011999327.1|3634846_3635863_-|transposase	IS110 family transposase	transposase	NA	NA	NA	NA
WP_012128385.1|3635973_3637173_-|transposase	IS4 family transposase	transposase	A0A0F7LAS3	uncultured_marine_virus	47.8	1.5e-101
WP_021018048.1|3637328_3638012_+	SDR family oxidoreductase	NA	NA	NA	NA	NA
WP_012128383.1|3639236_3639992_-	hypothetical protein	NA	NA	NA	NA	NA
WP_012128382.1|3639991_3644221_-	LysM peptidoglycan-binding domain-containing protein	NA	NA	NA	NA	NA
WP_012128380.1|3644591_3644852_-	hypothetical protein	NA	NA	NA	NA	NA
WP_012128378.1|3645326_3646301_+	DUF1852 domain-containing protein	NA	NA	NA	NA	NA
WP_041853311.1|3646331_3647360_+	methionine synthase	NA	NA	NA	NA	NA
WP_012126704.1|3647773_3648799_+|transposase	IS110 family transposase	transposase	NA	NA	NA	NA
WP_086028385.1|3650075_3651610_-|transposase	IS3 family transposase	transposase	NA	NA	NA	NA
>prophage 1
NC_022270	Vibrio campbellii ATCC BAA-1116 chromosome II, complete sequence	2195939	7914	74207	2195939	transposase,tRNA	Enterobacteria_phage(21.43%)	54	NA	NA
WP_021018061.1|7914_9459_-|transposase	IS66 family transposase	transposase	S5VTD3	Leptospira_phage	34.2	7.9e-71
WP_011998779.1|9519_9873_-	IS66 family insertion sequence element accessory protein TnpB	NA	NA	NA	NA	NA
WP_011999494.1|9869_10181_-	IS66 family insertion sequence hypothetical protein	NA	NA	NA	NA	NA
WP_012130306.1|10257_10809_-	TniQ family protein	NA	NA	NA	NA	NA
WP_012130304.1|10924_11236_-	hypothetical protein	NA	NA	NA	NA	NA
WP_086028365.1|11363_12897_+|transposase	IS3 family transposase	transposase	A0A1P8CWQ3	Bacillus_phage	28.2	9.1e-11
WP_011999494.1|14053_14365_+	IS66 family insertion sequence hypothetical protein	NA	NA	NA	NA	NA
WP_011998779.1|14361_14715_+	IS66 family insertion sequence element accessory protein TnpB	NA	NA	NA	NA	NA
WP_011999494.1|19407_19719_+	IS66 family insertion sequence hypothetical protein	NA	NA	NA	NA	NA
WP_011998799.1|19715_20069_+	IS66 family insertion sequence element accessory protein TnpB	NA	NA	NA	NA	NA
WP_021018064.1|20128_21682_+|transposase	IS66 family transposase	transposase	S5VTD3	Leptospira_phage	34.9	2.1e-71
WP_012126528.1|23466_24207_+	ATP-binding protein	NA	K4HZD4	Acidithiobacillus_phage	43.2	7.7e-48
WP_012130294.1|24777_25962_+|tRNA	threonine--tRNA ligase	tRNA	A0A2K9L297	Tupanvirus	34.5	2.9e-73
WP_012130293.1|26046_26961_+	hypothetical protein	NA	NA	NA	NA	NA
WP_005428486.1|27246_27837_+	TetR/AcrR family transcriptional regulator	NA	NA	NA	NA	NA
WP_012130291.1|27959_28814_+	alpha/beta hydrolase	NA	NA	NA	NA	NA
WP_041853499.1|28932_31473_-	chitinase	NA	B0FDP2	Orgyia_leucostigma_nucleopolyhedrovirus	47.4	3.6e-145
WP_012130287.1|31842_32346_-	DUF2850 domain-containing protein	NA	NA	NA	NA	NA
WP_012130286.1|32566_32851_+	pyrimidine/purine nucleoside phosphorylase	NA	NA	NA	NA	NA
WP_011999278.1|32897_34229_-|transposase	IS4 family transposase	transposase	NA	NA	NA	NA
WP_005428352.1|34433_34715_+	hypothetical protein	NA	NA	NA	NA	NA
WP_012130285.1|34737_35922_-	GGDEF domain-containing protein	NA	G3MA91	Bacillus_virus	27.5	6.6e-17
WP_011999171.1|36149_37181_-|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_012130283.1|37466_38765_+	carbohydrate porin	NA	NA	NA	NA	NA
WP_012128611.1|38897_40277_-|transposase	IS4 family transposase	transposase	Q9JMP3	Wolbachia_phage	27.2	9.9e-49
WP_012130281.1|40621_41626_+	LacI family DNA-binding transcriptional regulator	NA	C6ZCU4	Enterobacteria_phage	30.9	8.0e-32
WP_012130278.1|42959_43949_+	sugar ABC transporter permease	NA	NA	NA	NA	NA
WP_012130277.1|43950_44835_+	carbohydrate ABC transporter permease	NA	NA	NA	NA	NA
WP_012130276.1|44858_46208_+	beta-glucosidase	NA	A0A0B5JD41	Pandoravirus	34.2	5.5e-68
WP_010648031.1|46207_47302_+	sn-glycerol-3-phosphate ABC transporter ATP-binding protein UgpC	NA	G3M9Y6	Bacillus_virus	33.2	2.5e-26
WP_012130275.1|47436_48459_+	substrate-binding domain-containing protein	NA	C6ZCU4	Enterobacteria_phage	29.5	3.4e-30
WP_012130274.1|48670_50011_+	MATE family efflux transporter	NA	NA	NA	NA	NA
WP_021018067.1|50627_52307_-	ribosomal large subunit pseudouridine synthase A	NA	NA	NA	NA	NA
WP_012130272.1|52501_53299_+	HAD family hydrolase	NA	NA	NA	NA	NA
WP_012130271.1|53400_53805_-	hypothetical protein	NA	NA	NA	NA	NA
WP_012130270.1|53815_54907_-	GGDEF domain-containing protein	NA	NA	NA	NA	NA
WP_041853500.1|54903_55368_-	oxidoreductase	NA	NA	NA	NA	NA
WP_005428270.1|55649_56021_+	DUF805 domain-containing protein	NA	NA	NA	NA	NA
WP_012130267.1|56070_56310_-	hypothetical protein	NA	NA	NA	NA	NA
WP_005428252.1|56512_57352_-	S-formylglutathione hydrolase	NA	NA	NA	NA	NA
WP_005428461.1|57556_58705_-	S-(hydroxymethyl)glutathione dehydrogenase/class III alcohol dehydrogenase	NA	E3SJ82	Synechococcus_phage	28.9	3.0e-35
WP_012130266.1|58994_59810_+	arylamine N-acetyltransferase	NA	NA	NA	NA	NA
WP_012130264.1|60177_60690_+	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_012130263.1|60758_61628_+	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_041853580.1|61702_62476_-	siderophore-interacting protein	NA	NA	NA	NA	NA
WP_012130260.1|63254_64244_-	hypothetical protein	NA	NA	NA	NA	NA
WP_012130259.1|64259_65330_-	HlyD family secretion protein	NA	NA	NA	NA	NA
WP_021018070.1|65463_66354_+	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_041853501.1|66677_68609_-	S9 family peptidase	NA	NA	NA	NA	NA
WP_021018071.1|68880_69465_-	LysE family translocator	NA	NA	NA	NA	NA
WP_010645422.1|69613_70054_+	Lrp/AsnC family transcriptional regulator	NA	NA	NA	NA	NA
WP_012130253.1|71522_72137_-	HAD-IB family hydrolase	NA	NA	NA	NA	NA
WP_005428450.1|72153_72483_-	multidrug efflux SMR transporter	NA	NA	NA	NA	NA
WP_011999348.1|73013_74207_+|transposase	IS4 family transposase	transposase	A4KWT9	Enterobacteria_phage	38.4	1.3e-68
>prophage 2
NC_022270	Vibrio campbellii ATCC BAA-1116 chromosome II, complete sequence	2195939	80506	212758	2195939	transposase,tRNA,protease,integrase	Leptospira_phage(11.11%)	117	80428:80446	175760:175774
80428:80446	attL	GGCTTTGTTGCGTAATTCG	NA	NA	NA	NA
WP_011999114.1|80506_81427_+|transposase	IS5 family transposase	transposase	A0A1V0E8E1	Vibrio_phage	96.4	2.3e-171
80428:80446	attL	GGCTTTGTTGCGTAATTCG	NA	NA	NA	NA
WP_012130243.1|82349_83117_+	transcriptional regulator	NA	NA	NA	NA	NA
WP_012130242.1|83377_86068_+	alpha-glucosidase	NA	NA	NA	NA	NA
WP_012130241.1|86593_87313_+	hypothetical protein	NA	NA	NA	NA	NA
WP_005428362.1|87350_87602_-	TIGR03643 family protein	NA	NA	NA	NA	NA
WP_005428272.1|87731_88151_-	VOC family protein	NA	NA	NA	NA	NA
WP_012130240.1|88352_88814_+	ecotin	NA	NA	NA	NA	NA
WP_012130238.1|88810_89119_+	MliC family protein	NA	NA	NA	NA	NA
WP_005428402.1|89668_90073_+	hypothetical protein	NA	NA	NA	NA	NA
WP_021018074.1|91645_92437_+	hypothetical protein	NA	NA	NA	NA	NA
WP_012130231.1|92993_93485_-	VOC family protein	NA	NA	NA	NA	NA
WP_011999494.1|93853_94165_+	IS66 family insertion sequence hypothetical protein	NA	NA	NA	NA	NA
WP_011998799.1|94161_94515_+	IS66 family insertion sequence element accessory protein TnpB	NA	NA	NA	NA	NA
WP_012130229.1|94574_96119_+|transposase	IS66 family transposase	transposase	S5VTD3	Leptospira_phage	34.7	2.3e-70
WP_010645458.1|96234_96681_+	hypothetical protein	NA	NA	NA	NA	NA
WP_041853583.1|97754_99005_-	hypothetical protein	NA	NA	NA	NA	NA
WP_012130225.1|99145_99463_-	DUF4144 domain-containing protein	NA	NA	NA	NA	NA
WP_012130224.1|99613_100150_-	DUF924 domain-containing protein	NA	A0A1V0SIY0	Klosneuvirus	35.8	8.4e-20
WP_012130223.1|100207_102055_-	M3 family oligoendopeptidase	NA	NA	NA	NA	NA
WP_012128517.1|102273_103746_-	group II intron reverse transcriptase/maturase	NA	A0A0U4J920	Pseudomonas_phage	50.4	5.0e-131
WP_041853502.1|104458_104827_+	hypothetical protein	NA	NA	NA	NA	NA
WP_012130220.1|104893_105067_-	hypothetical protein	NA	NA	NA	NA	NA
WP_012130219.1|105303_106434_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_012130218.1|106580_107714_+	glycerate kinase	NA	W6LM47	Streptococcus_phage	37.1	8.7e-43
WP_012130217.1|107813_109016_-	MFS transporter	NA	NA	NA	NA	NA
WP_041853503.1|109015_109420_-	VOC family protein	NA	NA	NA	NA	NA
WP_021018075.1|109389_110139_-	hypothetical protein	NA	NA	NA	NA	NA
WP_012130214.1|110741_110897_-	hypothetical protein	NA	NA	NA	NA	NA
WP_012130213.1|111063_112500_-	PLP-dependent aminotransferase family protein	NA	A0A1X9I5H2	Streptococcus_phage	26.4	2.1e-25
WP_012130212.1|112610_113528_+	DMT family transporter	NA	NA	NA	NA	NA
WP_012130211.1|113838_114267_-	MarR family transcriptional regulator	NA	NA	NA	NA	NA
WP_012130210.1|114277_114919_-	cytochrome b/b6 domain-containing protein	NA	NA	NA	NA	NA
WP_012130209.1|115051_115495_+	cytochrome c	NA	NA	NA	NA	NA
WP_012130208.1|115563_116241_+	hypothetical protein	NA	NA	NA	NA	NA
WP_012130207.1|116423_116924_-	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_012130206.1|116984_117455_-	HAD family hydrolase	NA	NA	NA	NA	NA
WP_012130205.1|117573_118038_-	GNAT family N-acetyltransferase	NA	Q9G0F8	Roseobacter_virus	24.7	1.7e-05
WP_012130204.1|118047_118779_-	SDR family oxidoreductase	NA	Q06VL0	Trichoplusia_ni_ascovirus	29.8	1.6e-21
WP_012130203.1|118806_119358_-	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_012130202.1|119589_120684_+	NapC/NirT family cytochrome c	NA	NA	NA	NA	NA
WP_012130201.1|120707_123155_+	molybdopterin guanine dinucleotide-containing S/N-oxide reductase	NA	A0A077SK27	Escherichia_phage	28.1	3.0e-72
WP_012130200.1|123233_123959_-	phosphatase PAP2 family protein	NA	NA	NA	NA	NA
WP_012130199.1|124147_124762_-	thiamine phosphate synthase	NA	NA	NA	NA	NA
WP_012130198.1|124824_125616_-	hydroxyethylthiazole kinase	NA	NA	NA	NA	NA
WP_012130197.1|125628_126297_-	thiaminase II	NA	NA	NA	NA	NA
WP_086028440.1|126351_127302_-	ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_012130195.1|127349_128150_-	ABC transporter permease	NA	NA	NA	NA	NA
WP_012130194.1|128142_128895_-	ABC transporter ATP-binding protein	NA	G3M9Y6	Bacillus_virus	40.9	4.2e-25
WP_012130193.1|128884_129772_-	bifunctional hydroxymethylpyrimidine kinase/phosphomethylpyrimidine kinase	NA	NA	NA	NA	NA
WP_005534803.1|130347_131733_+	TldD/PmbA family protein	NA	NA	NA	NA	NA
WP_012130191.1|131732_133076_+	TldD/PmbA family protein	NA	NA	NA	NA	NA
WP_012130190.1|133154_133754_-|tRNA	tRNA (pseudouridine(54)-N(1))-methyltransferase TrmY	tRNA	NA	NA	NA	NA
WP_041853504.1|133912_134413_+	DUF3087 domain-containing protein	NA	NA	NA	NA	NA
WP_021018077.1|140606_141866_+|integrase	tyrosine-type recombinase/integrase	integrase	A7XX23	Thermus_virus	23.4	3.5e-08
WP_012127359.1|142016_143570_-|transposase	IS66 family transposase	transposase	S5VTD3	Leptospira_phage	34.9	4.7e-71
WP_011998799.1|143629_143983_-	IS66 family insertion sequence element accessory protein TnpB	NA	NA	NA	NA	NA
WP_021018078.1|144459_145440_+|integrase	site-specific integrase	integrase	Q76UT6	Pseudomonas_virus	38.7	2.9e-42
WP_012130183.1|145470_146391_+|transposase	IS5 family transposase	transposase	A0A1V0E8E1	Vibrio_phage	96.7	1.6e-172
WP_012130182.1|146387_147032_-	DUF4150 domain-containing protein	NA	NA	NA	NA	NA
146428:146446	attR	CGAATTACGCAACAAAGCC	NA	NA	NA	NA
WP_021018079.1|147049_147502_-	hypothetical protein	NA	NA	NA	NA	NA
146428:146446	attR	CGAATTACGCAACAAAGCC	NA	NA	NA	NA
WP_012130179.1|148083_148326_+	hypothetical protein	NA	NA	NA	NA	NA
WP_012130178.1|148605_149199_+|integrase	tyrosine-type recombinase/integrase	integrase	A3F636	Streptococcus_phage	29.0	1.3e-10
WP_021018080.1|149387_149792_+	hypothetical protein	NA	NA	NA	NA	NA
WP_012130176.1|149793_150735_+	nucleotidyl transferase AbiEii/AbiGii toxin family protein	NA	NA	NA	NA	NA
WP_021018081.1|150754_152302_+	type I restriction-modification system subunit M	NA	A0A2H4PQP4	Staphylococcus_phage	38.3	1.6e-84
WP_012130173.1|152629_153391_+	hypothetical protein	NA	NA	NA	NA	NA
WP_012130170.1|156746_157523_+	M48 family metallopeptidase	NA	NA	NA	NA	NA
WP_021018082.1|157533_157707_+	hypothetical protein	NA	NA	NA	NA	NA
WP_012128396.1|158181_158613_-	regulatory protein RecX	NA	NA	NA	NA	NA
WP_012128395.1|158696_158903_-	hypothetical protein	NA	NA	NA	NA	NA
WP_021018044.1|158889_159171_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011998890.1|159331_159529_+	hypothetical protein	NA	NA	NA	NA	NA
WP_011999494.1|162924_163236_+	IS66 family insertion sequence hypothetical protein	NA	NA	NA	NA	NA
WP_012130165.1|163232_163586_+	IS66 family insertion sequence element accessory protein TnpB	NA	NA	NA	NA	NA
WP_012130164.1|163645_165190_+|transposase	IS66 family transposase	transposase	S5VTD3	Leptospira_phage	34.7	3.0e-70
WP_012130162.1|166711_167365_+	hypothetical protein	NA	NA	NA	NA	NA
WP_021017836.1|167760_168072_+	IS66 family insertion sequence hypothetical protein	NA	NA	NA	NA	NA
WP_021018084.1|169590_169938_+	hypothetical protein	NA	NA	NA	NA	NA
WP_011999348.1|171030_172224_-|transposase	IS4 family transposase	transposase	A4KWT9	Enterobacteria_phage	38.4	1.3e-68
WP_080654503.1|172875_172965_+	DUF3265 domain-containing protein	NA	NA	NA	NA	NA
WP_144080942.1|173079_173262_+	hypothetical protein	NA	NA	NA	NA	NA
WP_012130156.1|173276_174431_-|transposase	IS110 family transposase	transposase	NA	NA	NA	NA
WP_010645962.1|174549_174999_+	effector binding domain-containing protein	NA	NA	NA	NA	NA
WP_012130153.1|176215_177292_-	hypothetical protein	NA	NA	NA	NA	NA
WP_012128611.1|177507_178887_-|transposase	IS4 family transposase	transposase	Q9JMP3	Wolbachia_phage	27.2	9.9e-49
WP_169563925.1|179860_180571_+	hypothetical protein	NA	NA	NA	NA	NA
WP_005530256.1|180786_181143_-	YibL family ribosome-associated protein	NA	NA	NA	NA	NA
WP_021018085.1|181227_182223_-	2-hydroxyacid dehydrogenase	NA	A0A1J0F959	Only_Syngen_Nebraska_virus	42.1	6.2e-69
WP_021018086.1|182400_182883_+	L,D-transpeptidase family protein	NA	NA	NA	NA	NA
WP_012130148.1|182908_183619_-	glycerophosphoryl diester phosphodiesterase	NA	A0A076G4Q2	Staphylococcus_phage	25.8	1.1e-14
WP_012130146.1|184032_184698_+	response regulator transcription factor	NA	W8CYM9	Bacillus_phage	35.2	2.6e-26
WP_012130145.1|184697_186071_+	sensor histidine kinase	NA	W8CYF6	Bacillus_phage	25.9	6.5e-16
WP_012130144.1|186277_188350_+	TonB-dependent siderophore receptor	NA	NA	NA	NA	NA
WP_012130143.1|188425_189193_+	DUF3450 domain-containing protein	NA	NA	NA	NA	NA
WP_012130142.1|189193_190561_+	MotA/TolQ/ExbB proton channel family protein	NA	NA	NA	NA	NA
WP_012130141.1|190560_191115_+	MotA/TolQ/ExbB proton channel family protein	NA	NA	NA	NA	NA
WP_005432634.1|191111_191516_+	biopolymer transporter ExbD	NA	NA	NA	NA	NA
WP_012130140.1|191515_192136_+	energy transducer TonB	NA	NA	NA	NA	NA
WP_012130139.1|192132_193305_+	hypothetical protein	NA	NA	NA	NA	NA
WP_012130138.1|193477_194323_+|protease	CPBP family intramembrane metalloprotease	protease	NA	NA	NA	NA
WP_012128517.1|194746_196219_-	group II intron reverse transcriptase/maturase	NA	A0A0U4J920	Pseudomonas_phage	50.4	5.0e-131
WP_080514183.1|196758_197250_+	PepSY domain-containing protein	NA	NA	NA	NA	NA
WP_021018089.1|197272_197812_+	DUF2271 domain-containing protein	NA	NA	NA	NA	NA
WP_162471677.1|197822_198659_+	DUF4198 domain-containing protein	NA	NA	NA	NA	NA
WP_005432620.1|198703_199024_+	hypothetical protein	NA	NA	NA	NA	NA
WP_012130133.1|199020_199572_+	hypothetical protein	NA	NA	NA	NA	NA
WP_012130132.1|199634_200570_+	zinc ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_012130131.1|200569_201304_+	metal ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	28.1	5.7e-11
WP_005432612.1|201303_202179_+	metal ABC transporter permease	NA	NA	NA	NA	NA
WP_012130130.1|202193_203063_+	ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_041853506.1|203278_204262_+	porin	NA	NA	NA	NA	NA
WP_021018090.1|204440_206606_-	oligopeptidase B	NA	F2Y2Z7	Organic_Lake_phycodnavirus	26.4	9.8e-35
WP_012130127.1|206883_208089_-	multidrug efflux MFS transporter EmrD	NA	NA	NA	NA	NA
WP_012130126.1|208351_209272_-	agmatinase	NA	A0A0N9R043	Chrysochromulina_ericina_virus	27.8	4.1e-06
WP_041853595.1|209273_211184_-	arginine decarboxylase	NA	NA	NA	NA	NA
WP_012130124.1|211520_212270_+	MBL fold metallo-hydrolase	NA	NA	NA	NA	NA
WP_012130123.1|212329_212758_-|protease	ATP-dependent zinc protease	protease	NA	NA	NA	NA
>prophage 3
NC_022270	Vibrio campbellii ATCC BAA-1116 chromosome II, complete sequence	2195939	437008	506654	2195939	transposase	Leptospira_phage(21.43%)	57	NA	NA
WP_021018128.1|437008_438562_+|transposase	IS66 family transposase	transposase	S5VTD3	Leptospira_phage	34.9	3.0e-70
WP_012129917.1|438551_440135_-	DEAD/DEAH box helicase	NA	Q5GF26	Diachasmimorpha_longicaudata_entomopoxvirus	35.5	3.8e-52
WP_012129915.1|442873_443566_-	molecular chaperone	NA	NA	NA	NA	NA
WP_169563927.1|443562_443913_-	DUF4402 domain-containing protein	NA	NA	NA	NA	NA
WP_012129913.1|444063_444498_-	DUF4402 domain-containing protein	NA	NA	NA	NA	NA
WP_012129912.1|445008_445719_-	lipoate--protein ligase A	NA	NA	NA	NA	NA
WP_012129911.1|445961_446426_+	hypothetical protein	NA	NA	NA	NA	NA
WP_012127146.1|446680_447874_-|transposase	IS4 family transposase	transposase	A4KWT9	Enterobacteria_phage	38.1	2.8e-68
WP_021018131.1|448330_449359_-	hypothetical protein	NA	NA	NA	NA	NA
WP_012129907.1|449796_450945_-	PLP-dependent aminotransferase family protein	NA	NA	NA	NA	NA
WP_012129906.1|451076_451946_+	AraC family transcriptional regulator	NA	NA	NA	NA	NA
WP_011999348.1|452196_453390_+|transposase	IS4 family transposase	transposase	A4KWT9	Enterobacteria_phage	38.4	1.3e-68
WP_005532354.1|453519_453759_+	YdcH family protein	NA	NA	NA	NA	NA
WP_012129902.1|454368_455511_+	hypothetical protein	NA	NA	NA	NA	NA
WP_012129901.1|455500_456427_+	zinc ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_012129900.1|456430_457225_+	metal ABC transporter permease	NA	NA	NA	NA	NA
WP_012129899.1|457349_458696_-	DUF1501 domain-containing protein	NA	NA	NA	NA	NA
WP_012129898.1|458701_460186_-	DUF1800 family protein	NA	NA	NA	NA	NA
WP_012129897.1|460624_461344_+	beta-ketoacyl-ACP reductase	NA	NA	NA	NA	NA
WP_011998890.1|461414_461612_+	hypothetical protein	NA	NA	NA	NA	NA
WP_011999348.1|462467_463661_-|transposase	IS4 family transposase	transposase	A4KWT9	Enterobacteria_phage	38.4	1.3e-68
WP_041853608.1|463773_464340_-	reverse transcriptase N-terminal domain-containing protein	NA	A0A0U4J920	Pseudomonas_phage	55.6	6.7e-52
WP_144080972.1|465325_467377_+	type I secretion system permease/ATPase	NA	W8CYL7	Bacillus_phage	29.2	6.9e-38
WP_012129891.1|467361_468735_+	HlyD family type I secretion periplasmic adaptor subunit	NA	NA	NA	NA	NA
WP_144080944.1|470802_471264_+	hypothetical protein	NA	NA	NA	NA	NA
WP_021018132.1|471971_474659_+	calcium-binding protein	NA	NA	NA	NA	NA
WP_021018133.1|474855_475566_+	hypothetical protein	NA	NA	NA	NA	NA
WP_021018134.1|475579_478747_+	calcium-binding protein	NA	NA	NA	NA	NA
WP_021017836.1|479087_479399_+	IS66 family insertion sequence hypothetical protein	NA	NA	NA	NA	NA
WP_012127165.1|479395_479749_+	IS66 family insertion sequence element accessory protein TnpB	NA	NA	NA	NA	NA
WP_012129880.1|479808_481341_+|transposase	IS66 family transposase	transposase	S5VTD3	Leptospira_phage	35.4	1.2e-71
WP_041853519.1|482416_483622_-	DUF3103 domain-containing protein	NA	NA	NA	NA	NA
WP_012129878.1|483878_484523_-	HAD-IA family hydrolase	NA	NA	NA	NA	NA
WP_012129877.1|484587_484995_-	DUF2007 domain-containing protein	NA	NA	NA	NA	NA
WP_012129876.1|485234_485762_+	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_012129873.1|486309_487170_+	glutathione-dependent disulfide-bond oxidoreductase	NA	NA	NA	NA	NA
WP_012129872.1|487493_489101_-	BCCT family transporter	NA	A0A2I7QNT1	Vibrio_phage	27.7	1.5e-27
WP_005426354.1|489578_490748_+	D-alanyl-D-alanine carboxypeptidase	NA	B6DZZ7	Stx2-converting_phage	46.7	6.2e-84
WP_021018135.1|490852_491260_+	SPOR domain-containing protein	NA	NA	NA	NA	NA
WP_012129868.1|491458_492163_+	methyltransferase domain-containing protein	NA	A0A1X9I6N4	Streptococcus_phage	34.1	3.2e-11
WP_012129867.1|492243_492717_-	peroxiredoxin	NA	M1I839	Pelagibacter_phage	41.7	1.0e-21
WP_012129865.1|493115_494123_-	adenosine deaminase	NA	NA	NA	NA	NA
WP_012129864.1|494628_494769_-	hypothetical protein	NA	NA	NA	NA	NA
WP_021018136.1|494832_495042_-	hypothetical protein	NA	NA	NA	NA	NA
WP_005426339.1|495335_495548_-	cold-shock protein	NA	A0A1W6JNX5	Morganella_phage	65.7	2.5e-20
WP_012129862.1|495869_496718_+	pirin family protein	NA	NA	NA	NA	NA
WP_041853520.1|496960_497809_-	patatin family protein	NA	NA	NA	NA	NA
WP_010647262.1|497988_498447_+	transcriptional repressor	NA	NA	NA	NA	NA
WP_012129859.1|498537_499872_+	dihydroorotase	NA	NA	NA	NA	NA
WP_021018137.1|500020_500581_+	carbonate dehydratase	NA	NA	NA	NA	NA
WP_012129857.1|500570_501575_+	GTP-binding protein	NA	NA	NA	NA	NA
WP_012129856.1|501797_502712_+	CDF family Co(II)/Ni(II) efflux transporter DmeF	NA	NA	NA	NA	NA
WP_012129855.1|502711_503128_+	MarR family transcriptional regulator	NA	NA	NA	NA	NA
WP_005426383.1|503517_503853_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011999494.1|504400_504712_+	IS66 family insertion sequence hypothetical protein	NA	NA	NA	NA	NA
WP_012127165.1|504708_505062_+	IS66 family insertion sequence element accessory protein TnpB	NA	NA	NA	NA	NA
WP_012127491.1|505121_506654_+|transposase	IS66 family transposase	transposase	S5VTD3	Leptospira_phage	35.2	1.2e-71
>prophage 4
NC_022270	Vibrio campbellii ATCC BAA-1116 chromosome II, complete sequence	2195939	514080	573684	2195939	transposase	Enterobacteria_phage(28.57%)	44	NA	NA
WP_011999278.1|514080_515412_-|transposase	IS4 family transposase	transposase	NA	NA	NA	NA
WP_021018138.1|515573_515999_-	universal stress protein	NA	NA	NA	NA	NA
WP_005426417.1|516155_516407_-	hypothetical protein	NA	NA	NA	NA	NA
WP_012129842.1|518145_519174_+|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_021018139.1|519601_521758_+	S9 family peptidase	NA	A0A1V0SHT0	Klosneuvirus	32.8	1.8e-65
WP_144080945.1|523645_523846_+	hypothetical protein	NA	NA	NA	NA	NA
WP_012129834.1|523910_524831_+|transposase	IS5 family transposase	transposase	A0A1V0E8E1	Vibrio_phage	96.4	2.3e-171
WP_080514178.1|524862_526023_+	group II intron reverse transcriptase/maturase	NA	A0A0U4J920	Pseudomonas_phage	30.1	1.1e-27
WP_012129832.1|526058_526589_-	spermidine N1-acetyltransferase	NA	NA	NA	NA	NA
WP_005426336.1|526860_527013_+	hypothetical protein	NA	NA	NA	NA	NA
WP_169563909.1|527445_528477_-|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_012129829.1|529990_530353_+	VOC family protein	NA	NA	NA	NA	NA
WP_021018141.1|530479_530995_+	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_012129827.1|531014_531413_+	NUDIX domain-containing protein	NA	NA	NA	NA	NA
WP_012129825.1|531627_532479_-	CARB/PSE/RTG family carbenicillin-hydrolyzing class A beta-lactamase	NA	A0A077SL40	Escherichia_phage	42.0	5.5e-50
WP_021018142.1|532803_533682_-	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_012129823.1|533790_534414_+	homoserine/homoserine lactone efflux protein	NA	NA	NA	NA	NA
WP_005425081.1|534487_535054_-	copper-binding protein	NA	NA	NA	NA	NA
WP_012129822.1|535132_538312_-	efflux RND transporter permease subunit	NA	NA	NA	NA	NA
WP_012129821.1|538314_540048_-	efflux RND transporter periplasmic adaptor subunit	NA	NA	NA	NA	NA
WP_012129820.1|540212_541604_-	TolC family protein	NA	NA	NA	NA	NA
WP_041853521.1|541738_542176_-	hypothetical protein	NA	NA	NA	NA	NA
WP_012129818.1|542491_546730_+	formate dehydrogenase subunit alpha	NA	NA	NA	NA	NA
WP_012129817.1|546823_547750_+	endonuclease/exonuclease/phosphatase family protein	NA	NA	NA	NA	NA
WP_012129816.1|547980_548313_+	hypothetical protein	NA	NA	NA	NA	NA
WP_005425148.1|548390_549488_-	ABC transporter permease	NA	NA	NA	NA	NA
WP_005534577.1|549487_550414_-	ABC transporter ATP-binding protein	NA	A0A285PWH2	Cedratvirus	34.6	3.7e-23
WP_041853612.1|550418_551366_-	HlyD family efflux transporter periplasmic adaptor subunit	NA	NA	NA	NA	NA
WP_012129813.1|551738_552602_-	MurR/RpiR family transcriptional regulator	NA	NA	NA	NA	NA
WP_012129810.1|554142_555588_+	D-aminoacylase	NA	NA	NA	NA	NA
WP_012129781.1|556174_557206_-|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_012129808.1|557372_558893_+	sodium:solute symporter family protein	NA	NA	NA	NA	NA
WP_012129807.1|558995_559940_+	sugar kinase	NA	NA	NA	NA	NA
WP_011999348.1|560260_561454_-|transposase	IS4 family transposase	transposase	A4KWT9	Enterobacteria_phage	38.4	1.3e-68
WP_012129803.1|564841_565888_+	lactonase family protein	NA	NA	NA	NA	NA
WP_005534602.1|565902_566265_+	RidA family protein	NA	NA	NA	NA	NA
WP_012129802.1|566521_567055_+	YbhB/YbcL family Raf kinase inhibitor-like protein	NA	NA	NA	NA	NA
WP_012129801.1|567086_567869_+	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_012129800.1|567889_568108_-	hypothetical protein	NA	NA	NA	NA	NA
WP_005435488.1|568261_569317_-	ACR3 family arsenite efflux transporter	NA	NA	NA	NA	NA
WP_012129799.1|569402_569744_-	winged helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_012129798.1|570013_570598_+	NAD(P)H-dependent oxidoreductase	NA	NA	NA	NA	NA
WP_012129797.1|570765_571134_+	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_011999529.1|572490_573684_-|transposase	IS4 family transposase	transposase	A4KWT9	Enterobacteria_phage	38.4	5.7e-69
>prophage 5
NC_022270	Vibrio campbellii ATCC BAA-1116 chromosome II, complete sequence	2195939	607492	673699	2195939	transposase,integrase	Enterobacteria_phage(12.5%)	54	633923:633937	678547:678561
WP_012127146.1|607492_608686_+|transposase	IS4 family transposase	transposase	A4KWT9	Enterobacteria_phage	38.1	2.8e-68
WP_012128611.1|608823_610203_+|transposase	IS4 family transposase	transposase	Q9JMP3	Wolbachia_phage	27.2	9.9e-49
WP_005426000.1|610519_611488_-	porin	NA	NA	NA	NA	NA
WP_041853524.1|612056_613091_+	porin	NA	NA	NA	NA	NA
WP_012129758.1|613297_613912_+	fumarylacetoacetate hydrolase family protein	NA	NA	NA	NA	NA
WP_012129757.1|613920_614232_-	AzlD domain-containing protein	NA	NA	NA	NA	NA
WP_012129756.1|614228_614972_-	AzlC family ABC transporter permease	NA	NA	NA	NA	NA
WP_012129755.1|615043_615871_-	AraC family transcriptional regulator	NA	NA	NA	NA	NA
WP_012129754.1|616112_616745_+	LysE family translocator	NA	NA	NA	NA	NA
WP_011999278.1|617129_618461_-|transposase	IS4 family transposase	transposase	NA	NA	NA	NA
WP_021018154.1|618784_620479_-	phospho-sugar mutase	NA	A0A1X9I671	Streptococcus_phage	37.1	2.8e-93
WP_080514177.1|620808_621972_+	cytochrome c oxidase subunit II	NA	NA	NA	NA	NA
WP_012129748.1|621968_623609_+	cytochrome c oxidase subunit I	NA	R9VX24	Flavobacterium_phage	35.5	1.5e-11
WP_012129747.1|623629_624220_+	cytochrome c oxidase assembly protein	NA	NA	NA	NA	NA
WP_012129746.1|624231_625116_+	cytochrome c oxidase subunit 3	NA	NA	NA	NA	NA
WP_012129745.1|625118_625355_-	DUF2909 domain-containing protein	NA	NA	NA	NA	NA
WP_012129744.1|625353_626121_+	SURF1 family protein	NA	NA	NA	NA	NA
WP_012129743.1|626117_626654_+	hypothetical protein	NA	NA	NA	NA	NA
WP_012129742.1|626666_627686_+	COX15/CtaA family protein	NA	NA	NA	NA	NA
WP_012129741.1|627678_628593_+	protoheme IX farnesyltransferase	NA	NA	NA	NA	NA
WP_010647147.1|629054_630035_-	OmpA family protein	NA	NA	NA	NA	NA
WP_012129738.1|630495_631548_+	3-deoxy-7-phosphoheptulonate synthase AroG	NA	S4W5F1	Pandoravirus	49.5	3.7e-80
WP_012128611.1|631606_632986_-|transposase	IS4 family transposase	transposase	Q9JMP3	Wolbachia_phage	27.2	9.9e-49
WP_021018156.1|633216_634389_+	MFS transporter	NA	NA	NA	NA	NA
633923:633937	attL	GTGGCTTTGACTTCA	NA	NA	NA	NA
WP_012129736.1|634607_636170_+	methyl-accepting chemotaxis protein	NA	A0A1B0V854	Salmonella_phage	48.6	1.7e-28
WP_012129735.1|636295_638302_-	transketolase	NA	NA	NA	NA	NA
WP_005425862.1|638427_639378_-	transaldolase	NA	M4SLG0	Cyanophage	27.8	1.5e-11
WP_012129734.1|639842_640844_+	sugar-binding transcriptional regulator	NA	NA	NA	NA	NA
WP_012129733.1|640970_642266_+	glycoside hydrolase family 18 protein	NA	A0A1B1V5N4	Malacosoma_sp._alphabaculovirus	35.6	1.4e-68
WP_012129732.1|642307_644599_-	EAL domain-containing protein	NA	A0A127AWB9	Bacillus_phage	30.0	2.3e-13
WP_012129731.1|644620_645451_-	sulfurtransferase	NA	NA	NA	NA	NA
WP_012129730.1|645506_645806_-	hypothetical protein	NA	NA	NA	NA	NA
WP_012129722.1|650801_651719_+	acyl transferase	NA	NA	NA	NA	NA
WP_012129721.1|651753_652821_+	LLM class flavin-dependent oxidoreductase	NA	NA	NA	NA	NA
WP_012129720.1|652847_653822_+	LLM class flavin-dependent oxidoreductase	NA	NA	NA	NA	NA
WP_012129719.1|653907_655044_+	long-chain-fatty-acid--CoA ligase	NA	NA	NA	NA	NA
WP_021018158.1|655045_655747_+	NAD(P)H-flavin reductase	NA	NA	NA	NA	NA
WP_012129717.1|655769_656462_+	3,4-dihydroxy-2-butanone-4-phosphate synthase	NA	A0A2H4PQS2	Staphylococcus_phage	40.0	2.5e-40
WP_012129716.1|656597_657308_-	molybdopterin-synthase adenylyltransferase MoeB	NA	NA	NA	NA	NA
WP_021018159.1|657317_658553_-	molybdopterin molybdotransferase MoeA	NA	NA	NA	NA	NA
WP_005373478.1|658839_659493_+	GTP cyclohydrolase I FolE	NA	R9TJA5	Vibrio_phage	54.3	3.4e-55
WP_021018160.1|659537_660503_-	TDT family transporter	NA	NA	NA	NA	NA
WP_012129713.1|660745_662152_-	H(+)/Cl(-) exchange transporter ClcA	NA	NA	NA	NA	NA
WP_021018161.1|662814_663375_+	hypothetical protein	NA	NA	NA	NA	NA
WP_012129711.1|663386_663806_-	helix-turn-helix transcriptional regulator	NA	A0A1C6ZDG7	Pseudomonas_phage	40.0	2.4e-06
WP_012129710.1|663902_664811_+	aldo/keto reductase family oxidoreductase	NA	A0A1V0SDE7	Indivirus	28.8	4.3e-08
WP_005425987.1|665132_666137_+	response regulator	NA	NA	NA	NA	NA
WP_005425904.1|666136_666577_+	PAS domain-containing protein	NA	NA	NA	NA	NA
WP_012129708.1|666687_668226_+	bifunctional ADP-dependent NAD(P)H-hydrate dehydratase/NAD(P)H-hydrate epimerase	NA	NA	NA	NA	NA
WP_012129706.1|668673_669717_+	GMP reductase	NA	A0A0N9Q9A5	Chrysochromulina_ericina_virus	53.9	3.0e-98
WP_012129705.1|669861_670482_+	TnsA endonuclease N-terminal domain-containing protein	NA	NA	NA	NA	NA
WP_012129704.1|670484_671387_+	hypothetical protein	NA	NA	NA	NA	NA
WP_012129703.1|671404_672598_-|transposase	IS4 family transposase	transposase	A4KWT9	Enterobacteria_phage	38.4	9.8e-69
WP_012129701.1|672697_673699_+|integrase,transposase	DDE-type integrase/transposase/recombinase	integrase,transposase	NA	NA	NA	NA
678547:678561	attR	GTGGCTTTGACTTCA	NA	NA	NA	NA
>prophage 6
NC_022270	Vibrio campbellii ATCC BAA-1116 chromosome II, complete sequence	2195939	688950	746763	2195939	transposase,holin	Enterobacteria_phage(30.0%)	47	NA	NA
WP_012127146.1|688950_690144_+|transposase	IS4 family transposase	transposase	A4KWT9	Enterobacteria_phage	38.1	2.8e-68
WP_012129686.1|692095_694105_+	AAA family ATPase	NA	NA	NA	NA	NA
WP_012129685.1|694110_694602_+	UvrD-helicase domain-containing protein	NA	NA	NA	NA	NA
WP_011999348.1|694697_695891_+|transposase	IS4 family transposase	transposase	A4KWT9	Enterobacteria_phage	38.4	1.3e-68
WP_012129684.1|695859_696768_-	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_012129683.1|697234_697441_+	Flp family type IVb pilin	NA	NA	NA	NA	NA
WP_021018165.1|697604_698021_+	prepilin peptidase	NA	NA	NA	NA	NA
WP_012129681.1|698042_698867_+	pilus assembly protein CpaB	NA	NA	NA	NA	NA
WP_012129680.1|698866_700237_+	BON domain-containing protein	NA	NA	NA	NA	NA
WP_012129679.1|700233_700710_+	hypothetical protein	NA	NA	NA	NA	NA
WP_012129678.1|700712_701954_+	hypothetical protein	NA	NA	NA	NA	NA
WP_012129677.1|701950_703222_+	CpaF family protein	NA	NA	NA	NA	NA
WP_005425870.1|703223_704126_+	type II secretion system F family protein	NA	NA	NA	NA	NA
WP_005425863.1|704122_704965_+	type II secretion system F family protein	NA	NA	NA	NA	NA
WP_012129676.1|704976_705699_+	tetratricopeptide repeat protein	NA	NA	NA	NA	NA
WP_041853526.1|705701_706184_+	pilus assembly protein	NA	NA	NA	NA	NA
WP_012129674.1|706170_706731_+	hypothetical protein	NA	NA	NA	NA	NA
WP_012129673.1|706735_708283_+	pilus assembly protein	NA	NA	NA	NA	NA
WP_012129672.1|708291_708942_+	OmpA family protein	NA	NA	NA	NA	NA
WP_012129671.1|708980_710453_+	hypothetical protein	NA	NA	NA	NA	NA
WP_012129670.1|710684_711947_+	amidohydrolase family protein	NA	NA	NA	NA	NA
WP_086028361.1|712070_713194_-|transposase	IS3 family transposase	transposase	U5P429	Shigella_phage	34.3	6.9e-24
WP_009700210.1|713819_714419_+	transcriptional regulator BetI	NA	NA	NA	NA	NA
WP_012129669.1|714435_715896_+	betaine-aldehyde dehydrogenase	NA	NA	NA	NA	NA
WP_012129668.1|715915_717625_+|holin	choline dehydrogenase	holin	A0A1V0S9M4	Catovirus	31.5	8.2e-61
WP_021018166.1|717667_718606_+|holin	choline ABC transporter substrate-binding protein	holin	NA	NA	NA	NA
WP_005425967.1|718668_719511_+|holin	choline ABC transporter permease subunit	holin	NA	NA	NA	NA
WP_012129666.1|719512_720697_+|holin	choline ABC transporter ATP-binding protein	holin	G3M9Y6	Bacillus_virus	35.2	7.8e-26
WP_012129665.1|720840_721497_-	nitroreductase family protein	NA	NA	NA	NA	NA
WP_012129664.1|721715_722507_-	slipin family protein	NA	A0A2K9L3L2	Tupanvirus	29.9	2.2e-24
WP_012129663.1|722516_723884_-	nodulation protein NfeD	NA	NA	NA	NA	NA
WP_012129661.1|724286_725954_-	response regulator	NA	NA	NA	NA	NA
WP_012129660.1|726013_727156_-	EAL domain-containing response regulator	NA	NA	NA	NA	NA
WP_041853527.1|727156_730759_-	transporter substrate-binding domain-containing protein	NA	A0A1V0SGX0	Hokovirus	26.5	1.1e-33
WP_012129658.1|731016_731988_+	c-type cytochrome	NA	NA	NA	NA	NA
WP_012128517.1|733787_735260_-	group II intron reverse transcriptase/maturase	NA	A0A0U4J920	Pseudomonas_phage	50.4	5.0e-131
WP_012129654.1|736625_737093_+	OsmC family protein	NA	NA	NA	NA	NA
WP_012129653.1|737317_738328_+	DUF2804 domain-containing protein	NA	NA	NA	NA	NA
WP_012129652.1|738337_739153_+	sterol desaturase family protein	NA	NA	NA	NA	NA
WP_012129650.1|739825_740344_+	DUF4136 domain-containing protein	NA	NA	NA	NA	NA
WP_012129649.1|740481_740889_+	hypothetical protein	NA	NA	NA	NA	NA
WP_005431873.1|740939_741617_+	DedA family protein	NA	NA	NA	NA	NA
WP_012129648.1|741702_742020_-	hypothetical protein	NA	NA	NA	NA	NA
WP_021018168.1|742114_742522_-	hypothetical protein	NA	NA	NA	NA	NA
WP_012128611.1|742723_744103_-|transposase	IS4 family transposase	transposase	Q9JMP3	Wolbachia_phage	27.2	9.9e-49
WP_012129645.1|744247_744886_-	murein L,D-transpeptidase catalytic domain family protein	NA	NA	NA	NA	NA
WP_012129643.1|745569_746763_-|transposase	IS4 family transposase	transposase	A4KWT9	Enterobacteria_phage	38.1	4.8e-68
>prophage 7
NC_022270	Vibrio campbellii ATCC BAA-1116 chromosome II, complete sequence	2195939	820091	848092	2195939	transposase	Enterobacteria_phage(22.22%)	24	NA	NA
WP_011999171.1|820091_821123_-|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_012129595.1|821356_823402_+	hybrid sensor histidine kinase/response regulator	NA	Q8QKV7	Ectocarpus_siliculosus_virus	38.3	2.9e-12
WP_041853530.1|823508_824690_-	quorum-sensing autoinducer synthase	NA	NA	NA	NA	NA
WP_005426767.1|825099_826044_-	ribosome biogenesis GTPase YlqF	NA	NA	NA	NA	NA
WP_086028432.1|826595_827390_+|transposase	IS5-like element ISVha3 family transposase	transposase	A0A0M5M147	Mycobacterium_phage	36.4	2.4e-31
WP_012129587.1|829642_829981_+	hypothetical protein	NA	A0A1P8DTL0	Salmonella_phage	37.4	2.7e-08
WP_144080947.1|830505_831060_+	toxin-activating lysine-acyltransferase	NA	NA	NA	NA	NA
WP_011999348.1|831028_832222_-|transposase	IS4 family transposase	transposase	A4KWT9	Enterobacteria_phage	38.4	1.3e-68
WP_012129584.1|832350_833550_-|transposase	IS4 family transposase	transposase	A0A0F7LAS3	uncultured_marine_virus	47.8	1.1e-101
WP_012129583.1|833693_834167_+	hypothetical protein	NA	NA	NA	NA	NA
WP_012129580.1|834413_835094_+	methyltransferase domain-containing protein	NA	NA	NA	NA	NA
WP_012129578.1|835254_835740_+	deoxycytidine deaminase	NA	I4AZP2	Saccharomonospora_phage	31.3	2.1e-06
WP_012129577.1|835736_836255_+	dCTP deaminase	NA	NA	NA	NA	NA
WP_012129576.1|836266_837277_+	phosphotransferase	NA	NA	NA	NA	NA
WP_012129575.1|837260_838517_+	diaminopimelate decarboxylase	NA	NA	NA	NA	NA
WP_012129574.1|838513_839734_+	MFS transporter	NA	NA	NA	NA	NA
WP_012129573.1|839723_840773_+	ATP-grasp domain-containing protein	NA	NA	NA	NA	NA
WP_011999494.1|840849_841161_+	IS66 family insertion sequence hypothetical protein	NA	NA	NA	NA	NA
WP_011998779.1|841157_841511_+	IS66 family insertion sequence element accessory protein TnpB	NA	NA	NA	NA	NA
WP_169563922.1|841571_842072_+	hypothetical protein	NA	NA	NA	NA	NA
WP_012127697.1|842227_843760_+|transposase	IS21 family transposase	transposase	K4I413	Acidithiobacillus_phage	42.1	3.9e-110
WP_012127698.1|843770_844511_+	ATP-binding protein	NA	K4HZD4	Acidithiobacillus_phage	43.2	7.7e-48
WP_144080948.1|845923_846808_+	hypothetical protein	NA	NA	NA	NA	NA
WP_012127146.1|846898_848092_+|transposase	IS4 family transposase	transposase	A4KWT9	Enterobacteria_phage	38.1	2.8e-68
>prophage 8
NC_022270	Vibrio campbellii ATCC BAA-1116 chromosome II, complete sequence	2195939	851816	917041	2195939	transposase	Vibrio_phage(21.43%)	54	NA	NA
WP_011999347.1|851816_852845_-|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_041853531.1|854307_855099_-	hypothetical protein	NA	A0A0P0ZFK4	Escherichia_phage	33.2	4.9e-24
WP_011999348.1|855337_856531_+|transposase	IS4 family transposase	transposase	A4KWT9	Enterobacteria_phage	38.4	1.3e-68
WP_012129558.1|856742_857744_+	metal-dependent hydrolase	NA	NA	NA	NA	NA
WP_012129557.1|857773_858157_-	hypothetical protein	NA	NA	NA	NA	NA
WP_048814477.1|858549_858711_+	glutathione S-transferase	NA	NA	NA	NA	NA
WP_012129555.1|858881_859073_+	hypothetical protein	NA	NA	NA	NA	NA
WP_005431386.1|859183_859642_+	hypothetical protein	NA	NA	NA	NA	NA
WP_048814421.1|859896_861060_-	multidrug effflux MFS transporter	NA	S4TR35	Salmonella_phage	24.0	4.3e-13
WP_012129552.1|861336_861588_+	hypothetical protein	NA	NA	NA	NA	NA
WP_086028365.1|861661_863196_-|transposase	IS3 family transposase	transposase	A0A1P8CWQ3	Bacillus_phage	28.2	9.1e-11
WP_012129551.1|863301_863715_+	NUDIX domain-containing protein	NA	A0A1L7N0J3	Ralstonia_phage	44.4	8.1e-23
WP_012129550.1|863781_864261_+	ATP-binding protein	NA	NA	NA	NA	NA
WP_005533200.1|864398_864836_+	hypothetical protein	NA	NA	NA	NA	NA
WP_012129549.1|864836_865016_+	DUF1289 domain-containing protein	NA	NA	NA	NA	NA
WP_005533203.1|865026_865299_-	Ni(II)/Co(II)-binding transcriptional repressor RcnR	NA	NA	NA	NA	NA
WP_021018184.1|865603_866026_+	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_012129547.1|866142_867903_-	ABC transporter ATP-binding protein/permease	NA	W8CYL7	Bacillus_phage	31.6	3.3e-65
WP_012129546.1|868057_868234_-	Lacal_2735 family protein	NA	NA	NA	NA	NA
WP_005431261.1|868686_869913_+	DUF819 family protein	NA	NA	NA	NA	NA
WP_021018185.1|870309_871059_+	MipA/OmpV family protein	NA	NA	NA	NA	NA
WP_041853532.1|871196_872090_-	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_012129542.1|872198_873068_+	acetyl-CoA carboxylase carboxyltransferase subunit beta	NA	NA	NA	NA	NA
WP_012129541.1|873146_873887_-	prephenate dehydratase	NA	NA	NA	NA	NA
WP_005533223.1|874250_874511_+	DUF5062 family protein	NA	NA	NA	NA	NA
WP_086028361.1|874652_875775_+|transposase	IS3 family transposase	transposase	U5P429	Shigella_phage	34.3	6.9e-24
WP_012129539.1|875995_876490_+	YcxB family protein	NA	NA	NA	NA	NA
WP_012129538.1|876585_878727_-	TonB-dependent receptor	NA	NA	NA	NA	NA
WP_012129537.1|878775_879540_-	Fe(3+) dicitrate ABC transporter ATP-binding protein FecE	NA	F2Y2R6	Organic_Lake_phycodnavirus	28.7	1.2e-14
WP_012129536.1|879539_880511_-	iron chelate uptake ABC transporter family permease subunit	NA	NA	NA	NA	NA
WP_012129535.1|880507_881524_-	iron chelate uptake ABC transporter family permease subunit	NA	NA	NA	NA	NA
WP_012129534.1|881524_882421_-	Fe(3+)-dicitrate ABC transporter substrate-binding protein FecB	NA	NA	NA	NA	NA
WP_012129532.1|882834_883311_-	hypothetical protein	NA	NA	NA	NA	NA
WP_012129531.1|883323_885432_-	LruC domain-containing protein	NA	NA	NA	NA	NA
WP_021018186.1|885714_886635_-|transposase	IS5 family transposase	transposase	A0A1V0E8E1	Vibrio_phage	85.9	1.1e-149
WP_011999171.1|887119_888151_-|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_012129525.1|889903_890446_+	hypothetical protein	NA	NA	NA	NA	NA
WP_012129416.1|890531_891032_+	hypothetical protein	NA	NA	NA	NA	NA
WP_012129524.1|891054_893859_+	CS1-pili formation C-terminal domain-containing protein	NA	NA	NA	NA	NA
WP_012129413.1|893877_894606_+	hypothetical protein	NA	NA	NA	NA	NA
WP_012129412.1|894571_895657_+	hypothetical protein	NA	NA	NA	NA	NA
WP_012129411.1|895653_895869_+	hypothetical protein	NA	NA	NA	NA	NA
WP_012129523.1|895868_898442_+	peptidase	NA	NA	NA	NA	NA
WP_021018190.1|899030_899939_-|transposase	IS5 family transposase	transposase	A0A1V0E8E1	Vibrio_phage	93.7	1.2e-162
WP_086028371.1|900624_901421_-|transposase	IS5 family transposase	transposase	A0A0M5M147	Mycobacterium_phage	36.9	5.4e-31
WP_021018192.1|902467_903550_+	hypothetical protein	NA	NA	NA	NA	NA
WP_021018193.1|903546_903705_+	hypothetical protein	NA	NA	NA	NA	NA
WP_021018197.1|906908_907817_-|transposase	IS5 family transposase	transposase	A0A1V0E8E1	Vibrio_phage	93.0	4.8e-161
WP_012129510.1|908349_911214_-	aminomethyl-transferring glycine dehydrogenase	NA	E3SN07	Prochlorococcus_phage	52.3	3.0e-273
WP_005431364.1|911343_911724_-	glycine cleavage system protein GcvH	NA	NA	NA	NA	NA
WP_012129509.1|911775_913071_-	serine hydroxymethyltransferase	NA	A0A240F3L3	Aeromonas_phage	52.3	1.7e-103
WP_005431308.1|913449_914073_+	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_041853534.1|914340_915459_+	glycine cleavage system aminomethyltransferase GcvT	NA	NA	NA	NA	NA
WP_012127098.1|915718_917041_+|transposase	IS4 family transposase	transposase	NA	NA	NA	NA
>prophage 9
NC_022270	Vibrio campbellii ATCC BAA-1116 chromosome II, complete sequence	2195939	971291	997640	2195939	transposase	Leptospira_phage(25.0%)	16	NA	NA
WP_012127098.1|971291_972614_+|transposase	IS4 family transposase	transposase	NA	NA	NA	NA
WP_011999494.1|972746_973058_+	IS66 family insertion sequence hypothetical protein	NA	NA	NA	NA	NA
WP_011998799.1|973054_973408_+	IS66 family insertion sequence element accessory protein TnpB	NA	NA	NA	NA	NA
WP_012129463.1|973467_974964_+|transposase	IS66 family transposase	transposase	S5VTD3	Leptospira_phage	35.2	1.7e-70
WP_021018205.1|975699_976062_+|transposase	ISAs1 family transposase	transposase	NA	NA	NA	NA
WP_012126736.1|979503_981693_+	DUF5011 domain-containing protein	NA	NA	NA	NA	NA
WP_011999348.1|982298_983492_+|transposase	IS4 family transposase	transposase	A4KWT9	Enterobacteria_phage	38.4	1.3e-68
WP_086028371.1|984732_985528_+|transposase	IS5 family transposase	transposase	A0A0M5M147	Mycobacterium_phage	36.9	5.4e-31
WP_012129458.1|985558_986167_-	response regulator transcription factor	NA	NA	NA	NA	NA
WP_012128174.1|986338_987367_-|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_005426806.1|987652_988375_+	nitroreductase family protein	NA	NA	NA	NA	NA
WP_012129456.1|988635_989616_+	chemotaxis protein CheV	NA	Q56AR1	Bacillus_thuringiensis_phage	75.9	5.8e-136
WP_012129455.1|989796_990519_+	sulfite exporter TauE/SafE family protein	NA	NA	NA	NA	NA
WP_012129454.1|990601_991507_+	EamA family transporter RarD	NA	NA	NA	NA	NA
WP_012129448.1|994105_995470_-	endonuclease/exonuclease/phosphatase family protein	NA	NA	NA	NA	NA
WP_011999187.1|996314_997640_+|transposase	IS4 family transposase	transposase	NA	NA	NA	NA
>prophage 10
NC_022270	Vibrio campbellii ATCC BAA-1116 chromosome II, complete sequence	2195939	1023501	1070718	2195939	transposase,protease,plate	Vibrio_phage(25.0%)	34	NA	NA
WP_005532467.1|1023501_1023912_+|plate	type VI secretion system baseplate subunit TssE	plate	NA	NA	NA	NA
WP_012129430.1|1023922_1025671_+|plate	type VI secretion system baseplate subunit TssF	plate	NA	NA	NA	NA
WP_005532465.1|1025667_1026666_+|plate	type VI secretion system baseplate subunit TssG	plate	NA	NA	NA	NA
WP_005427005.1|1026765_1027218_-	Lrp/AsnC family transcriptional regulator	NA	NA	NA	NA	NA
WP_012129429.1|1027250_1030640_-	type VI secretion system membrane subunit TssM	NA	NA	NA	NA	NA
WP_012129428.1|1030667_1031972_-	type VI secretion system ImpA family N-terminal domain-containing protein	NA	NA	NA	NA	NA
WP_021018210.1|1032594_1033194_+	hypothetical protein	NA	NA	NA	NA	NA
WP_012129426.1|1033203_1034718_+	FHA domain-containing protein	NA	NA	NA	NA	NA
WP_077201632.1|1034710_1035211_+	type VI secretion system lipoprotein TssJ	NA	NA	NA	NA	NA
WP_005426887.1|1035222_1036548_+|plate	type VI secretion system baseplate subunit TssK	plate	NA	NA	NA	NA
WP_005495177.1|1036544_1037336_+	DotU family type IV/VI secretion system protein	NA	NA	NA	NA	NA
WP_012129425.1|1037439_1038360_-|transposase	IS5 family transposase	transposase	A0A1V0E8E1	Vibrio_phage	96.4	6.2e-172
WP_041853645.1|1039096_1039426_+	hypothetical protein	NA	NA	NA	NA	NA
WP_012129422.1|1039676_1041833_+	TonB-dependent receptor	NA	NA	NA	NA	NA
WP_012129421.1|1041826_1042366_+	YfiR family protein	NA	NA	NA	NA	NA
WP_012129420.1|1042362_1044279_+	diguanylate cyclase	NA	G3MA91	Bacillus_virus	42.2	7.9e-28
WP_021018212.1|1045098_1045986_+	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_144080953.1|1046042_1046838_+|transposase	IS5 family transposase	transposase	A0A0M5M147	Mycobacterium_phage	36.9	9.2e-31
WP_012129417.1|1048781_1049315_+	hypothetical protein	NA	NA	NA	NA	NA
WP_012129416.1|1049665_1050166_+	hypothetical protein	NA	NA	NA	NA	NA
WP_012130424.1|1050188_1052996_+	CS1-pili formation C-terminal domain-containing protein	NA	NA	NA	NA	NA
WP_051184959.1|1053014_1053722_+	hypothetical protein	NA	NA	NA	NA	NA
WP_021018193.1|1054786_1054945_+	hypothetical protein	NA	NA	NA	NA	NA
WP_021018218.1|1057679_1058168_+	hypothetical protein	NA	NA	NA	NA	NA
WP_021018222.1|1060110_1060398_+	hypothetical protein	NA	NA	NA	NA	NA
WP_011999494.1|1060960_1061272_+	IS66 family insertion sequence hypothetical protein	NA	NA	NA	NA	NA
WP_011999338.1|1061268_1061622_+	IS66 family insertion sequence element accessory protein TnpB	NA	NA	NA	NA	NA
WP_011999339.1|1061681_1063214_+|transposase	IS66 family transposase	transposase	S5VTD3	Leptospira_phage	35.2	1.6e-71
WP_012129404.1|1063273_1064179_-	homocysteine S-methyltransferase family protein	NA	NA	NA	NA	NA
WP_012129403.1|1064347_1064905_-	PhnA domain-containing protein	NA	NA	NA	NA	NA
WP_012129402.1|1065185_1065395_-	YgdI/YgdR family lipoprotein	NA	NA	NA	NA	NA
WP_012129401.1|1065529_1068010_-	lipase	NA	NA	NA	NA	NA
WP_012129400.1|1068032_1069277_-	outer membrane protein transport protein	NA	NA	NA	NA	NA
WP_041853648.1|1069635_1070718_+|protease	site-2 protease family protein	protease	NA	NA	NA	NA
>prophage 11
NC_022270	Vibrio campbellii ATCC BAA-1116 chromosome II, complete sequence	2195939	1104576	1111359	2195939		Vibrio_phage(100.0%)	11	NA	NA
WP_012129368.1|1104576_1104945_-	hypothetical protein	NA	Q9MCC3	Vibrio_phage	60.3	1.7e-32
WP_021018226.1|1105150_1105414_+	hypothetical protein	NA	NA	NA	NA	NA
WP_012129366.1|1105397_1105799_+	hypothetical protein	NA	NA	NA	NA	NA
WP_005531344.1|1105802_1106018_+	hypothetical protein	NA	A0A1W6UGD1	Vibrio_phage	87.3	7.2e-31
WP_012129365.1|1106001_1107147_+	replication initiation factor domain-containing protein	NA	A0A1W6UG38	Vibrio_phage	90.6	1.3e-208
WP_012127988.1|1107150_1107510_+	DUF1293 family protein	NA	Q783U4	Vibrio_phage	95.8	7.2e-60
WP_012129364.1|1107515_1107746_+	hypothetical protein	NA	Q783U3	Vibrio_phage	88.2	1.7e-30
WP_012129363.1|1107751_1108000_+	hypothetical protein	NA	Q783U2	Vibrio_phage	89.0	8.6e-28
WP_012129361.1|1108525_1109623_+	hypothetical protein	NA	Q783U1	Vibrio_phage	61.6	1.1e-85
WP_021018229.1|1109624_1109969_+	DUF2523 domain-containing protein	NA	Q783U0	Vibrio_phage	73.7	1.5e-43
WP_021018230.1|1109973_1111359_+	hypothetical protein	NA	Q783T9	Vibrio_phage	84.4	3.1e-236
>prophage 12
NC_022270	Vibrio campbellii ATCC BAA-1116 chromosome II, complete sequence	2195939	1119843	1153180	2195939	transposase,protease	Bacillus_phage(55.56%)	27	NA	NA
WP_086028365.1|1119843_1121378_-|transposase	IS3 family transposase	transposase	A0A1P8CWQ3	Bacillus_phage	28.2	9.1e-11
WP_086028361.1|1121694_1122817_+|transposase	IS3 family transposase	transposase	U5P429	Shigella_phage	34.3	6.9e-24
WP_012129342.1|1123122_1124040_-	hypothetical protein	NA	NA	NA	NA	NA
WP_012129340.1|1124562_1125093_+	hypothetical protein	NA	NA	NA	NA	NA
WP_086028365.1|1126716_1128251_-|transposase	IS3 family transposase	transposase	A0A1P8CWQ3	Bacillus_phage	28.2	9.1e-11
WP_012129336.1|1130623_1130779_-	YoaH family protein	NA	NA	NA	NA	NA
WP_012129335.1|1130821_1131943_-	conjugal transfer protein TraF	NA	NA	NA	NA	NA
WP_012129334.1|1132002_1132884_-	DUF2861 family protein	NA	NA	NA	NA	NA
WP_012129333.1|1132892_1133555_-	response regulator transcription factor	NA	W8CYM9	Bacillus_phage	33.9	1.3e-27
WP_041853541.1|1133529_1134984_-	DUF3404 domain-containing protein	NA	NA	NA	NA	NA
WP_012129331.1|1135137_1136532_-	Re/Si-specific NAD(P)(+) transhydrogenase subunit beta	NA	NA	NA	NA	NA
WP_012129330.1|1136544_1138101_-	Re/Si-specific NAD(P)(+) transhydrogenase subunit alpha	NA	NA	NA	NA	NA
WP_012129329.1|1138535_1138817_-	hypothetical protein	NA	NA	NA	NA	NA
WP_021018234.1|1138881_1139250_-	late competence development ComFB family protein	NA	NA	NA	NA	NA
WP_041853542.1|1139505_1140750_+	GGDEF domain-containing protein	NA	A0A127AWB9	Bacillus_phage	27.0	5.7e-11
WP_041853543.1|1140873_1141833_-	diguanylate cyclase	NA	W8CYM9	Bacillus_phage	32.2	9.7e-11
WP_005427129.1|1142076_1142514_+	DUF3069 domain-containing protein	NA	NA	NA	NA	NA
WP_012129325.1|1142599_1143706_-	molybdenum ABC transporter ATP-binding protein ModC	NA	G9BWD6	Planktothrix_phage	33.0	3.9e-19
WP_012129324.1|1143702_1144392_-	molybdate ABC transporter permease subunit	NA	NA	NA	NA	NA
WP_012129323.1|1144404_1145157_-	molybdate ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_041853544.1|1145247_1146699_-	cobyric acid synthase	NA	NA	NA	NA	NA
WP_010644161.1|1146863_1147235_+	NirD/YgiW/YdeI family stress tolerance protein	NA	NA	NA	NA	NA
WP_012129321.1|1147400_1147937_+	hypothetical protein	NA	NA	NA	NA	NA
WP_012126481.1|1148116_1149496_+|transposase	IS4 family transposase	transposase	Q9JMP3	Wolbachia_phage	27.2	1.3e-48
WP_012129320.1|1149570_1150248_-|protease	ATP-dependent zinc protease	protease	NA	NA	NA	NA
WP_041853651.1|1150260_1151448_-	aspartate/tyrosine/aromatic aminotransferase	NA	NA	NA	NA	NA
WP_012127146.1|1151986_1153180_-|transposase	IS4 family transposase	transposase	A4KWT9	Enterobacteria_phage	38.1	2.8e-68
>prophage 13
NC_022270	Vibrio campbellii ATCC BAA-1116 chromosome II, complete sequence	2195939	1169123	1218702	2195939	transposase	uncultured_Caudovirales_phage(18.18%)	39	NA	NA
WP_011999187.1|1169123_1170449_+|transposase	IS4 family transposase	transposase	NA	NA	NA	NA
WP_012129304.1|1170499_1171597_-	ketoacyl-ACP synthase III	NA	NA	NA	NA	NA
WP_021018240.1|1171762_1172197_+	thioredoxin TrxC	NA	A0A1J0GW78	Streptomyces_phage	40.9	1.6e-13
WP_021018241.1|1172373_1173534_+	MFS transporter	NA	NA	NA	NA	NA
WP_011999171.1|1173626_1174658_+|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_012129300.1|1174667_1175054_-	nitrous oxide-stimulated promoter family protein	NA	NA	NA	NA	NA
WP_012129299.1|1175111_1175621_-	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_005427046.1|1175693_1175882_+	DUF2986 domain-containing protein	NA	NA	NA	NA	NA
WP_012129298.1|1175928_1177545_-	methyl-accepting chemotaxis protein	NA	A0A2H4J162	uncultured_Caudovirales_phage	36.1	6.0e-13
WP_012129297.1|1178010_1179342_+	anaerobic C4-dicarboxylate transporter	NA	NA	NA	NA	NA
WP_005427009.1|1179444_1179933_-	NYN domain-containing protein	NA	NA	NA	NA	NA
WP_012129296.1|1180053_1180494_+	DUF4174 domain-containing protein	NA	NA	NA	NA	NA
WP_041853545.1|1180783_1181038_-	hypothetical protein	NA	NA	NA	NA	NA
WP_010644214.1|1182702_1183491_+	lipase	NA	Q6XLV5	Feldmannia_irregularis_virus	28.8	8.6e-05
WP_005532120.1|1183573_1183819_-	hypothetical protein	NA	NA	NA	NA	NA
WP_012129291.1|1183956_1185480_-	alpha-amylase	NA	NA	NA	NA	NA
WP_021018242.1|1186381_1188076_-	D-lactate dehydrogenase	NA	NA	NA	NA	NA
WP_041853546.1|1188397_1189297_-	hypothetical protein	NA	NA	NA	NA	NA
WP_012129288.1|1189305_1189770_-	type III secretion system chaperone	NA	NA	NA	NA	NA
WP_012129287.1|1190390_1191848_-	ATPase RavA stimulator ViaA	NA	NA	NA	NA	NA
WP_012129286.1|1191857_1193519_-	DUF3763 domain-containing protein	NA	A0A2H4PB07	Aphanizomenon_phage	28.4	2.7e-32
WP_012129285.1|1193787_1194303_+	NUDIX hydrolase	NA	Q5ULM8	Lactobacillus_virus	30.7	1.9e-08
WP_012129284.1|1194327_1195332_+	low-specificity L-threonine aldolase	NA	NA	NA	NA	NA
WP_012129283.1|1195413_1195740_+	cytochrome c	NA	NA	NA	NA	NA
WP_012129282.1|1197637_1198633_+	succinylglutamate desuccinylase/aspartoacylase family protein	NA	NA	NA	NA	NA
WP_012129281.1|1198698_1199220_-	lipocalin family protein	NA	A0A1W6JNX6	Morganella_phage	46.2	5.4e-40
WP_012129280.1|1199276_1199804_-	histidine phosphatase family protein	NA	NA	NA	NA	NA
WP_012129279.1|1199831_1200260_-	hypothetical protein	NA	NA	NA	NA	NA
WP_041853547.1|1200246_1200900_-	amino-acid racemase	NA	NA	NA	NA	NA
WP_169563909.1|1201069_1202101_-|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_086028361.1|1202652_1203775_+|transposase	IS3 family transposase	transposase	U5P429	Shigella_phage	34.3	6.9e-24
WP_041853653.1|1205621_1207304_-	DUF5011 domain-containing protein	NA	NA	NA	NA	NA
WP_012129275.1|1207677_1208058_+	pyruvate dehydrogenase	NA	NA	NA	NA	NA
WP_012129274.1|1208145_1211202_-	SMC family ATPase	NA	I6W6S0	Vibriophage	25.3	6.7e-05
WP_012129273.1|1211211_1212351_-	exonuclease SbcCD subunit D	NA	A0A217ER54	Bacillus_phage	27.6	1.2e-10
WP_086028355.1|1214275_1215399_-|transposase	IS3 family transposase	transposase	U5P429	Shigella_phage	34.7	1.8e-24
WP_021018246.1|1215776_1216112_+	Hpt domain-containing protein	NA	NA	NA	NA	NA
WP_012129268.1|1216211_1217660_-	methyl-accepting chemotaxis protein	NA	A0A2H4J162	uncultured_Caudovirales_phage	47.3	9.2e-21
WP_011999219.1|1217670_1218702_-|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
>prophage 14
NC_022270	Vibrio campbellii ATCC BAA-1116 chromosome II, complete sequence	2195939	1230616	1308896	2195939	transposase	Enterobacteria_phage(27.27%)	52	NA	NA
WP_048814473.1|1230616_1231939_-|transposase	IS4 family transposase	transposase	NA	NA	NA	NA
WP_011999494.1|1231972_1232284_+	IS66 family insertion sequence hypothetical protein	NA	NA	NA	NA	NA
WP_011998779.1|1232280_1232634_+	IS66 family insertion sequence element accessory protein TnpB	NA	NA	NA	NA	NA
WP_021017764.1|1232694_1234239_+|transposase	IS66 family transposase	transposase	S5VTD3	Leptospira_phage	34.2	2.7e-71
WP_012129250.1|1244136_1245123_+	peptidoglycan DD-metalloendopeptidase family protein	NA	Q8SBN9	Clostridium_phage	31.0	1.1e-17
WP_086028426.1|1245876_1247000_-|transposase	IS3 family transposase	transposase	U5P429	Shigella_phage	34.3	5.3e-24
WP_012129246.1|1247950_1248631_-	M48 family metallopeptidase	NA	NA	NA	NA	NA
WP_144080962.1|1248632_1249097_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011999348.1|1249101_1250295_-|transposase	IS4 family transposase	transposase	A4KWT9	Enterobacteria_phage	38.4	1.3e-68
WP_012129243.1|1254007_1255306_-	restriction endonuclease subunit S	NA	NA	NA	NA	NA
WP_162471676.1|1258027_1258171_-	hypothetical protein	NA	NA	NA	NA	NA
WP_012129240.1|1258197_1258812_-	DJ-1/PfpI family protein	NA	NA	NA	NA	NA
WP_012129239.1|1259121_1259694_+	YceI family protein	NA	NA	NA	NA	NA
WP_012129236.1|1260441_1263330_-	hypothetical protein	NA	NA	NA	NA	NA
WP_169563929.1|1263707_1264739_+|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_011999348.1|1265209_1266403_+|transposase	IS4 family transposase	transposase	A4KWT9	Enterobacteria_phage	38.4	1.3e-68
WP_011999171.1|1266530_1267562_-|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_012129234.1|1267688_1269008_-	peptidoglycan DD-metalloendopeptidase family protein	NA	A0A2K9VGT1	Pontimonas_phage	39.2	6.2e-16
WP_021018255.1|1269313_1270204_-	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_012129233.1|1270320_1270746_+	ester cyclase	NA	NA	NA	NA	NA
WP_012129231.1|1271077_1272760_-	SpoIIE family protein phosphatase	NA	NA	NA	NA	NA
WP_021018256.1|1272781_1273042_-	hypothetical protein	NA	NA	NA	NA	NA
WP_012129228.1|1273294_1273909_-	glutathione S-transferase	NA	NA	NA	NA	NA
WP_012129226.1|1274169_1274745_+	TetR/AcrR family transcriptional regulator	NA	NA	NA	NA	NA
WP_012129225.1|1274746_1275151_+	DUF296 domain-containing protein	NA	NA	NA	NA	NA
WP_012129224.1|1275249_1275585_-	nitrite reductase small subunit NirD	NA	NA	NA	NA	NA
WP_012129223.1|1275585_1278105_-	nitrite reductase large subunit	NA	NA	NA	NA	NA
WP_012129222.1|1278115_1278952_-	ABC transporter ATP-binding protein	NA	G3M9Y6	Bacillus_virus	37.6	8.2e-30
WP_012129221.1|1278963_1279929_-	ABC transporter permease	NA	NA	NA	NA	NA
WP_012129220.1|1280009_1281374_-	ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_012129218.1|1281655_1282237_-	ANTAR domain-containing protein	NA	NA	NA	NA	NA
WP_012129217.1|1282310_1283228_-	dienelactone hydrolase family protein	NA	NA	NA	NA	NA
WP_012129216.1|1283454_1284408_-	glycosyl transferase family protein	NA	NA	NA	NA	NA
WP_012129215.1|1284404_1285310_-	uroporphyrinogen-III C-methyltransferase	NA	NA	NA	NA	NA
WP_012129214.1|1285330_1287994_-	molybdopterin-dependent oxidoreductase	NA	NA	NA	NA	NA
WP_012129213.1|1288284_1288719_-	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_012129212.1|1289078_1290335_+	septum formation initiator	NA	NA	NA	NA	NA
WP_012129210.1|1290948_1292901_+	diguanylate cyclase	NA	A0A127AWB9	Bacillus_phage	34.1	4.0e-19
WP_012129209.1|1292910_1293246_+	hypothetical protein	NA	NA	NA	NA	NA
WP_012129208.1|1293501_1295280_+	S8 family serine peptidase	NA	A0A1B0T6A2	Bacillus_phage	31.0	5.8e-09
WP_012129207.1|1295292_1295739_+	hypothetical protein	NA	NA	NA	NA	NA
WP_012129206.1|1297262_1298192_-	SRPBCC family protein	NA	NA	NA	NA	NA
WP_011999187.1|1298305_1299631_-|transposase	IS4 family transposase	transposase	NA	NA	NA	NA
WP_012129205.1|1299762_1301004_-	HAMP domain-containing histidine kinase	NA	NA	NA	NA	NA
WP_041853662.1|1300975_1301644_-	response regulator transcription factor	NA	W8CYM9	Bacillus_phage	34.8	4.0e-27
WP_012129203.1|1301733_1302915_+	hypothetical protein	NA	NA	NA	NA	NA
WP_012129202.1|1303037_1303373_+	hypothetical protein	NA	NA	NA	NA	NA
WP_021018257.1|1303490_1303787_+	hypothetical protein	NA	NA	NA	NA	NA
WP_011999348.1|1304787_1305981_-|transposase	IS4 family transposase	transposase	A4KWT9	Enterobacteria_phage	38.4	1.3e-68
WP_012129196.1|1306644_1307106_+	hypothetical protein	NA	NA	NA	NA	NA
WP_005431498.1|1307198_1307675_+	copper chaperone PCu(A)C	NA	NA	NA	NA	NA
WP_012126704.1|1307870_1308896_+|transposase	IS110 family transposase	transposase	NA	NA	NA	NA
>prophage 15
NC_022270	Vibrio campbellii ATCC BAA-1116 chromosome II, complete sequence	2195939	1703968	1799172	2195939	plate,terminase,tail,portal,transposase,capsid,head	Vibrio_phage(46.15%)	83	NA	NA
WP_011999375.1|1703968_1705162_-|transposase	IS4 family transposase	transposase	A4KWT9	Enterobacteria_phage	38.4	1.3e-68
WP_011999385.1|1706629_1708642_-	S9 family peptidase	NA	F2Y2S5	Organic_Lake_phycodnavirus	28.1	3.0e-09
WP_005535217.1|1709020_1709194_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011999384.1|1709379_1710723_-	DEAD/DEAH box helicase	NA	Q5GF26	Diachasmimorpha_longicaudata_entomopoxvirus	27.9	1.2e-38
WP_005441096.1|1711145_1711394_+	membrane protein	NA	NA	NA	NA	NA
WP_033000544.1|1711420_1712326_-	L,D-transpeptidase family protein	NA	NA	NA	NA	NA
WP_011999383.1|1712353_1713769_-	deoxyribodipyrimidine photo-lyase	NA	A0A1V0SGL1	Hokovirus	31.1	1.7e-59
WP_011999382.1|1713793_1714597_-	MerR family transcriptional regulator	NA	Q9EYF2	Enterobacteria_phage	34.3	7.9e-22
WP_011999381.1|1714586_1715537_-	DUF523 and DUF1722 domain-containing protein	NA	NA	NA	NA	NA
WP_011999379.1|1715932_1716643_+	purine-nucleoside phosphorylase	NA	NA	NA	NA	NA
WP_011999378.1|1716711_1718181_+	hypothetical protein	NA	NA	NA	NA	NA
WP_011999377.1|1718350_1719835_+	hypothetical protein	NA	NA	NA	NA	NA
WP_011999376.1|1719818_1721402_+	GGDEF domain-containing protein	NA	A0A127AWB9	Bacillus_phage	41.3	2.0e-16
WP_011999375.1|1721463_1722657_-|transposase	IS4 family transposase	transposase	A4KWT9	Enterobacteria_phage	38.4	1.3e-68
WP_011999374.1|1722824_1723715_-	DMT family transporter	NA	NA	NA	NA	NA
WP_005535345.1|1723861_1724248_+	DUF3302 domain-containing protein	NA	NA	NA	NA	NA
WP_011999373.1|1724247_1725378_+	HlyD family secretion protein	NA	NA	NA	NA	NA
WP_005432209.1|1725688_1726237_+	ECF-type riboflavin transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_011999371.1|1726243_1728025_+	ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	34.9	5.6e-20
WP_011999370.1|1728021_1728861_+	energy-coupling factor transporter transmembrane protein EcfT	NA	NA	NA	NA	NA
WP_011999369.1|1728981_1730163_-	MFS transporter	NA	NA	NA	NA	NA
WP_011999367.1|1730498_1731245_+	metalloregulator ArsR/SmtB family transcription factor	NA	A0A2H4J437	uncultured_Caudovirales_phage	39.7	3.8e-18
WP_005535357.1|1731663_1732164_+	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_011999366.1|1732271_1733258_-	phosphotransferase	NA	NA	NA	NA	NA
WP_041853682.1|1733257_1733533_-	N-acetyltransferase	NA	NA	NA	NA	NA
WP_011999364.1|1733668_1734415_+	flagellar brake protein	NA	NA	NA	NA	NA
WP_011999363.1|1734526_1735492_-	porin	NA	NA	NA	NA	NA
WP_011999361.1|1735906_1737535_-	methyl-accepting chemotaxis protein	NA	A0A2H4J162	uncultured_Caudovirales_phage	39.3	7.9e-21
WP_011999360.1|1737761_1740122_-	ATP-binding protein	NA	NA	NA	NA	NA
WP_005432238.1|1740320_1740818_+	hypothetical protein	NA	NA	NA	NA	NA
WP_011999358.1|1740897_1742529_+	ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	34.1	1.8e-20
WP_011999357.1|1742775_1744815_-	S9 family peptidase	NA	A0A1V0SHT0	Klosneuvirus	31.5	6.3e-68
WP_011999354.1|1749203_1749551_-	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_041853560.1|1749900_1751004_+	mechanosensitive ion channel family protein	NA	NA	NA	NA	NA
WP_011999352.1|1751123_1752446_+|transposase	IS4 family transposase	transposase	NA	NA	NA	NA
WP_038891499.1|1752507_1753227_-	carbonic anhydrase	NA	NA	NA	NA	NA
WP_086028389.1|1753566_1754362_+|transposase	IS5 family transposase	transposase	A0A0M5M147	Mycobacterium_phage	36.9	5.4e-31
WP_011999171.1|1754599_1755631_+|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_011999349.1|1755815_1757030_-	OFA family MFS transporter	NA	NA	NA	NA	NA
WP_011999348.1|1757107_1758301_-|transposase	IS4 family transposase	transposase	A4KWT9	Enterobacteria_phage	38.4	1.3e-68
WP_011999347.1|1758608_1759637_+|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_011999346.1|1759793_1760825_-|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_011999345.1|1760874_1761921_-	diguanylate cyclase	NA	NA	NA	NA	NA
WP_169563935.1|1762412_1763468_+|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_011998779.1|1765058_1765412_-	IS66 family insertion sequence element accessory protein TnpB	NA	NA	NA	NA	NA
WP_011999494.1|1765408_1765720_-	IS66 family insertion sequence hypothetical protein	NA	NA	NA	NA	NA
WP_021018306.1|1765895_1768013_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011999341.1|1768012_1769656_-	hypothetical protein	NA	NA	NA	NA	NA
WP_021018307.1|1770095_1771571_-|transposase	IS66 family transposase	transposase	S5VTD3	Leptospira_phage	35.2	5.8e-71
WP_011999338.1|1771686_1772040_-	IS66 family insertion sequence element accessory protein TnpB	NA	NA	NA	NA	NA
WP_011999494.1|1772036_1772348_-	IS66 family insertion sequence hypothetical protein	NA	NA	NA	NA	NA
WP_011999336.1|1773326_1773803_-	DUF285 domain-containing protein	NA	NA	NA	NA	NA
WP_021018308.1|1773829_1774267_-	BspA family leucine-rich repeat surface protein	NA	NA	NA	NA	NA
WP_005530007.1|1774667_1774802_-	hypothetical protein	NA	R9TPW0	Vibrio_phage	86.4	5.3e-16
WP_005537019.1|1776208_1776703_-	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_011999328.1|1776858_1778058_+|transposase	IS4 family transposase	transposase	A0A0F7LAS3	uncultured_marine_virus	48.0	5.2e-102
WP_011999327.1|1778168_1779185_+|transposase	IS110 family transposase	transposase	NA	NA	NA	NA
WP_048814469.1|1779533_1779713_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011999324.1|1780144_1780342_-	hypothetical protein	NA	A0A2I7RNJ8	Vibrio_phage	85.9	1.6e-21
WP_011999323.1|1780341_1781040_-	hypothetical protein	NA	A0A2I7RNK2	Vibrio_phage	92.2	3.9e-126
WP_011999322.1|1781030_1781720_-	hypothetical protein	NA	A0A2I7RNK1	Vibrio_phage	80.7	1.1e-112
WP_011999321.1|1781733_1782270_-	hypothetical protein	NA	A0A2I7RNK5	Vibrio_phage	81.4	1.3e-73
WP_011999320.1|1782279_1782510_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011999319.1|1782512_1783268_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011999318.1|1783260_1784067_-|tail	phage tail protein	tail	A0A0U4K5K2	Pseudomonas_phage	47.5	4.2e-31
WP_011999317.1|1784070_1784571_-	hypothetical protein	NA	A0A2I7RNJ4	Vibrio_phage	48.9	3.7e-38
WP_011999316.1|1784590_1785778_-|plate	baseplate J/gp47 family protein	plate	A0A2I7RNJ7	Vibrio_phage	57.8	4.1e-136
WP_011999315.1|1785770_1786103_-	DUF2590 family protein	NA	A0A2I7RNH9	Vibrio_phage	75.7	1.1e-38
WP_011999314.1|1786102_1788658_-|tail	phage tail tape measure protein	tail	A0A1D9C9V3	Salinivibrio_phage	53.5	6.2e-230
WP_005530039.1|1788868_1789132_-	hypothetical protein	NA	A0A2I7RNJ9	Vibrio_phage	78.3	1.7e-29
WP_005530042.1|1789128_1789365_-	hypothetical protein	NA	A0A1D9C9R8	Salinivibrio_phage	42.7	1.0e-09
WP_011999313.1|1789367_1789598_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011999312.1|1789594_1790107_-	hypothetical protein	NA	A0A2I7S7C4	Vibrio_phage	39.5	8.0e-20
WP_011999311.1|1790103_1790322_-	TraR/DksA C4-type zinc finger protein	NA	A0A2I7RNJ6	Vibrio_phage	72.1	2.6e-20
WP_011999310.1|1790334_1790790_-	DUF2597 family protein	NA	A0A2I7RNI0	Vibrio_phage	92.7	3.7e-77
WP_011999309.1|1790793_1791915_-	DUF2586 family protein	NA	A0A2I7RNI8	Vibrio_phage	82.7	1.5e-180
WP_011999308.1|1791930_1792587_-	virion morphogenesis protein	NA	A0A2I7RNI6	Vibrio_phage	88.5	7.2e-106
WP_011999307.1|1792570_1793062_-|tail	phage tail protein	tail	A0A2I7RNH2	Vibrio_phage	91.4	4.9e-83
WP_021018311.1|1793058_1793478_-|head	head completion/stabilization protein	head	A0A2I7RNH7	Vibrio_phage	70.5	2.1e-50
WP_011999305.1|1793596_1794313_-|terminase	terminase	terminase	A0A2I7RNJ0	Vibrio_phage	58.0	1.3e-68
WP_011999303.1|1795328_1796204_-|capsid	GPO family capsid scaffolding protein	capsid	A0A2I7RNH1	Vibrio_phage	60.1	6.5e-78
WP_011999302.1|1796378_1798160_+|terminase	terminase	terminase	A0A1D9C9R1	Salinivibrio_phage	80.7	3.0e-263
WP_005530066.1|1798164_1799172_+|portal	phage portal protein	portal	A0A1D9C9P9	Salinivibrio_phage	61.8	1.2e-115
>prophage 16
NC_022270	Vibrio campbellii ATCC BAA-1116 chromosome II, complete sequence	2195939	1802257	1806987	2195939		Vibrio_phage(85.71%)	9	NA	NA
WP_011999296.1|1802257_1802509_+	ogr/Delta-like zinc finger family protein	NA	R9TNQ2	Vibrio_phage	75.9	1.2e-29
WP_011999295.1|1802503_1802767_-	hypothetical protein	NA	Q8HA64	Vibrio_phage	56.9	2.2e-13
WP_011999294.1|1802817_1804704_-	replication endonuclease	NA	A0A218M4H2	Erwinia_phage	38.4	1.5e-63
WP_011999293.1|1804709_1804946_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011999292.1|1804942_1805170_-	hypothetical protein	NA	NA	NA	NA	NA
WP_010645271.1|1805169_1805370_-	hypothetical protein	NA	A0A2I7RNH0	Vibrio_phage	41.3	2.6e-06
WP_011999291.1|1805398_1805938_-	phage regulatory CII family protein	NA	A0A2I7RNI1	Vibrio_phage	55.3	3.5e-50
WP_005530092.1|1806051_1806264_-	hypothetical protein	NA	U3PFJ1	Vibrio_phage	54.3	1.3e-13
WP_011999289.1|1806360_1806987_+	phage repressor protein CI	NA	A0A2I7RNF9	Vibrio_phage	42.9	1.9e-39
>prophage 17
NC_022270	Vibrio campbellii ATCC BAA-1116 chromosome II, complete sequence	2195939	2007870	2082079	2195939	transposase,integrase	Vibrio_phage(23.53%)	58	1995330:1995345	2052416:2052431
1995330:1995345	attL	GTCACTGGGTGGTTAC	NA	NA	NA	NA
WP_011999114.1|2007870_2008791_+|transposase	IS5 family transposase	transposase	A0A1V0E8E1	Vibrio_phage	96.4	2.3e-171
WP_011999112.1|2009142_2009529_+	DUF2541 family protein	NA	NA	NA	NA	NA
WP_041853385.1|2009613_2010924_-	group II intron reverse transcriptase/maturase	NA	A0A0U4J920	Pseudomonas_phage	30.1	8.9e-31
WP_011999108.1|2011533_2012526_-	OmpA family protein	NA	NA	NA	NA	NA
WP_011999107.1|2012538_2013576_-	hypothetical protein	NA	NA	NA	NA	NA
WP_041853571.1|2013575_2014331_-	molecular chaperone	NA	NA	NA	NA	NA
WP_011999105.1|2014344_2016807_-	fimbrial biogenesis outer membrane usher protein	NA	NA	NA	NA	NA
WP_086028444.1|2016875_2017343_-	fimbrial protein	NA	NA	NA	NA	NA
WP_021018338.1|2017729_2018464_-	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_021018339.1|2018854_2019655_-|integrase	tyrosine-type recombinase/integrase	integrase	A0A2H4J6I5	uncultured_Caudovirales_phage	45.8	3.9e-05
WP_011999098.1|2020182_2020611_-	Spy/CpxP family protein refolding chaperone	NA	NA	NA	NA	NA
WP_011999097.1|2020817_2021144_+	2Fe-2S iron-sulfur cluster binding domain-containing protein	NA	NA	NA	NA	NA
WP_011999095.1|2024275_2026162_+	methyl-accepting chemotaxis protein	NA	A0A2H4J162	uncultured_Caudovirales_phage	57.0	3.4e-15
WP_011999093.1|2026396_2027335_+	hypothetical protein	NA	A0A126HGL6	Vibrio_phage	31.3	3.5e-13
WP_011999092.1|2027518_2029510_+	U32 family peptidase	NA	Q6DW11	Phage_TP	28.2	1.7e-20
WP_021018341.1|2029552_2029939_+	hypothetical protein	NA	NA	NA	NA	NA
WP_011999089.1|2030183_2030486_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011999088.1|2030536_2031205_-	NAD(P)H-dependent oxidoreductase	NA	NA	NA	NA	NA
WP_005374689.1|2031828_2032074_+	DUF3297 family protein	NA	NA	NA	NA	NA
WP_021018342.1|2032177_2032741_-	cysteine hydrolase	NA	NA	NA	NA	NA
WP_011999083.1|2033049_2033784_+	ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	30.4	3.2e-22
WP_011999082.1|2033770_2036281_+	ABC transporter permease	NA	NA	NA	NA	NA
WP_011999081.1|2036280_2037390_+	carotenoid 1,2-hydratase	NA	NA	NA	NA	NA
WP_080514187.1|2037484_2038837_-	sphingomyelin phosphodiesterase	NA	A0A1P8L6H7	Staphylococcus_phage	35.1	6.8e-26
WP_004746427.1|2039140_2039407_+	DUF2999 family protein	NA	NA	NA	NA	NA
WP_011999079.1|2039749_2040847_+	YdcF family protein	NA	NA	NA	NA	NA
WP_011999078.1|2040900_2041236_-	type II toxin-antitoxin system RelE/ParE family toxin	NA	NA	NA	NA	NA
WP_005383516.1|2041249_2041492_-	type II toxin-antitoxin system Phd/YefM family antitoxin	NA	NA	NA	NA	NA
WP_005374640.1|2041756_2042179_-	organic hydroperoxide resistance protein	NA	NA	NA	NA	NA
WP_021018343.1|2042316_2042775_+	MarR family transcriptional regulator	NA	NA	NA	NA	NA
WP_005374632.1|2043080_2043638_+	alkyl hydroperoxide reductase subunit C	NA	NA	NA	NA	NA
WP_011999076.1|2043810_2045379_+	alkyl hydroperoxide reductase subunit F	NA	G3MA85	Bacillus_virus	32.4	3.3e-40
WP_011999070.1|2048061_2048481_+	VOC family protein	NA	NA	NA	NA	NA
WP_011999069.1|2048589_2050047_-	gluconate permease	NA	NA	NA	NA	NA
WP_011999068.1|2050160_2050937_-	hydroxypyruvate isomerase family protein	NA	NA	NA	NA	NA
WP_041853694.1|2050936_2051569_-	aldolase	NA	A0A077SK32	Escherichia_phage	61.7	9.7e-68
WP_011999066.1|2051595_2052852_-	four-carbon acid sugar kinase family protein	NA	A0A077SLJ7	Escherichia_phage	56.7	1.5e-131
2052416:2052431	attR	GTCACTGGGTGGTTAC	NA	NA	NA	NA
WP_005429064.1|2052877_2053786_-	NAD(P)-dependent oxidoreductase	NA	A0A077SLF7	Escherichia_phage	68.7	3.0e-102
WP_021018345.1|2054062_2054827_+	DeoR/GlpR transcriptional regulator	NA	A0A077SK06	Escherichia_phage	49.0	1.4e-57
WP_005533925.1|2055047_2055743_+	hypothetical protein	NA	NA	NA	NA	NA
WP_011999064.1|2056009_2057095_+	CZB domain-containing protein	NA	A0A2H4J162	uncultured_Caudovirales_phage	59.0	4.9e-11
WP_011999061.1|2058237_2058837_-	LysE family translocator	NA	NA	NA	NA	NA
WP_011999060.1|2058957_2059440_+	Lrp/AsnC family transcriptional regulator	NA	NA	NA	NA	NA
WP_144080964.1|2059540_2059756_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011999057.1|2059858_2060779_+|transposase	IS5 family transposase	transposase	A0A1V0E8E1	Vibrio_phage	94.8	1.1e-168
WP_048814466.1|2062607_2063150_+	cytochrome b	NA	NA	NA	NA	NA
WP_157722659.1|2064359_2064830_-|transposase	ISAs1 family transposase	transposase	NA	NA	NA	NA
WP_086028385.1|2065022_2066556_+|transposase	IS3 family transposase	transposase	A0A1P8CWQ3	Bacillus_phage	28.2	9.1e-11
WP_011999045.1|2069223_2069511_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011999044.1|2069494_2070817_-	hypothetical protein	NA	NA	NA	NA	NA
WP_080654502.1|2072060_2074637_-	peptidase	NA	NA	NA	NA	NA
WP_012129411.1|2074636_2074852_-	hypothetical protein	NA	NA	NA	NA	NA
WP_012129412.1|2074848_2075934_-	hypothetical protein	NA	NA	NA	NA	NA
WP_012129413.1|2075899_2076628_-	hypothetical protein	NA	NA	NA	NA	NA
WP_012130424.1|2076646_2079454_-	CS1-pili formation C-terminal domain-containing protein	NA	NA	NA	NA	NA
WP_012129416.1|2079476_2079977_-	hypothetical protein	NA	NA	NA	NA	NA
WP_012130423.1|2080062_2080614_-	hypothetical protein	NA	NA	NA	NA	NA
WP_012130421.1|2081158_2082079_+|transposase	IS5 family transposase	transposase	A0A1V0E8E1	Vibrio_phage	94.8	1.9e-168
>prophage 1
NC_022271	Vibrio campbellii ATCC BAA-1116 plasmid unnamed, complete sequence	89003	12306	56447	89003	transposase	Leptospira_phage(25.0%)	49	NA	NA
WP_021017764.1|12306_13851_-|transposase	IS66 family transposase	transposase	S5VTD3	Leptospira_phage	34.2	2.7e-71
WP_011998799.1|13911_14265_-	IS66 family insertion sequence element accessory protein TnpB	NA	NA	NA	NA	NA
WP_011999494.1|14261_14573_-	IS66 family insertion sequence hypothetical protein	NA	NA	NA	NA	NA
WP_011998802.1|15868_16216_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011998803.1|16227_16566_-	hypothetical protein	NA	NA	NA	NA	NA
WP_144080977.1|16765_17889_-|transposase	IS3 family transposase	transposase	U5P429	Shigella_phage	34.3	6.9e-24
WP_011998807.1|18832_19264_+	hypothetical protein	NA	NA	NA	NA	NA
WP_021018373.1|19317_19977_-|transposase	IS110 family transposase	transposase	NA	NA	NA	NA
WP_011998809.1|20136_20421_+	hypothetical protein	NA	NA	NA	NA	NA
WP_011998811.1|20879_21923_-|transposase	IS110 family transposase	transposase	M1NSC9	Streptococcus_phage	26.7	1.6e-06
WP_080514194.1|22003_22135_+	DUF3265 domain-containing protein	NA	NA	NA	NA	NA
WP_011998812.1|22339_23356_-|transposase	IS110 family transposase	transposase	NA	NA	NA	NA
WP_011998813.1|23466_24666_-|transposase	IS4 family transposase	transposase	A0A0F7LAS3	uncultured_marine_virus	47.8	1.5e-101
WP_011998815.1|25446_26271_+	DUF2971 domain-containing protein	NA	NA	NA	NA	NA
WP_011998817.1|26996_27293_-	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_011998818.1|27279_27477_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011998819.1|27614_28652_+	permease	NA	NA	NA	NA	NA
WP_011998820.1|29123_31328_-	DNA topoisomerase III	NA	NA	NA	NA	NA
WP_011998821.1|31336_31873_-	hypothetical protein	NA	NA	NA	NA	NA
WP_021018375.1|31883_33623_-	type IV secretory system conjugative DNA transfer family protein	NA	NA	NA	NA	NA
WP_011998823.1|33665_34682_-	P-type DNA transfer ATPase VirB11	NA	NA	NA	NA	NA
WP_011998825.1|35032_36226_-	type IV secretion system protein VirB10	NA	NA	NA	NA	NA
WP_011998826.1|36218_36986_-	TrbG/VirB9 family P-type conjugative transfer protein	NA	NA	NA	NA	NA
WP_011998827.1|36982_37738_-	conjugal transfer protein TraG	NA	NA	NA	NA	NA
WP_021018376.1|37734_37887_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011998829.1|37961_38912_-	type IV secretion system protein	NA	NA	NA	NA	NA
WP_005430722.1|38921_39155_-	EexN family lipoprotein	NA	NA	NA	NA	NA
WP_011998830.1|39167_39833_-	conjugal transfer protein TrbJ	NA	NA	NA	NA	NA
WP_021018377.1|39835_42166_-	conjugal transfer protein TraE	NA	NA	NA	NA	NA
WP_011998832.1|42128_42500_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011998833.1|42502_42820_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011998834.1|42834_43437_-	lytic transglycosylase domain-containing protein	NA	NA	NA	NA	NA
WP_011998835.1|43426_43786_-	TraY domain-containing protein	NA	NA	NA	NA	NA
WP_011998836.1|43839_44022_-	TraY domain-containing protein	NA	NA	NA	NA	NA
WP_011998837.1|44027_44189_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011998838.1|44780_45371_+	LexA family transcriptional regulator	NA	H9A0Q4	Staphylococcus_phage	26.0	2.1e-08
WP_021018378.1|45392_45818_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011998840.1|45830_46478_-	isoprenoid biosynthesis glyoxalase ElbB	NA	NA	NA	NA	NA
WP_011998841.1|46474_46954_-	hypothetical protein	NA	NA	NA	NA	NA
WP_144080979.1|47657_48458_+	hypothetical protein	NA	NA	NA	NA	NA
WP_011998844.1|49157_49556_+	GIY-YIG nuclease family protein	NA	A0A0P0YND3	Yellowstone_lake_phycodnavirus	41.8	1.3e-12
WP_011998845.1|49668_50436_+	ParA family protein	NA	A0A1X9IGI7	Lactococcus_phage	32.8	5.2e-15
WP_011998846.1|50456_50753_+	hypothetical protein	NA	NA	NA	NA	NA
WP_011998849.1|51105_51444_-	type II toxin-antitoxin system RelE/ParE family toxin	NA	NA	NA	NA	NA
WP_021018379.1|51454_51700_-	prevent-host-death protein	NA	NA	NA	NA	NA
WP_011998851.1|52572_53025_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011998852.1|53221_54208_+	hypothetical protein	NA	NA	NA	NA	NA
WP_011998853.1|54295_54691_+	hypothetical protein	NA	NA	NA	NA	NA
WP_012127359.1|54893_56447_-|transposase	IS66 family transposase	transposase	S5VTD3	Leptospira_phage	34.9	4.7e-71
