The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
NZ_CP025084	Serratia sp. ATCC 39006 chromosome, complete genome	4971757	1675215	1718306	4971757	tail,plate,terminase,integrase	Salmonella_phage(28.57%)	57	1677794:1677840	1718471:1718517
WP_037382626.1|1675215_1676319_+	glutamate 5-kinase	NA	A0A1X9I5D0	Streptococcus_phage	42.0	7.2e-58
WP_021017453.1|1676329_1677583_+	glutamate-5-semialdehyde dehydrogenase	NA	A0A1X9I5D4	Streptococcus_phage	46.9	1.2e-93
1677794:1677840	attL	ATTCGTAATGCGAAGGTCGTAGGTTCGACTCCTATTATCGGCACCAT	NA	NA	NA	NA
WP_021017452.1|1677862_1679017_-|integrase	site-specific integrase	integrase	U5P434	Shigella_phage	72.0	1.7e-166
WP_037382623.1|1679249_1679477_-	TraR/DksA family transcriptional regulator	NA	A0A0N7C211	Escherichia_phage	60.4	4.8e-09
WP_021017450.1|1679537_1680242_-	hypothetical protein	NA	A0A088C400	Shewanella_sp._phage	39.7	9.6e-24
WP_021017449.1|1680259_1680928_-	AAA family ATPase	NA	G9L667	Escherichia_phage	46.6	2.0e-50
WP_021017448.1|1680927_1681590_-	exodeoxyribonuclease X	NA	A0A1W5PTR6	Pseudoalteromonas_phage	36.6	8.2e-17
WP_101377479.1|1681910_1683596_-	hypothetical protein	NA	H6WRX1	Salmonella_phage	35.6	5.4e-65
WP_021017445.1|1683877_1684069_-	DUF1482 family protein	NA	NA	NA	NA	NA
WP_037382513.1|1684544_1684934_-	helix-turn-helix domain-containing protein	NA	K7PH19	Enterobacteria_phage	63.5	9.4e-21
WP_021017443.1|1685044_1685248_+	helix-turn-helix transcriptional regulator	NA	K7PMD5	Enterobacterial_phage	61.5	1.6e-16
WP_021017442.1|1685265_1685775_+	protein of unknown function DUF1019	NA	K7P7P2	Enterobacteria_phage	47.1	6.1e-28
WP_021017441.1|1685802_1686525_+	hypothetical protein	NA	R9VWB9	Serratia_phage	53.7	4.0e-65
WP_021017440.1|1686524_1687382_+	hypothetical protein	NA	A0A193GZ86	Enterobacter_phage	35.7	7.3e-26
WP_021017439.1|1687399_1688140_+	ATP-binding protein	NA	S4TNF5	Salmonella_phage	72.0	1.3e-95
WP_021017437.1|1688265_1688955_+	hypothetical protein	NA	K7PKY8	Enterobacterial_phage	36.7	6.5e-09
WP_021015868.1|1688947_1689706_+	class I SAM-dependent methyltransferase	NA	H9C170	Pectobacterium_phage	68.6	3.6e-61
WP_021017436.1|1689702_1691442_+	DNA cytosine methyltransferase	NA	H9C171	Pectobacterium_phage	60.8	1.2e-229
WP_021015870.1|1691539_1691788_+	hypothetical protein	NA	H6WRY6	Salmonella_phage	68.1	3.0e-20
WP_021017435.1|1691924_1692362_+	recombination protein NinB	NA	G8C7V3	Escherichia_phage	95.8	1.7e-74
WP_021017434.1|1692354_1692540_+	recombination protein NinG	NA	M9NYX8	Enterobacteria_phage	58.8	5.1e-09
WP_021017433.1|1692536_1692668_+	YlcG family protein	NA	NA	NA	NA	NA
WP_021017432.1|1692664_1693360_+	antitermination Q family protein	NA	I6PDF8	Cronobacter_phage	47.2	8.0e-55
WP_021017431.1|1693875_1694946_+	site-specific DNA-methyltransferase	NA	Q6UAT0	Klebsiella_phage	63.5	8.3e-128
WP_021015876.1|1695193_1695433_+	Lysis S family protein	NA	NA	NA	NA	NA
WP_021017430.1|1695435_1695954_+	lysozyme	NA	I6PBN2	Cronobacter_phage	58.7	9.2e-48
WP_021017429.1|1695956_1696490_+	hypothetical protein	NA	H9C185	Pectobacterium_phage	46.4	5.7e-29
WP_021017428.1|1696573_1696804_+	hypothetical protein	NA	NA	NA	NA	NA
WP_021017427.1|1696872_1697055_+	hypothetical protein	NA	NA	NA	NA	NA
WP_037382510.1|1697799_1699200_+|terminase	PBSX family phage terminase large subunit	terminase	A0A077KAW0	Edwardsiella_phage	69.3	1.4e-188
WP_021017424.1|1699204_1700656_+	DUF1073 domain-containing protein	NA	A0A0M4S6U1	Salmonella_phage	68.1	1.6e-190
WP_037382600.1|1700711_1701260_+	phage Mu F like family protein	NA	A0A0M4REK0	Salmonella_phage	56.9	3.9e-49
WP_021017422.1|1701312_1702515_+	DUF2213 domain-containing protein	NA	A0A0M4R5A6	Salmonella_phage	54.7	3.9e-110
WP_021017421.1|1702518_1703013_+	hypothetical protein	NA	A0A2H4JHM9	uncultured_Caudovirales_phage	62.7	1.2e-49
WP_021017420.1|1703024_1703966_+	DUF2184 domain-containing protein	NA	A0A2H4J191	uncultured_Caudovirales_phage	75.2	5.2e-134
WP_021017419.1|1704005_1704287_+	hypothetical protein	NA	NA	NA	NA	NA
WP_021017418.1|1704255_1704675_+	DUF4054 domain-containing protein	NA	A0A2H4J1A6	uncultured_Caudovirales_phage	60.0	9.7e-40
WP_021017417.1|1704671_1705289_+	hypothetical protein	NA	A0A0M4S631	Salmonella_phage	32.9	4.8e-19
WP_021017416.1|1705288_1705675_+	hypothetical protein	NA	A0A2H4J1A4	uncultured_Caudovirales_phage	75.8	7.5e-47
WP_021017415.1|1705667_1706219_+	hypothetical protein	NA	A0A2H4J1A0	uncultured_Caudovirales_phage	49.7	2.9e-44
WP_037382598.1|1706224_1707376_+	DUF3383 domain-containing protein	NA	A0A0M4RD26	Salmonella_phage	80.4	2.7e-172
WP_021017413.1|1707385_1707826_+	DUF3277 family protein	NA	A0A2H4J619	uncultured_Caudovirales_phage	69.2	7.3e-54
WP_021017412.1|1707829_1708276_+	hypothetical protein	NA	A0A0M4S6U8	Salmonella_phage	52.4	1.4e-31
WP_037382508.1|1708311_1708458_+	hypothetical protein	NA	A0A2H4J1A2	uncultured_Caudovirales_phage	76.6	1.4e-14
WP_021017411.1|1708454_1710461_+	hypothetical protein	NA	A0A0M4REK7	Salmonella_phage	66.8	2.0e-135
WP_021017410.1|1710460_1711048_+	hypothetical protein	NA	A0A0M3ULD5	Salmonella_phage	61.5	8.8e-55
WP_021017409.1|1711047_1711350_+	hypothetical protein	NA	A0A0M4R5B7	Salmonella_phage	53.0	1.8e-24
WP_021017408.1|1711352_1712420_+	hypothetical protein	NA	A0A2H4J1B2	uncultured_Caudovirales_phage	58.5	5.4e-119
WP_037382505.1|1712421_1712886_+	hypothetical protein	NA	NA	NA	NA	NA
WP_021017406.1|1713122_1713332_+	hypothetical protein	NA	NA	NA	NA	NA
WP_021017405.1|1713282_1713834_+	DUF2335 domain-containing protein	NA	S5WJ01	Leptospira_phage	35.9	3.3e-11
WP_021017404.1|1713891_1714647_+|plate	phage baseplate assembly protein V	plate	A0A0M5M1K7	Salmonella_phage	71.6	2.5e-86
WP_021017403.1|1714646_1715003_+	hypothetical protein	NA	A0A2H4J629	uncultured_Caudovirales_phage	78.0	1.8e-47
WP_021017402.1|1715003_1716194_+	hypothetical protein	NA	A0A2H4J5T1	uncultured_Caudovirales_phage	75.6	3.4e-162
WP_021017401.1|1716190_1716871_+	DUF2612 domain-containing protein	NA	A0A0M5M1K4	Salmonella_phage	79.6	5.7e-106
WP_021017400.1|1716870_1717692_+|tail	tail fiber protein	tail	M1TAS6	Escherichia_phage	39.9	1.7e-35
WP_021017399.1|1717691_1718306_+|tail	tail fiber assembly protein	tail	Q9MCR5	Enterobacteria_phage	46.1	1.1e-39
1718471:1718517	attR	ATTCGTAATGCGAAGGTCGTAGGTTCGACTCCTATTATCGGCACCAT	NA	NA	NA	NA
>prophage 2
NZ_CP025084	Serratia sp. ATCC 39006 chromosome, complete genome	4971757	3135651	3181506	4971757	terminase,tail,plate,integrase,capsid	Pectobacterium_phage(57.14%)	63	3180088:3180101	3182381:3182394
WP_021015916.1|3135651_3135873_+	hypothetical protein	NA	H9C151	Pectobacterium_phage	74.0	3.9e-24
WP_021015915.1|3135869_3136406_-	hypothetical protein	NA	NA	NA	NA	NA
WP_021015914.1|3136408_3138484_-|tail	tail fiber protein	tail	H9C1B7	Pectobacterium_phage	48.2	3.4e-162
WP_021015913.1|3138555_3139407_-	DUF2612 domain-containing protein	NA	H9C1B4	Pectobacterium_phage	81.8	4.7e-134
WP_021015912.1|3139399_3140602_-|plate	baseplate J/gp47 family protein	plate	H9C1B3	Pectobacterium_phage	80.2	2.5e-181
WP_021015911.1|3140601_3140952_-	hypothetical protein	NA	H9C1B2	Pectobacterium_phage	81.9	3.9e-50
WP_021015910.1|3141013_3141616_-	hypothetical protein	NA	H9C1B1	Pectobacterium_phage	66.1	2.4e-76
WP_021015909.1|3141612_3142503_-	hypothetical protein	NA	H9C1B0	Pectobacterium_phage	88.8	1.4e-157
WP_021015908.1|3142495_3142786_-	hypothetical protein	NA	H9C1A9	Pectobacterium_phage	81.2	1.1e-39
WP_021015907.1|3142782_3143430_-	hypothetical protein	NA	H9C1A8	Pectobacterium_phage	84.2	1.9e-79
WP_021015906.1|3143432_3145160_-	glycoside hydrolase family 104 protein	NA	H9C1A7	Pectobacterium_phage	58.2	9.2e-177
WP_021015905.1|3145204_3145795_-	hypothetical protein	NA	NA	NA	NA	NA
WP_021015904.1|3145901_3146672_-	phage antirepressor KilAC domain-containing protein	NA	Q71TC0	Escherichia_phage	46.9	2.5e-41
WP_037381732.1|3146738_3147548_-	phage antirepressor N-terminal domain-containing protein	NA	A5VW58	Enterobacteria_phage	52.1	4.2e-55
WP_021015902.1|3147615_3147795_-	Arc family DNA-binding protein	NA	NA	NA	NA	NA
WP_021015901.1|3147918_3148317_+	Arc family DNA-binding protein	NA	NA	NA	NA	NA
WP_021015900.1|3148504_3148906_-	hypothetical protein	NA	H9C1A4	Pectobacterium_phage	75.0	1.8e-51
WP_021015899.1|3148909_3149314_-	hypothetical protein	NA	H9C1A3	Pectobacterium_phage	83.6	1.1e-59
WP_021015898.1|3149320_3150478_-	DUF3383 family protein	NA	H9C1A2	Pectobacterium_phage	65.7	4.4e-143
WP_021015897.1|3150485_3151010_-	hypothetical protein	NA	H9C1A1	Pectobacterium_phage	82.1	1.2e-74
WP_021015896.1|3151011_3151431_-	hypothetical protein	NA	H9C1A0	Pectobacterium_phage	82.1	1.0e-65
WP_021015895.1|3151433_3152021_-	hypothetical protein	NA	H9C199	Pectobacterium_phage	62.1	6.1e-56
WP_084297635.1|3152017_3152455_-	DUF4054 domain-containing protein	NA	H9C198	Pectobacterium_phage	85.6	1.6e-61
WP_021015892.1|3152849_3153785_-	DUF2184 domain-containing protein	NA	H9C196	Pectobacterium_phage	83.6	8.8e-150
WP_021015891.1|3153802_3154309_-	hypothetical protein	NA	H9C195	Pectobacterium_phage	75.0	1.3e-62
WP_021015890.1|3154308_3155508_-	DUF2213 domain-containing protein	NA	H9C194	Pectobacterium_phage	80.2	5.1e-142
WP_021015889.1|3155519_3156269_-|capsid	minor capsid protein	capsid	H9C193	Pectobacterium_phage	88.4	2.2e-119
WP_021015888.1|3156318_3157710_-	DUF1073 domain-containing protein	NA	H9C192	Pectobacterium_phage	81.7	3.1e-223
WP_021015887.1|3157712_3159353_-|terminase	phage terminase large subunit	terminase	H9C191	Pectobacterium_phage	94.1	0.0e+00
WP_021015886.1|3159447_3159609_-	hypothetical protein	NA	NA	NA	NA	NA
WP_021015885.1|3159815_3160832_-|terminase	terminase small subunit	terminase	I6X6R5	Burkholderia_virus	44.8	2.9e-45
WP_021015884.1|3161050_3161212_+	hypothetical protein	NA	NA	NA	NA	NA
WP_021015883.1|3161204_3161528_+	hypothetical protein	NA	NA	NA	NA	NA
WP_021015882.1|3161635_3161878_-	hypothetical protein	NA	NA	NA	NA	NA
WP_021015881.1|3162005_3162449_+	hypothetical protein	NA	NA	NA	NA	NA
WP_021015880.1|3162656_3163205_-	hypothetical protein	NA	NA	NA	NA	NA
WP_021015879.1|3163357_3163564_-	hypothetical protein	NA	NA	NA	NA	NA
WP_021015878.1|3163728_3164262_-	hypothetical protein	NA	H9C185	Pectobacterium_phage	69.5	2.2e-60
WP_021015877.1|3164234_3164765_-	lysozyme	NA	I6PBN2	Cronobacter_phage	59.1	4.7e-47
WP_021015876.1|3164767_3165007_-	Lysis S family protein	NA	NA	NA	NA	NA
WP_021015875.1|3165183_3165591_-	type II toxin-antitoxin system HicB family antitoxin	NA	F1C593	Cronobacter_phage	60.0	1.0e-38
WP_023220365.1|3165639_3165816_-	type II toxin-antitoxin system HicA family toxin	NA	A0A0M3LQ86	Mannheimia_phage	60.3	1.2e-12
WP_021015874.1|3165985_3166561_-	DUF1133 family protein	NA	A0A0U2S606	Escherichia_phage	45.8	4.3e-38
WP_021015873.1|3166557_3166917_-	RusA family crossover junction endodeoxyribonuclease	NA	K7P6W0	Enterobacteria_phage	69.2	3.0e-42
WP_021015872.1|3166913_3167198_-	DUF1364 family protein	NA	G8C7V5	Escherichia_phage	86.0	1.2e-41
WP_021015871.1|3167194_3167788_-	DUF1367 family protein	NA	H9C173	Pectobacterium_phage	56.9	7.5e-62
WP_021015870.1|3167829_3168078_-	hypothetical protein	NA	H6WRY6	Salmonella_phage	68.1	3.0e-20
WP_021015869.1|3168175_3169915_-	DNA cytosine methyltransferase	NA	H9C171	Pectobacterium_phage	60.1	9.7e-227
WP_021015868.1|3169911_3170670_-	class I SAM-dependent methyltransferase	NA	H9C170	Pectobacterium_phage	68.6	3.6e-61
WP_021015867.1|3170662_3171352_-	hypothetical protein	NA	H9C168	Pectobacterium_phage	47.7	5.0e-09
WP_021015866.1|3171348_3171633_-	winged helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_101377506.1|3171682_3172348_-	replication protein	NA	A0A0U2JGJ0	Escherichia_phage	67.8	2.3e-59
WP_021015863.1|3173187_3173748_-	DUF1019 domain-containing protein	NA	K7PJT7	Enterobacteria_phage	37.1	1.5e-16
WP_021015862.1|3173750_3173981_-	helix-turn-helix domain-containing protein	NA	A0A0M4QX15	Salmonella_phage	58.1	1.0e-19
WP_021015861.1|3174083_3174476_+	helix-turn-helix domain-containing protein	NA	K7PM35	Enterobacteria_phage	51.6	3.5e-31
WP_101377507.1|3175026_3175218_+	DUF1482 family protein	NA	NA	NA	NA	NA
WP_101377508.1|3175499_3177185_+	hypothetical protein	NA	H6WRX1	Salmonella_phage	35.6	7.1e-65
WP_021017448.1|3177505_3178168_+	exodeoxyribonuclease X	NA	A0A1W5PTR6	Pseudoalteromonas_phage	36.6	8.2e-17
WP_101377509.1|3178167_3178836_+	AAA family ATPase	NA	G9L667	Escherichia_phage	47.0	1.5e-50
WP_101377510.1|3178853_3179558_+	hypothetical protein	NA	A0A088C400	Shewanella_sp._phage	39.7	5.6e-24
WP_037381585.1|3179618_3179837_+	TraR/DksA family transcriptional regulator	NA	A0A0N7C211	Escherichia_phage	54.3	7.6e-12
WP_021015858.1|3179934_3180189_+	excisionase family protein	NA	Q859D3	Escherichia_coli_phage	50.0	9.4e-14
3180088:3180101	attL	GGGCAACCGTGGGA	NA	NA	NA	NA
WP_021015857.1|3180222_3181506_+|integrase	tyrosine-type recombinase/integrase	integrase	B6DZ48	Enterobacteria_phage	57.2	3.4e-144
WP_021015857.1|3180222_3181506_+|integrase	tyrosine-type recombinase/integrase	integrase	B6DZ48	Enterobacteria_phage	57.2	3.4e-144
3182381:3182394	attR	TCCCACGGTTGCCC	NA	NA	NA	NA
>prophage 3
NZ_CP025084	Serratia sp. ATCC 39006 chromosome, complete genome	4971757	3220362	3312428	4971757	tail,plate,protease,integrase,lysis,tRNA	Escherichia_phage(22.22%)	93	3236461:3236475	3320179:3320193
WP_021015818.1|3220362_3221187_+	ammonia-dependent NAD(+) synthetase	NA	G3MA24	Bacillus_virus	53.1	3.3e-68
WP_037381572.1|3221269_3222151_+	aromatic amino acid DMT transporter YddG	NA	NA	NA	NA	NA
WP_021015816.1|3222296_3222653_+	nitrous oxide-stimulated promoter family protein	NA	NA	NA	NA	NA
WP_009112984.1|3222707_3223004_-	integration host factor subunit alpha	NA	A0A0H3UZA0	Geobacillus_virus	40.0	7.1e-13
WP_021015815.1|3223008_3225396_-|tRNA	phenylalanine--tRNA ligase subunit beta	tRNA	A0A1L3IZU3	BeAn_58058_virus	24.7	2.1e-06
WP_021015814.1|3225411_3226395_-|tRNA	phenylalanine--tRNA ligase subunit alpha	tRNA	A0A2H4UW22	Bodo_saltans_virus	37.6	1.4e-33
WP_157831396.1|3226579_3226624_-	pheST operon leader peptide PheM	NA	NA	NA	NA	NA
WP_021015813.1|3226770_3227127_-	50S ribosomal protein L20	NA	NA	NA	NA	NA
WP_021015812.1|3227169_3227367_-	50S ribosomal protein L35	NA	NA	NA	NA	NA
WP_071790861.1|3227463_3228006_-	translation initiation factor IF-3	NA	A0A2L0UZ54	Agrobacterium_phage	34.1	7.4e-16
WP_021015810.1|3228009_3229938_-|tRNA	threonine--tRNA ligase	tRNA	A0A2K9L297	Tupanvirus	37.9	4.5e-132
WP_021015809.1|3230424_3230700_-	YebO family protein	NA	NA	NA	NA	NA
WP_021015808.1|3230881_3231673_-	DNA-binding transcriptional regulator KdgR	NA	NA	NA	NA	NA
WP_021015807.1|3231882_3233049_-	PD40 domain-containing protein	NA	NA	NA	NA	NA
WP_021015806.1|3233336_3234221_-|protease	protease HtpX	protease	NA	NA	NA	NA
WP_021015805.1|3234671_3236843_-	EAL domain-containing protein	NA	G3MA91	Bacillus_virus	36.4	2.5e-22
3236461:3236475	attL	GCACCAATAGCATAA	NA	NA	NA	NA
WP_021015803.1|3237579_3238833_-	NADP-dependent isocitrate dehydrogenase	NA	Q77Z09	Phage_21	77.8	5.0e-15
WP_021015802.1|3238934_3239591_+	23S rRNA pseudouridine(2457) synthase RluE	NA	NA	NA	NA	NA
WP_021015801.1|3239583_3240030_+	NUDIX hydrolase	NA	NA	NA	NA	NA
WP_021015800.1|3240132_3241245_+|tRNA	tRNA 2-thiouridine(34) synthase MnmA	tRNA	NA	NA	NA	NA
WP_021015799.1|3241507_3243175_-	Tar ligand binding domain-containing protein	NA	NA	NA	NA	NA
WP_021015798.1|3243946_3244579_+	high frequency lysogenization protein HflD	NA	NA	NA	NA	NA
WP_021015797.1|3244712_3246083_+	adenylosuccinate lyase	NA	A0A2H4UUU6	Bodo_saltans_virus	46.0	5.9e-110
WP_021015796.1|3246259_3246943_+	two-component system response regulator PhoP	NA	NA	NA	NA	NA
WP_021015795.1|3246944_3248396_+	two-component system sensor histidine kinase PhoQ	NA	NA	NA	NA	NA
WP_021015794.1|3248456_3249578_+	cupin domain-containing protein	NA	NA	NA	NA	NA
WP_021015793.1|3249737_3251006_-	peptidase T	NA	NA	NA	NA	NA
WP_021015792.1|3251280_3251511_-	FeoC-like transcriptional regulator	NA	NA	NA	NA	NA
WP_021015791.1|3251566_3253891_-	Fe(2+) transporter permease subunit FeoB	NA	NA	NA	NA	NA
WP_021015790.1|3253918_3254146_-	FeoA domain-containing protein	NA	NA	NA	NA	NA
WP_021015789.1|3254157_3254406_-	ferrous iron transport protein A	NA	NA	NA	NA	NA
WP_021015788.1|3254737_3256753_-	carboxy terminal-processing peptidase	NA	A0A0R6PIZ1	Moraxella_phage	34.2	8.7e-86
WP_021015787.1|3256772_3257501_-	RNA chaperone ProQ	NA	NA	NA	NA	NA
WP_037381569.1|3257585_3258092_-	GAF domain-containing protein	NA	NA	NA	NA	NA
WP_021015785.1|3259056_3259248_+	YebW family protein	NA	NA	NA	NA	NA
WP_037380923.1|3259659_3260472_-	phage repressor protein CI	NA	Q6K1G0	Salmonella_virus	50.4	2.9e-80
WP_021015783.1|3261110_3261620_+	hypothetical protein	NA	A0A0F7LBQ6	Escherichia_phage	47.8	5.0e-38
WP_021015782.1|3261699_3261927_+	DUF2732 family protein	NA	NA	NA	NA	NA
WP_021015781.1|3261926_3262151_+	TraR/DksA family transcriptional regulator	NA	A0A1S6L007	Salmonella_phage	50.0	4.3e-10
WP_021015780.1|3262247_3264512_+	replication endonuclease	NA	Q858T4	Yersinia_virus	53.3	4.8e-218
WP_021015779.1|3264617_3264839_+	hypothetical protein	NA	NA	NA	NA	NA
WP_021015776.1|3265577_3265781_+|tail	tail protein X	tail	A0A218M4L8	Erwinia_phage	68.7	3.4e-22
WP_021015775.1|3265783_3265993_+	hypothetical protein	NA	A0A218M4L5	Erwinia_phage	42.0	9.2e-07
WP_021015774.1|3265976_3266486_+	lysozyme	NA	A0A218M4K3	Erwinia_phage	61.9	3.6e-57
WP_021015773.1|3266482_3266914_+|lysis	LysB family phage lysis regulatory protein	lysis	F1BUQ1	Erwinia_phage	32.4	4.7e-13
WP_021015772.1|3267003_3267471_+|tail	phage tail protein	tail	A0A0F7LA33	Escherichia_phage	48.4	7.5e-33
WP_021015771.1|3267748_3268390_+|plate	phage baseplate assembly protein V	plate	Q6K1H6	Salmonella_virus	65.9	1.1e-74
WP_021015770.1|3268386_3268734_+	GPW/gp25 family protein	NA	F1BUP4	Erwinia_phage	64.0	7.0e-36
WP_021015769.1|3268738_3269647_+|plate	baseplate assembly protein	plate	A0A0F7LCJ3	Escherichia_phage	74.8	2.0e-122
WP_021015768.1|3269639_3270251_+|tail	phage tail protein I	tail	A0A0F7LA36	Escherichia_phage	62.9	3.0e-74
WP_021015767.1|3270477_3271497_+|tail	phage tail protein	tail	A0A2I8TVA9	Erwinia_phage	55.9	5.2e-95
WP_021015766.1|3271496_3272111_+|tail	tail fiber assembly protein	tail	Q9MCR5	Enterobacteria_phage	47.2	9.9e-41
WP_021015765.1|3272248_3272680_-	FkbM family methyltransferase	NA	A0A291AUV0	Sinorhizobium_phage	33.3	1.2e-08
WP_021015764.1|3272688_3273768_-	acyltransferase	NA	Q716G0	Shigella_phage	35.6	1.0e-40
WP_021015760.1|3275301_3276459_+|tail	phage tail protein	tail	M1TAS6	Escherichia_phage	45.0	2.2e-105
WP_021015759.1|3276458_3277073_+|tail	tail fiber assembly protein	tail	A0A218M4J2	Erwinia_phage	44.9	1.7e-40
WP_021015758.1|3277402_3278671_+|tail	phage tail protein	tail	A0A0M3ULH6	Salmonella_phage	46.2	2.8e-90
WP_021015757.1|3278670_3279252_+|tail	tail fiber assembly protein	tail	A0A0M4QWM3	Salmonella_phage	53.4	2.6e-51
WP_021015756.1|3279410_3280763_+	esterase-like activity of phytase family protein	NA	NA	NA	NA	NA
WP_021015755.1|3280931_3281495_-	DNA endonuclease SmrA	NA	NA	NA	NA	NA
WP_021015754.1|3281859_3283029_+|tail	phage tail sheath protein	tail	S4TRX2	Salmonella_phage	80.4	1.7e-182
WP_021015753.1|3283043_3283565_+|tail	phage major tail tube protein	tail	S4TNZ0	Salmonella_phage	77.3	4.2e-77
WP_021015752.1|3283629_3283920_+|tail	phage tail assembly protein	tail	A0A0F7LDQ8	Escherichia_phage	67.4	1.2e-25
WP_071790860.1|3283952_3284072_+|tail	GpE family phage tail protein	tail	A0A0F7LCR6	Escherichia_phage	74.4	3.5e-11
WP_021015751.1|3284064_3286380_+|tail	phage tail tape measure protein	tail	Q858U7	Yersinia_virus	41.4	2.7e-75
WP_021015750.1|3286393_3286888_+|tail	phage tail protein	tail	S4TUC3	Salmonella_phage	51.9	8.8e-40
WP_021015749.1|3286884_3288078_+	hypothetical protein	NA	Q6K1G4	Salmonella_virus	37.3	1.1e-67
WP_021015748.1|3288176_3288392_+	ogr/Delta-like zinc finger family protein	NA	A0A2I8TV89	Erwinia_phage	66.7	5.9e-17
WP_037380909.1|3288773_3290081_+	guanine deaminase	NA	NA	NA	NA	NA
WP_021015746.1|3290318_3292088_+	diguanylate cyclase	NA	NA	NA	NA	NA
WP_021015745.1|3292129_3292783_-	metallophosphoesterase	NA	K7P6H8	Enterobacteria_phage	55.3	1.1e-71
WP_021015744.1|3293147_3293552_+	hypothetical protein	NA	NA	NA	NA	NA
WP_021015743.1|3293810_3294044_+	hypothetical protein	NA	A0A192Y6D5	Salmonella_phage	54.5	2.4e-16
WP_021015742.1|3294166_3294868_-	winged helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_021015741.1|3294870_3295263_-	amino acid-binding ACT domain-containing protein	NA	NA	NA	NA	NA
WP_021015740.1|3295267_3295579_-	antibiotic biosynthesis monooxygenase	NA	NA	NA	NA	NA
WP_021015739.1|3295920_3297477_-	2-isopropylmalate synthase	NA	NA	NA	NA	NA
WP_021015738.1|3297473_3298748_-	MFS transporter	NA	NA	NA	NA	NA
WP_021015737.1|3298744_3299359_-	cysteine hydrolase	NA	NA	NA	NA	NA
WP_021015736.1|3299355_3301239_-	FAD/NAD(P)-binding protein	NA	NA	NA	NA	NA
WP_021015735.1|3301235_3302432_-	pyridoxal phosphate-dependent aminotransferase	NA	NA	NA	NA	NA
WP_021015734.1|3302480_3303488_-	TauD/TfdA family dioxygenase	NA	NA	NA	NA	NA
WP_021015733.1|3303523_3305485_-	aconitate hydratase	NA	NA	NA	NA	NA
WP_021015732.1|3305481_3305859_-	cupin domain-containing protein	NA	NA	NA	NA	NA
WP_021015731.1|3305888_3306440_-	TetR/AcrR family transcriptional regulator	NA	NA	NA	NA	NA
WP_021015729.1|3307455_3307746_+	hypothetical protein	NA	NA	NA	NA	NA
WP_021015728.1|3307896_3308298_+	nuclear transport factor 2 family protein	NA	NA	NA	NA	NA
WP_021015727.1|3308674_3309127_-	hypothetical protein	NA	NA	NA	NA	NA
WP_021015726.1|3310131_3310479_+	hypothetical protein	NA	A0A222YZD3	Escherichia_phage	58.3	4.6e-35
WP_037380902.1|3310777_3310957_-	hypothetical protein	NA	NA	NA	NA	NA
WP_021015725.1|3311299_3311578_+	type II toxin-antitoxin system RelE/ParE family toxin	NA	A0A2L1IV28	Escherichia_phage	59.8	4.0e-26
WP_021015724.1|3311577_3311862_+	HigA family addiction module antidote protein	NA	A0A2L1IV52	Escherichia_phage	65.9	1.5e-23
WP_084297613.1|3312092_3312428_+|integrase	tyrosine-type recombinase/integrase	integrase	A0A2H4IYC8	uncultured_Caudovirales_phage	47.7	1.6e-21
3320179:3320193	attR	GCACCAATAGCATAA	NA	NA	NA	NA
>prophage 4
NZ_CP025084	Serratia sp. ATCC 39006 chromosome, complete genome	4971757	3921963	3930505	4971757		Bacillus_phage(50.0%)	8	NA	NA
WP_021015190.1|3921963_3922653_+	response regulator transcription factor	NA	W8CYM9	Bacillus_phage	33.9	1.1e-27
WP_021015189.1|3922659_3923844_+	HAMP domain-containing histidine kinase	NA	W8CYF6	Bacillus_phage	24.8	1.3e-20
WP_021015188.1|3924045_3924807_+	CDP-diacylglycerol diphosphatase	NA	NA	NA	NA	NA
WP_021015187.1|3925099_3925246_-	hypothetical protein	NA	NA	NA	NA	NA
WP_021015186.1|3925647_3927054_-	NADP-dependent phosphogluconate dehydrogenase	NA	A0A1D7RI04	Synechococcus_phage	29.2	4.3e-31
WP_021015185.1|3927240_3928146_-	UTP--glucose-1-phosphate uridylyltransferase	NA	A0A127AW70	Bacillus_phage	42.3	8.5e-49
WP_021015184.1|3928216_3929383_-	nucleotide sugar dehydrogenase	NA	O41091	Paramecium_bursaria_Chlorella_virus	56.8	2.7e-116
WP_021015183.1|3929497_3930505_-	NAD-dependent epimerase	NA	A0A218MN48	uncultured_virus	30.4	2.9e-13
>prophage 5
NZ_CP025084	Serratia sp. ATCC 39006 chromosome, complete genome	4971757	4745600	4758964	4971757	tRNA	Enterobacteria_phage(33.33%)	11	NA	NA
WP_021014455.1|4745600_4746896_-	ABC transporter ATP-binding protein	NA	W6JKT0	Anomala_cuprea_entomopoxvirus	25.9	1.2e-14
WP_021014454.1|4746895_4747693_-	ABC transporter permease	NA	NA	NA	NA	NA
WP_021014453.1|4747695_4749057_-	phosphomannomutase/phosphoglucomutase	NA	A0A127AWJ1	Bacillus_phage	28.5	8.9e-34
WP_021014452.1|4749053_4750484_-	mannose-1-phosphate guanylyltransferase/mannose-6-phosphate isomerase	NA	A0A1V0SH58	Hokovirus	30.2	6.2e-54
WP_021014451.1|4751486_4752047_-	dTDP-4-dehydrorhamnose 3,5-epimerase	NA	I7HJC4	Enterobacteria_phage	56.6	2.3e-52
WP_021014450.1|4752053_4752926_-	dTDP-4-dehydrorhamnose reductase	NA	A0A291LA50	Escherichia_phage	35.4	3.6e-36
WP_021014449.1|4752951_4753815_-	glucose-1-phosphate thymidylyltransferase RfbA	NA	I7I009	Enterobacteria_phage	67.4	3.8e-107
WP_021014448.1|4753814_4754882_-	dTDP-glucose 4,6-dehydratase	NA	I7HTA3	Enterobacteria_phage	52.8	1.4e-98
WP_021014447.1|4755121_4755499_-	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_173861232.1|4756147_4756348_+	cold-shock protein	NA	A0A1W6JNX5	Morganella_phage	82.8	2.7e-24
WP_021014444.1|4757446_4758964_-|tRNA	lysine--tRNA ligase	tRNA	A0A1V0SAC0	Catovirus	36.3	2.9e-86
