The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
NZ_CP045799	Pseudomonas syringae USA011 chromosome, complete genome	6024796	2345042	2400245	6024796	tRNA,capsid,terminase,head,holin,tail,protease,portal,integrase	Pseudomonas_phage(59.18%)	74	2352445:2352498	2402562:2402615
WP_004408427.1|2345042_2346965_+|tRNA	threonine--tRNA ligase	tRNA	A0A2K9L297	Tupanvirus	37.7	4.1e-125
WP_003367017.1|2346982_2347516_+	translation initiation factor IF-3	NA	A0A2I7S9Q1	Vibrio_phage	37.3	8.9e-14
WP_002553160.1|2347576_2347771_+	50S ribosomal protein L35	NA	NA	NA	NA	NA
WP_002553161.1|2347800_2348157_+	50S ribosomal protein L20	NA	NA	NA	NA	NA
WP_003367019.1|2348261_2349278_+|tRNA	phenylalanine--tRNA ligase subunit alpha	tRNA	A0A2K9L3A8	Tupanvirus	39.3	8.4e-29
WP_024639020.1|2349305_2351684_+|tRNA	phenylalanine--tRNA ligase subunit beta	tRNA	NA	NA	NA	NA
WP_002553164.1|2351687_2351990_+	integration host factor subunit alpha	NA	A0A0H3UZA0	Geobacillus_virus	38.9	1.8e-11
WP_004408375.1|2351970_2352327_+	MerR family transcriptional regulator	NA	NA	NA	NA	NA
2352445:2352498	attL	AGCATGGGGTGCTAGGGGTCGAGTGTTCGAATCACTCCGTCCCGACCATATTTT	NA	NA	NA	NA
WP_024639021.1|2352580_2353693_-|integrase	tyrosine-type recombinase/integrase	integrase	A0A0U4JIT5	Pseudomonas_phage	31.4	3.1e-32
WP_005753573.1|2353692_2353905_-	hypothetical protein	NA	NA	NA	NA	NA
WP_032611107.1|2353953_2354856_-	phosphohydrolase	NA	A0A1V0ECI3	Caulobacter_phage	45.2	6.2e-68
WP_024639023.1|2354925_2355261_-	hypothetical protein	NA	NA	NA	NA	NA
WP_080393533.1|2355537_2355777_+	hypothetical protein	NA	NA	NA	NA	NA
WP_024639025.1|2356534_2356723_+	hypothetical protein	NA	NA	NA	NA	NA
WP_024639026.1|2356791_2357568_-	DUF2786 domain-containing protein	NA	A0A2P9JZH4	Alteromonadaceae_phage	28.5	4.5e-14
WP_024639027.1|2357660_2358068_-	hypothetical protein	NA	A0A0U4JNY7	Pseudomonas_phage	62.8	9.4e-40
WP_024639028.1|2358175_2358370_+	hypothetical protein	NA	NA	NA	NA	NA
WP_024639029.1|2358396_2358675_-	hypothetical protein	NA	NA	NA	NA	NA
WP_024639030.1|2358671_2359259_-	hypothetical protein	NA	NA	NA	NA	NA
WP_024639031.1|2359258_2359597_-	hypothetical protein	NA	NA	NA	NA	NA
WP_024639032.1|2359887_2360664_-	hypothetical protein	NA	A0A1B0YZY3	Pseudomonas_phage	65.5	2.8e-93
WP_024639033.1|2360737_2361139_-	helix-turn-helix transcriptional regulator	NA	A0A2H4JA92	uncultured_Caudovirales_phage	61.7	1.2e-18
WP_024639034.1|2361491_2362322_-	DUF3037 domain-containing protein	NA	NA	NA	NA	NA
WP_024639035.1|2362318_2363065_-	hypothetical protein	NA	NA	NA	NA	NA
WP_020304839.1|2363205_2363445_-	hypothetical protein	NA	NA	NA	NA	NA
WP_024639036.1|2363456_2364152_-	helix-turn-helix domain-containing protein	NA	A5VW98	Enterobacteria_phage	47.4	4.7e-39
WP_058401079.1|2364235_2364475_+	hypothetical protein	NA	A0A2H4J0V8	uncultured_Caudovirales_phage	73.4	8.5e-25
WP_024639038.1|2364699_2365368_+	DNA-binding protein	NA	A0A1B0YZY9	Pseudomonas_phage	53.5	1.4e-53
WP_050586751.1|2365379_2366159_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_024639040.1|2366155_2366836_+	replication P family protein	NA	A0A2D1GNB3	Pseudomonas_phage	42.7	4.6e-31
WP_024639041.1|2366832_2367129_+	DUF1364 domain-containing protein	NA	A0A2D1GNQ4	Pseudomonas_phage	84.5	1.5e-42
WP_024639042.1|2367125_2367314_+	DUF1382 family protein	NA	A0A2H4J9M2	uncultured_Caudovirales_phage	80.0	1.2e-18
WP_024639043.1|2367310_2367520_+	hypothetical protein	NA	NA	NA	NA	NA
WP_024639044.1|2367516_2367948_+	VRR-NUC domain-containing protein	NA	A0A2D1GNH3	Pseudomonas_phage	74.8	2.2e-55
WP_024639045.1|2367944_2368256_+	hypothetical protein	NA	A0A2H4J249	uncultured_Caudovirales_phage	44.1	3.4e-13
WP_024639046.1|2368252_2369530_+|integrase	site-specific integrase	integrase	A0A2D1GND4	Pseudomonas_phage	54.3	1.3e-122
WP_024639047.1|2369532_2369748_+	hypothetical protein	NA	NA	NA	NA	NA
WP_024639048.1|2369744_2370065_+	hypothetical protein	NA	A0A2D1GNG3	Pseudomonas_phage	75.5	1.8e-38
WP_024639049.1|2370067_2370454_+	antitermination protein Q	NA	A0A1W6JTD2	Pseudomonas_phage	55.1	3.9e-35
WP_129398657.1|2370586_2371084_+	hypothetical protein	NA	NA	NA	NA	NA
WP_024639051.1|2371182_2371506_+|holin	phage holin, lambda family	holin	A0A1V0DYG4	Shewanella_phage	37.8	8.9e-09
WP_024639052.1|2371502_2371922_+	hypothetical protein	NA	NA	NA	NA	NA
WP_024639053.1|2371950_2373576_-	methyl-accepting chemotaxis protein	NA	A0A2H4J162	uncultured_Caudovirales_phage	42.1	2.0e-56
WP_024639055.1|2374521_2374881_+	hypothetical protein	NA	H2BDJ7	Pseudomonas_virus	34.9	7.1e-07
WP_024639056.1|2374871_2375267_+	HNH endonuclease	NA	A0A2D1GNP5	Pseudomonas_phage	76.0	1.7e-57
WP_024639057.1|2375434_2375920_+|terminase	phage terminase small subunit P27 family	terminase	A0A2D1GNP3	Pseudomonas_phage	90.1	2.7e-78
WP_024639058.1|2375920_2377654_+|terminase	terminase large subunit	terminase	A0A2D1GNU5	Pseudomonas_phage	91.5	0.0e+00
WP_153795658.1|2377662_2377974_-	hypothetical protein	NA	NA	NA	NA	NA
WP_080393532.1|2377972_2379118_+|portal	phage portal protein	portal	A0A1V0E8B9	Vibrio_phage	57.8	3.2e-125
WP_024639060.1|2379121_2379985_+|protease	Clp protease ClpP	protease	A0A1V0E8B8	Vibrio_phage	62.5	2.7e-92
WP_024639061.1|2379981_2381175_+|capsid	phage major capsid protein	capsid	H2BDB0	Pseudomonas_virus	67.4	1.2e-138
WP_024639062.1|2381225_2381642_+	hypothetical protein	NA	NA	NA	NA	NA
WP_024639063.1|2381645_2382122_+|head,tail	phage gp6-like head-tail connector protein	head,tail	G3ENA1	Psychrobacter_phage	38.1	1.6e-14
WP_024639064.1|2382121_2382460_+|head	phage head closure protein	head	A0A1J0GUY4	Halomonas_phage	60.9	4.8e-29
WP_024639065.1|2382452_2382938_+	HK97 gp10 family phage protein	NA	A0A0U3TGT7	Pseudomonas_phage	67.7	1.3e-56
WP_024639066.1|2382937_2383306_+	DUF3168 domain-containing protein	NA	Q9MCA6	Pseudomonas_phage	64.2	1.6e-38
WP_024639067.1|2383369_2383873_+|tail	phage major tail protein	tail	A0A0U4ISC1	Pseudomonas_phage	61.0	1.9e-50
WP_024639068.1|2383882_2384320_+|tail	phage tail assembly protein	tail	Q9MCA4	Pseudomonas_phage	68.4	1.5e-38
WP_099315314.1|2384600_2385389_+	hypothetical protein	NA	A0A2H4J8D6	uncultured_Caudovirales_phage	47.5	4.6e-59
WP_024639069.1|2385446_2388017_+|tail	phage tail tape measure protein	tail	A0A2H4PI09	Pseudomonas_phage	50.4	3.5e-180
WP_024639070.1|2388016_2388361_+|tail	tail protein	tail	A0A2D1GNJ1	Pseudomonas_phage	52.6	6.7e-31
WP_153795659.1|2388396_2388549_+	hypothetical protein	NA	NA	NA	NA	NA
WP_024639072.1|2388550_2388817_-	hypothetical protein	NA	NA	NA	NA	NA
WP_024639073.1|2388899_2389193_-	hypothetical protein	NA	NA	NA	NA	NA
WP_024639074.1|2389356_2390055_+|tail	phage minor tail protein L	tail	A0A2D1GNF3	Pseudomonas_phage	80.1	5.3e-107
WP_024639075.1|2390057_2390840_+|tail	phage tail protein	tail	A0A2D1GNP8	Pseudomonas_phage	74.6	1.2e-120
WP_024639076.1|2390836_2391424_+|tail	tail assembly protein	tail	A0A2D1GNM2	Pseudomonas_phage	73.1	2.9e-74
WP_024639077.1|2391478_2395234_+|tail	phage tail protein	tail	A0A2D1GNE3	Pseudomonas_phage	61.2	0.0e+00
WP_024639079.1|2395550_2396237_+	hypothetical protein	NA	A0A2D1GNS6	Pseudomonas_phage	39.5	1.0e-38
WP_153795660.1|2396260_2397643_+|tail	tail fiber domain-containing protein	tail	A0A059VJZ6	Pseudomonas_phage	45.5	1.8e-42
WP_153795661.1|2397707_2398241_+	glycoside hydrolase family 19 protein	NA	A0A059VA40	Pseudomonas_phage	92.1	8.4e-89
WP_032610755.1|2398237_2398768_+	DUF2514 domain-containing protein	NA	A0A059VF51	Pseudomonas_phage	80.9	9.7e-61
WP_153795698.1|2398824_2399004_+	hypothetical protein	NA	A0A059VK06	Pseudomonas_phage	56.6	6.4e-09
WP_153795662.1|2399000_2400245_+	SGNH/GDSL hydrolase family protein	NA	A0A059VA35	Pseudomonas_phage	87.2	2.8e-207
2402562:2402615	attR	AGCATGGGGTGCTAGGGGTCGAGTGTTCGAATCACTCCGTCCCGACCATATTTT	NA	NA	NA	NA
>prophage 2
NZ_CP045799	Pseudomonas syringae USA011 chromosome, complete genome	6024796	3601801	3609543	6024796	tRNA	uncultured_Caudovirales_phage(71.43%)	9	NA	NA
WP_003411623.1|3601801_3603103_-	MFS transporter	NA	Q6JIH2	Burkholderia_virus	36.2	1.4e-60
WP_024639665.1|3603337_3603730_+	sulfurtransferase complex subunit TusD	NA	A0A2H4JA39	uncultured_Caudovirales_phage	82.3	6.3e-57
WP_024639666.1|3603731_3604094_+	sulfurtransferase complex subunit TusC	NA	A0A2H4J8C0	uncultured_Caudovirales_phage	61.7	1.9e-36
WP_024639667.1|3604093_3604393_+	sulfurtransferase complex subunit TusB	NA	A0A2H4JG28	uncultured_Caudovirales_phage	61.6	9.4e-29
WP_003317943.1|3604389_3604725_+	TusE/DsrC/DsvC family sulfur relay protein	NA	A0A2H4J8B6	uncultured_Caudovirales_phage	78.4	1.2e-43
WP_024639668.1|3604721_3605723_+	glycosyl transferase family protein	NA	A0A2H4JBY5	uncultured_Caudovirales_phage	84.2	8.8e-164
WP_024639669.1|3605818_3606817_+	glutathione S-transferase family protein	NA	NA	NA	NA	NA
WP_024639670.1|3606867_3608262_-	uroporphyrinogen-III C-methyltransferase	NA	NA	NA	NA	NA
WP_003317946.1|3608262_3609543_-|tRNA	serine--tRNA ligase	tRNA	A0A1B1IVT2	uncultured_Mediterranean_phage	45.8	4.1e-97
>prophage 3
NZ_CP045799	Pseudomonas syringae USA011 chromosome, complete genome	6024796	4196167	4264701	6024796	protease,tRNA,transposase	Bacillus_phage(33.33%)	38	NA	NA
WP_104722995.1|4196167_4197543_-|transposase	IS3 family transposase	transposase	A0A1B1P773	Bacillus_phage	52.8	1.9e-76
WP_104722995.1|4197860_4199235_+|transposase	IS3 family transposase	transposase	A0A1B1P773	Bacillus_phage	52.8	1.9e-76
WP_002554613.1|4199692_4199872_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003407712.1|4199950_4200490_-	DUF2058 domain-containing protein	NA	NA	NA	NA	NA
WP_024640384.1|4200520_4201354_-	nucleoside triphosphate pyrophosphohydrolase	NA	NA	NA	NA	NA
WP_011268592.1|4201481_4203725_-	GTP diphosphokinase	NA	NA	NA	NA	NA
WP_024640383.1|4203881_4205237_-	23S rRNA (uracil(1939)-C(5))-methyltransferase RlmD	NA	F5CA72	Streptococcus_phi-m46.1-like_phage	27.1	5.9e-30
WP_003407727.1|4205236_4206139_-	cysteine synthase CysM	NA	A0A1X9I5F1	Streptococcus_phage	40.1	3.9e-54
WP_011268595.1|4206389_4209143_+	response regulator	NA	A0A1V0SGX0	Hokovirus	29.4	2.2e-47
WP_003407729.1|4209223_4209661_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003407731.1|4209657_4210065_+	META domain-containing protein	NA	NA	NA	NA	NA
WP_011268596.1|4210235_4210703_-	TlpA family protein disulfide reductase	NA	NA	NA	NA	NA
WP_003314592.1|4210831_4211185_+	arsenate reductase (glutaredoxin)	NA	A0A2H4J8T1	uncultured_Caudovirales_phage	48.7	7.4e-25
WP_003363251.1|4211181_4211787_+	NAD(P)H:quinone oxidoreductase	NA	NA	NA	NA	NA
WP_003314590.1|4211886_4212558_+	3-methyladenine DNA glycosylase	NA	NA	NA	NA	NA
WP_003407740.1|4212564_4213389_-|tRNA	tRNA 2-thiocytidine(32) synthetase TtcA	tRNA	A0A0U2S5Z2	Escherichia_phage	72.0	1.2e-105
WP_003314586.1|4213583_4214078_+|protease	SprT family zinc-dependent metalloprotease	protease	A0A2I7S9Y6	Vibrio_phage	31.6	3.7e-06
WP_003407743.1|4214144_4215497_-	dicarboxylate/amino acid:cation symporter	NA	NA	NA	NA	NA
WP_011268599.1|4215891_4217238_-	two-component sensor histidine kinase	NA	NA	NA	NA	NA
WP_003407750.1|4217234_4217912_-	response regulator	NA	NA	NA	NA	NA
WP_003407754.1|4217939_4218290_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003407755.1|4218462_4219251_+	dienelactone hydrolase family protein	NA	NA	NA	NA	NA
WP_104722995.1|4219357_4220732_+|transposase	IS3 family transposase	transposase	A0A1B1P773	Bacillus_phage	52.8	1.9e-76
WP_024640679.1|4220902_4221637_+	4'-phosphopantetheinyl transferase superfamily protein	NA	NA	NA	NA	NA
WP_024640678.1|4221637_4222384_-	siderophore-iron reductase FhuF	NA	NA	NA	NA	NA
WP_024640677.1|4222341_4223952_-	HAMP domain-containing protein	NA	W8CYF6	Bacillus_phage	25.1	2.4e-17
WP_024640676.1|4223956_4224700_-	response regulator transcription factor	NA	W8CYM9	Bacillus_phage	35.3	6.3e-34
WP_024640675.1|4225408_4228321_+	ribonucleoside-diphosphate reductase subunit alpha	NA	A0A2H4P767	Pseudomonas_phage	45.9	8.8e-180
WP_002554639.1|4228586_4229834_+	ribonucleotide-diphosphate reductase subunit beta	NA	U5Q1G6	Bacillus_phage	27.4	1.1e-30
WP_153795674.1|4230093_4250088_-	amino acid adenylation domain-containing protein	NA	A0A2K9KZV5	Tupanvirus	27.7	1.4e-175
WP_057392289.1|4251213_4253160_+	AAA family ATPase	NA	NA	NA	NA	NA
WP_024639713.1|4253362_4254613_-	restriction endonuclease	NA	E5E3X4	Burkholderia_phage	46.7	5.6e-91
WP_080269153.1|4254573_4255077_-	DNA mismatch endonuclease Vsr	NA	E5E3X5	Burkholderia_phage	57.8	2.6e-47
WP_024639714.1|4255130_4256555_-	DNA (cytosine-5-)-methyltransferase	NA	E5E3X6	Burkholderia_phage	49.9	7.0e-106
WP_024639715.1|4257144_4257675_+	Bro-N domain-containing protein	NA	A0A290FZK7	Caldibacillus_phage	29.1	2.1e-07
WP_024639716.1|4257727_4258018_-	hypothetical protein	NA	NA	NA	NA	NA
WP_024639717.1|4258493_4261610_-|protease	autotransporter serine protease	protease	NA	NA	NA	NA
WP_024639718.1|4261701_4264701_-|protease	autotransporter serine protease	protease	NA	NA	NA	NA
>prophage 4
NZ_CP045799	Pseudomonas syringae USA011 chromosome, complete genome	6024796	4853562	4862092	6024796	tail	Pseudomonas_phage(87.5%)	9	NA	NA
WP_153795682.1|4853562_4854807_-	SGNH/GDSL hydrolase family protein	NA	A0A059VA35	Pseudomonas_phage	87.9	3.8e-209
WP_153795699.1|4854803_4854983_-	hypothetical protein	NA	A0A059VK06	Pseudomonas_phage	55.4	1.7e-09
WP_024638367.1|4855039_4855570_-	DUF2514 domain-containing protein	NA	A0A059VF51	Pseudomonas_phage	79.6	7.9e-55
WP_153795683.1|4855566_4856172_-	glycoside hydrolase family 19 protein	NA	A0A059VA40	Pseudomonas_phage	68.5	1.3e-66
WP_153795684.1|4856236_4857619_-|tail	tail fiber domain-containing protein	tail	A0A059VJZ6	Pseudomonas_phage	44.4	1.1e-42
WP_024640309.1|4857648_4858311_-	hypothetical protein	NA	A0A059VF40	Pseudomonas_phage	96.4	2.9e-123
WP_024640308.1|4858307_4858676_-	hypothetical protein	NA	A0A059VJS9	Pseudomonas_phage	95.1	3.9e-61
WP_024640305.1|4860821_4861106_-	STAS-like domain-containing protein	NA	NA	NA	NA	NA
WP_152981404.1|4861108_4862092_-	hypothetical protein	NA	A4PE73	Ralstonia_virus	40.4	1.3e-50
>prophage 5
NZ_CP045799	Pseudomonas syringae USA011 chromosome, complete genome	6024796	5284699	5320355	6024796	tail,lysis,tRNA,plate	Pseudomonas_phage(62.96%)	43	NA	NA
WP_024639964.1|5284699_5285911_-|tRNA	tyrosine--tRNA ligase	tRNA	NA	NA	NA	NA
WP_003401947.1|5286112_5287540_+	peptidoglycan DD-metalloendopeptidase family protein	NA	A8ATH6	Listeria_phage	44.7	4.2e-18
WP_003401948.1|5287543_5288638_+	anhydro-N-acetylmuramic acid kinase	NA	NA	NA	NA	NA
WP_002551953.1|5288700_5289051_-	iron-sulfur cluster insertion protein ErpA	NA	A0A2H4N7M3	Lake_Baikal_phage	50.5	7.4e-25
WP_011269099.1|5289252_5290287_-	N-acetyl-gamma-glutamyl-phosphate reductase	NA	NA	NA	NA	NA
WP_003401951.1|5290420_5290849_+	protoporphyrinogen oxidase HemJ	NA	NA	NA	NA	NA
WP_003401952.1|5290934_5291849_+	DUF805 domain-containing protein	NA	NA	NA	NA	NA
WP_024639965.1|5291905_5292682_+	SDR family oxidoreductase	NA	NA	NA	NA	NA
WP_003401954.1|5292785_5293124_+	histidine triad nucleotide-binding protein	NA	NA	NA	NA	NA
WP_003401955.1|5293245_5293893_+	2-polyprenyl-3-methyl-6-methoxy-1,4-benzoquinone monooxygenase	NA	NA	NA	NA	NA
WP_003316303.1|5293962_5294757_-	adenosylmethionine decarboxylase	NA	NA	NA	NA	NA
WP_024639966.1|5294999_5295422_-	OsmC family protein	NA	NA	NA	NA	NA
WP_024639967.1|5295623_5296268_+	cAMP-activated global transcriptional regulator CRP	NA	NA	NA	NA	NA
WP_024639968.1|5296279_5296975_-	lipoate--protein ligase family protein	NA	NA	NA	NA	NA
WP_024639969.1|5297009_5297846_-	indole-3-glycerol phosphate synthase TrpC	NA	A0A0P0IR83	Acinetobacter_phage	55.8	4.4e-68
WP_024639970.1|5297842_5298892_-	anthranilate phosphoribosyltransferase	NA	A0A0N7IRD9	Acinetobacter_phage	58.0	9.1e-111
WP_003394873.1|5298913_5299513_-	aminodeoxychorismate/anthranilate synthase component II	NA	A0A0P0IKJ1	Acinetobacter_phage	64.7	3.0e-74
WP_024639971.1|5299924_5300437_-|lysis	lysis protein	lysis	B5TK84	Pseudomonas_phage	48.4	4.7e-28
WP_024639972.1|5300433_5300979_-	glycoside hydrolase family 19 protein	NA	A0A2H4JHX4	uncultured_Caudovirales_phage	73.3	1.5e-69
WP_024639973.1|5301211_5301709_-|tail	tail fiber assembly protein	tail	NA	NA	NA	NA
WP_024639974.1|5301985_5303044_-	hypothetical protein	NA	NA	NA	NA	NA
WP_024639975.1|5303299_5303866_-|tail	phage tail protein	tail	B5TK80	Pseudomonas_phage	46.4	1.5e-43
WP_024639976.1|5303873_5305337_-	hypothetical protein	NA	B5TK79	Pseudomonas_phage	40.9	1.7e-86
WP_003401992.1|5305347_5305947_-	DUF2313 domain-containing protein	NA	B5TK76	Pseudomonas_phage	71.9	1.9e-84
WP_024639977.1|5305934_5306975_-|plate	baseplate J/gp47 family protein	plate	B5TK75	Pseudomonas_phage	70.1	2.1e-131
WP_024639978.1|5306964_5307363_-	hypothetical protein	NA	B5TK74	Pseudomonas_phage	62.9	2.6e-42
WP_003372720.1|5307359_5307872_-|plate	phage baseplate assembly protein	plate	B5TK73	Pseudomonas_phage	73.8	1.4e-64
WP_003401994.1|5307868_5308996_-	hypothetical protein	NA	B5TK72	Pseudomonas_phage	60.2	2.7e-113
WP_024639979.1|5308999_5310424_-	2-hydroxyacid dehydrogenase	NA	B5TK71	Pseudomonas_phage	45.6	1.5e-108
WP_024639980.1|5310420_5312703_-|tail	phage tail tape measure protein	tail	U5P420	Shigella_phage	40.2	2.9e-69
WP_003316280.1|5312833_5313130_-|tail	phage tail assembly protein	tail	B5TK69	Pseudomonas_phage	76.0	4.3e-34
WP_011269114.1|5313126_5313474_-|tail	phage tail protein	tail	B5TK68	Pseudomonas_phage	70.4	5.0e-42
WP_003422754.1|5313534_5315031_-|tail	bacteriophage Mu tail sheath	tail	B5TK67	Pseudomonas_phage	80.7	2.2e-235
WP_024639981.1|5315049_5315238_-	DUF2635 domain-containing protein	NA	B5TK66	Pseudomonas_phage	73.5	1.8e-14
WP_011269116.1|5315234_5315825_-	hypothetical protein	NA	B5TK65	Pseudomonas_phage	52.6	2.4e-52
WP_024639982.1|5315870_5316209_-	hypothetical protein	NA	A0A059VJW1	Pseudomonas_phage	59.2	9.0e-20
WP_003411734.1|5316189_5316579_-	hypothetical protein	NA	A0A059VK40	Pseudomonas_phage	76.4	2.3e-43
WP_024639983.1|5316701_5317874_-	cellulase family glycosylhydrolase	NA	NA	NA	NA	NA
WP_011269119.1|5317885_5318071_-	Com family DNA-binding transcriptional regulator	NA	B5TK59	Pseudomonas_phage	89.5	1.3e-12
WP_011269120.1|5318343_5318787_-	hypothetical protein	NA	A0A2H4J8A5	uncultured_Caudovirales_phage	45.8	4.6e-24
WP_024639984.1|5318976_5319588_+	helix-turn-helix domain-containing protein	NA	A0A0M4QWY1	Salmonella_phage	49.2	2.0e-49
WP_024639985.1|5319742_5319991_+	DUF1654 domain-containing protein	NA	NA	NA	NA	NA
WP_003316268.1|5320112_5320355_+	transcriptional regulator	NA	A0A2H4J8B4	uncultured_Caudovirales_phage	51.2	1.9e-16
>prophage 6
NZ_CP045799	Pseudomonas syringae USA011 chromosome, complete genome	6024796	5378939	5449941	6024796	protease,holin,transposase	Bacillus_virus(18.18%)	55	NA	NA
WP_104722995.1|5378939_5380315_-|transposase	IS3 family transposase	transposase	A0A1B1P773	Bacillus_phage	52.8	1.9e-76
WP_024640642.1|5381913_5384202_+	pyrroloquinoline quinone biosynthesis protein PqqF	NA	A0A2H4UVM3	Bodo_saltans_virus	27.6	8.8e-18
WP_003422658.1|5384337_5384412_+	pyrroloquinoline quinone precursor peptide PqqA	NA	NA	NA	NA	NA
WP_024640643.1|5384500_5385412_+	pyrroloquinoline quinone biosynthesis protein PqqB	NA	NA	NA	NA	NA
WP_003402120.1|5385420_5386176_+	pyrroloquinoline-quinone synthase PqqC	NA	NA	NA	NA	NA
WP_011269164.1|5386172_5386457_+	pyrroloquinoline quinone biosynthesis peptide chaperone PqqD	NA	NA	NA	NA	NA
WP_024640644.1|5386449_5387619_+	pyrroloquinoline quinone biosynthesis protein PqqE	NA	NA	NA	NA	NA
WP_024640645.1|5387581_5389408_+	S9 family peptidase	NA	NA	NA	NA	NA
WP_002555565.1|5389463_5389625_-	YqaE/Pmp3 family membrane protein	NA	NA	NA	NA	NA
WP_024640646.1|5390028_5391807_-	acyl-CoA dehydrogenase	NA	NA	NA	NA	NA
WP_024640647.1|5391976_5393275_-	GGDEF domain-containing protein	NA	NA	NA	NA	NA
WP_011269169.1|5394389_5396195_-	acyl-CoA dehydrogenase	NA	NA	NA	NA	NA
WP_003419817.1|5396528_5396825_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011269170.1|5396978_5397659_-	dethiobiotin synthase	NA	NA	NA	NA	NA
WP_024638682.1|5397683_5398493_-	malonyl-ACP O-methyltransferase BioC	NA	NA	NA	NA	NA
WP_024638683.1|5398485_5399217_-	alpha/beta fold hydrolase	NA	NA	NA	NA	NA
WP_024638684.1|5399209_5400400_-	8-amino-7-oxononanoate synthase	NA	NA	NA	NA	NA
WP_003372416.1|5400464_5401523_-	biotin synthase BioB	NA	NA	NA	NA	NA
WP_003402142.1|5401613_5402348_+	ComF family protein	NA	NA	NA	NA	NA
WP_024638685.1|5402486_5403251_+	TOBE domain-containing protein	NA	NA	NA	NA	NA
WP_024638686.1|5403332_5405249_+	PhoX family phosphatase	NA	NA	NA	NA	NA
WP_003402149.1|5405517_5406351_-	phosphodiesterase	NA	NA	NA	NA	NA
WP_024638687.1|5406376_5407408_-	ABC transporter ATP-binding protein	NA	G3M9Y6	Bacillus_virus	35.0	1.2e-27
WP_024638688.1|5407404_5408199_-	ABC transporter permease subunit	NA	NA	NA	NA	NA
WP_003402154.1|5408195_5409065_-	ABC transporter permease	NA	NA	NA	NA	NA
WP_003402156.1|5409064_5410066_-	extracellular solute-binding protein	NA	NA	NA	NA	NA
WP_024638689.1|5410049_5411069_-	substrate-binding domain-containing protein	NA	NA	NA	NA	NA
WP_003411854.1|5411262_5412237_+	serine/threonine protein kinase	NA	NA	NA	NA	NA
WP_024638690.1|5412549_5413437_+	EamA family transporter RarD	NA	NA	NA	NA	NA
WP_011269179.1|5413634_5414177_-	glycine cleavage system protein R	NA	NA	NA	NA	NA
WP_024638691.1|5414500_5416678_+	malate synthase G	NA	NA	NA	NA	NA
WP_003402175.1|5416743_5417190_-	response regulator	NA	A0A220YL79	Alteromonas_virus	29.6	2.2e-05
WP_024638692.1|5417414_5419349_+	CBS domain-containing protein	NA	NA	NA	NA	NA
WP_003402180.1|5419345_5420059_+	3'-5' exonuclease	NA	A0A1P8DIX6	Virus_Rctr197k	28.2	3.5e-05
WP_003316170.1|5420084_5420387_-	cell division protein ZapA	NA	NA	NA	NA	NA
WP_024638693.1|5420383_5420617_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011269183.1|5421028_5422654_+	methyl-accepting chemotaxis protein	NA	A0A2H4J162	uncultured_Caudovirales_phage	44.6	8.6e-68
WP_011269184.1|5423396_5423855_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_003402189.1|5423981_5425085_-	GlxA family transcriptional regulator	NA	NA	NA	NA	NA
WP_024640220.1|5425868_5426816_+|holin	choline ABC transporter substrate-binding protein	holin	NA	NA	NA	NA
WP_002555599.1|5426883_5427729_+|holin	choline ABC transporter permease subunit	holin	NA	NA	NA	NA
WP_011269186.1|5427725_5428904_+|holin	choline ABC transporter ATP-binding protein	holin	G3M9Y6	Bacillus_virus	36.4	2.9e-25
WP_024640219.1|5429162_5430416_+	serine hydroxymethyltransferase	NA	A0A240F3L3	Aeromonas_phage	54.0	7.0e-102
WP_024640218.1|5430433_5431684_+	sarcosine oxidase subunit beta family protein	NA	NA	NA	NA	NA
WP_003316160.1|5431699_5431996_+	sarcosine oxidase subunit delta	NA	NA	NA	NA	NA
WP_024640217.1|5431992_5435013_+	sarcosine oxidase subunit alpha	NA	NA	NA	NA	NA
WP_024640216.1|5435063_5435696_+	sarcosine oxidase subunit gamma family protein	NA	NA	NA	NA	NA
WP_003402204.1|5435901_5436759_+	formyltetrahydrofolate deformylase	NA	NA	NA	NA	NA
WP_024640215.1|5436867_5438067_+	formaldehyde dehydrogenase, glutathione-independent	NA	A0A2K9L7I1	Tupanvirus	27.7	2.2e-12
WP_080393617.1|5439554_5440529_-	RHS repeat-associated core domain-containing protein	NA	A0A1W5K0N1	Bacteriophage	41.8	8.1e-29
WP_024640212.1|5440638_5446464_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003402209.1|5446688_5447252_+	DUF2780 domain-containing protein	NA	NA	NA	NA	NA
WP_050586769.1|5447231_5448299_-	RHS repeat-associated core domain-containing protein	NA	B6SD27	Bacteriophage	38.3	1.5e-28
WP_003402215.1|5448349_5449243_-	acyltransferase	NA	NA	NA	NA	NA
WP_003402218.1|5449437_5449941_+|protease	ATP-dependent zinc protease	protease	NA	NA	NA	NA
>prophage 7
NZ_CP045799	Pseudomonas syringae USA011 chromosome, complete genome	6024796	5527334	5535693	6024796	transposase	Bacillus_phage(50.0%)	9	NA	NA
WP_003372639.1|5527334_5528525_+	methionine adenosyltransferase	NA	A0A2H4PQS6	Staphylococcus_phage	57.1	1.5e-117
WP_146052534.1|5528786_5528900_-	DUF1534 domain-containing protein	NA	NA	NA	NA	NA
WP_129450208.1|5528976_5529090_-	DUF1534 domain-containing protein	NA	NA	NA	NA	NA
WP_104722995.1|5529293_5530669_-|transposase	IS3 family transposase	transposase	A0A1B1P773	Bacillus_phage	52.8	1.9e-76
WP_024640554.1|5530931_5532617_+	NAD-dependent DNA ligase LigB	NA	A0A1Y0SVC9	Pseudomonas_phage	23.4	1.3e-26
WP_003405184.1|5532657_5533068_+	DUF1090 domain-containing protein	NA	NA	NA	NA	NA
WP_003405186.1|5533114_5533516_-	membrane protein	NA	A0A2H4J146	uncultured_Caudovirales_phage	74.0	8.4e-41
WP_003405188.1|5533630_5535022_-	heavy metal sensor histidine kinase	NA	W8CYF6	Bacillus_phage	29.1	6.8e-21
WP_003405189.1|5535018_5535693_-	heavy metal response regulator transcription factor	NA	W8CYM9	Bacillus_phage	38.9	2.1e-36
>prophage 8
NZ_CP045799	Pseudomonas syringae USA011 chromosome, complete genome	6024796	5689856	5742436	6024796	plate,protease,integrase	Paramecium_bursaria_Chlorella_virus(20.0%)	44	5687752:5687794	5712668:5712710
5687752:5687794	attL	TTGATTCTGGCCGAAGGCCGTAGGAGCGAACTTGTTCGCGAAG	NA	NA	NA	NA
WP_024640505.1|5689856_5691176_+|integrase	integrase arm-type DNA-binding domain-containing protein	integrase	A0A1B0VMI6	Pseudomonas_phage	38.8	1.4e-68
WP_024640504.1|5692106_5693087_+|integrase	integrase	integrase	NA	NA	NA	NA
WP_024640503.1|5693083_5693359_+	hypothetical protein	NA	NA	NA	NA	NA
WP_080393638.1|5693456_5694767_-	DUF4263 domain-containing protein	NA	NA	NA	NA	NA
WP_024640501.1|5695389_5697012_+	hypothetical protein	NA	NA	NA	NA	NA
WP_024640500.1|5697004_5697463_+	nucleoside 2-deoxyribosyltransferase	NA	A0A218KC29	Bacillus_phage	39.4	1.2e-11
WP_152981411.1|5697740_5699396_+	hypothetical protein	NA	NA	NA	NA	NA
WP_152981410.1|5699532_5700276_+	hypothetical protein	NA	NA	NA	NA	NA
WP_024640498.1|5700846_5701161_+	type II toxin-antitoxin system RelE/ParE family toxin	NA	A0A141GEX6	Brucella_phage	47.6	1.4e-14
WP_024640497.1|5701136_5701502_+	putative addiction module antidote protein	NA	NA	NA	NA	NA
WP_024640496.1|5701594_5702239_-	phosphoglycerate kinase	NA	NA	NA	NA	NA
WP_024640495.1|5702338_5702680_-	hypothetical protein	NA	NA	NA	NA	NA
WP_024640494.1|5702867_5703290_+	DUF1493 family protein	NA	NA	NA	NA	NA
WP_003342475.1|5703843_5704929_+	hypothetical protein	NA	A0A1S5SAB0	Streptococcus_phage	39.9	3.4e-68
WP_024640493.1|5705084_5705822_+	hypothetical protein	NA	NA	NA	NA	NA
WP_024640492.1|5705833_5706307_-	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_024640490.1|5707053_5707623_-	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_004407013.1|5707783_5708278_+	hypothetical protein	NA	NA	NA	NA	NA
WP_024640489.1|5708549_5709824_-	OprD family porin	NA	NA	NA	NA	NA
WP_004407009.1|5710469_5711576_-	agmatine deiminase	NA	A7IVE6	Paramecium_bursaria_Chlorella_virus	50.3	6.0e-105
WP_003372277.1|5711581_5712460_-	N-carbamoylputrescine amidase	NA	A7IVZ1	Paramecium_bursaria_Chlorella_virus	48.5	2.7e-76
WP_024640488.1|5712804_5715717_-	aminotransferase	NA	A0A1V0SKB7	Klosneuvirus	23.8	1.0e-18
5712668:5712710	attR	CTTCGCGAACAAGTTCGCTCCTACGGCCTTCGGCCAGAATCAA	NA	NA	NA	NA
WP_024640487.1|5715965_5717048_+	dTDP-glucose 4,6-dehydratase	NA	I7HTA3	Enterobacteria_phage	53.9	4.1e-98
WP_024640486.1|5717128_5717674_+	dTDP-4-dehydrorhamnose 3,5-epimerase	NA	A0A291LA62	Escherichia_phage	58.0	1.0e-52
WP_032607501.1|5717844_5719653_+	sensor histidine kinase	NA	NA	NA	NA	NA
WP_004406997.1|5719649_5721041_+	sigma-54-dependent Fis family transcriptional regulator	NA	NA	NA	NA	NA
WP_024640485.1|5721027_5721501_+	thioesterase	NA	NA	NA	NA	NA
WP_024640484.1|5722048_5722891_-	3'(2'),5'-bisphosphate nucleotidase CysQ	NA	NA	NA	NA	NA
WP_003372295.1|5722887_5723454_-	ADP compounds hydrolase NudE	NA	NA	NA	NA	NA
WP_003343604.1|5723551_5724214_+	GMP/IMP nucleotidase	NA	NA	NA	NA	NA
WP_004406991.1|5724258_5724699_-	peptidoglycan-binding protein LysM	NA	NA	NA	NA	NA
WP_024640483.1|5724848_5725730_+	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_024640482.1|5725833_5726670_+	formate dehydrogenase accessory sulfurtransferase FdhD	NA	NA	NA	NA	NA
WP_024640481.1|5726666_5729003_+	FdhF/YdeP family oxidoreductase	NA	NA	NA	NA	NA
WP_024640480.1|5729212_5729653_+	hypothetical protein	NA	NA	NA	NA	NA
WP_024640479.1|5729786_5731721_-	RecQ family ATP-dependent DNA helicase	NA	F2NZ48	Diadromus_pulchellus_ascovirus	40.2	4.9e-54
WP_024640478.1|5731867_5732689_+	hypothetical protein	NA	NA	NA	NA	NA
WP_024640476.1|5733318_5735490_-|protease	M48 family metalloprotease	protease	NA	NA	NA	NA
WP_003401916.1|5736190_5736940_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003318241.1|5737009_5737543_+	type VI secretion system contractile sheath small subunit	NA	NA	NA	NA	NA
WP_003343625.1|5737557_5739060_+	type VI secretion system contractile sheath large subunit	NA	NA	NA	NA	NA
WP_003318239.1|5739087_5739570_+|plate	type VI secretion system baseplate subunit TssE	plate	NA	NA	NA	NA
WP_003343627.1|5739569_5741402_+|plate	type VI secretion system baseplate subunit TssF	plate	NA	NA	NA	NA
WP_024640475.1|5741365_5742436_+|plate	type VI secretion system baseplate subunit TssG	plate	NA	NA	NA	NA
>prophage 1
NZ_CP045801	Pseudomonas syringae USA011 plasmid pUSA011-2, complete sequence	43372	8071	16239	43372	integrase	Burkholderia_phage(28.57%)	12	3787:3800	27322:27335
3787:3800	attL	TTCGATCAGGCGCT	NA	NA	NA	NA
WP_032611494.1|8071_9034_+|integrase	tyrosine-type recombinase/integrase	integrase	A0A166Y2G8	Gordonia_phage	34.1	3.3e-06
WP_024639835.1|9059_9380_-	hypothetical protein	NA	A0A2H4J9H6	uncultured_Caudovirales_phage	51.0	7.4e-16
WP_024639836.1|9789_10179_+	hypothetical protein	NA	NA	NA	NA	NA
WP_024639837.1|10226_10538_-	XRE family transcriptional regulator	NA	A0A0D5BHH6	Escherichia_phage	51.5	3.4e-21
WP_024639838.1|11127_11769_-	SOS response-associated peptidase	NA	C7BGE4	Burkholderia_phage	38.2	2.2e-35
WP_024639839.1|12006_12294_-	hypothetical protein	NA	NA	NA	NA	NA
WP_024639840.1|12283_12934_-	AAA family ATPase	NA	E5FFJ3	Burkholderia_phage	32.2	6.2e-17
WP_003348581.1|13046_13247_-	hypothetical protein	NA	NA	NA	NA	NA
WP_024639841.1|13584_13995_-	hypothetical protein	NA	NA	NA	NA	NA
WP_080393597.1|14088_14376_-	hypothetical protein	NA	NA	NA	NA	NA
WP_050586763.1|14537_15836_-	Y-family DNA polymerase	NA	I6RSM4	Salmonella_phage	46.9	2.0e-104
WP_024639843.1|15813_16239_-	peptidase S24	NA	A0A1W6JNS2	Morganella_phage	31.6	5.1e-12
27322:27335	attR	TTCGATCAGGCGCT	NA	NA	NA	NA
