The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
NC_022082	Klebsiella pneumoniae JM45, complete sequence	5273813	482268	565796	5273813	tRNA,integrase,terminase,protease,capsid,portal,tail,transposase,head	uncultured_Caudovirales_phage(54.55%)	78	499876:499893	515871:515888
WP_002919147.1|482268_483216_-|tRNA	methionyl-tRNA formyltransferase	tRNA	E3SNR5	Prochlorococcus_phage	37.2	2.2e-07
WP_002919144.1|483230_483740_-	peptide deformylase	NA	E3SLL2	Synechococcus_phage	40.3	2.6e-18
WP_002919139.1|483868_484993_+	DNA-protecting protein DprA	NA	NA	NA	NA	NA
WP_002919137.1|484964_485438_+	DUF494 domain-containing protein	NA	NA	NA	NA	NA
WP_004145330.1|485463_486006_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002919132.1|486010_486583_+	L-threonylcarbamoyladenylate synthase type 1 TsaC	NA	NA	NA	NA	NA
WP_002919126.1|486586_487405_+	shikimate dehydrogenase	NA	NA	NA	NA	NA
WP_002919125.1|487401_487659_+	DUF1488 domain-containing protein	NA	NA	NA	NA	NA
WP_002919123.1|487634_488189_-	gamma carbonic anhydrase family protein	NA	NA	NA	NA	NA
WP_002919103.1|493984_494206_-	membrane protein	NA	NA	NA	NA	NA
WP_002919102.1|494499_497610_-	multidrug efflux RND transporter permease subunit	NA	NA	NA	NA	NA
WP_002919101.1|497622_498762_-	efflux RND transporter periplasmic adaptor subunit	NA	NA	NA	NA	NA
WP_004150972.1|499140_499791_+	acrEF/envCD operon transcriptional regulator	NA	NA	NA	NA	NA
499876:499893	attL	GTATCAGTTCATGCCGTA	NA	NA	NA	NA
WP_004150971.1|500066_501293_+|integrase	site-specific integrase	integrase	A0A2H4JB45	uncultured_Caudovirales_phage	62.2	1.8e-150
WP_004150970.1|501385_502327_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001547839.1|502508_502793_+	AlpA family phage regulatory protein	NA	NA	NA	NA	NA
WP_004150969.1|502803_503583_+	hypothetical protein	NA	Q8HA02	Enterobacteria_phage	51.5	6.2e-40
WP_157263200.1|504085_504304_+	host cell division inhibitor Icd-like protein	NA	A0A2H4JGW3	uncultured_Caudovirales_phage	94.4	1.4e-34
WP_001549752.1|504296_504485_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004218267.1|504561_504690_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004150966.1|504788_505157_+	hypothetical protein	NA	A0A2H4JCX7	uncultured_Caudovirales_phage	81.1	3.7e-51
WP_001549749.1|505153_505519_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004150965.1|505518_507654_+	DUF927 domain-containing protein	NA	A0A1W6JPG0	Morganella_phage	62.4	3.4e-205
WP_004150964.1|507996_508332_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004150963.1|508380_508893_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001549743.1|509156_510323_+|capsid	phage major capsid protein	capsid	A0A2H4JED2	uncultured_Caudovirales_phage	95.9	9.8e-207
WP_001547826.1|510374_510935_+|head,protease	HK97 family phage prohead protease	head,protease	A0A2H4JB68	uncultured_Caudovirales_phage	95.7	1.2e-98
WP_004150962.1|510936_512178_+|portal	phage portal protein	portal	A0A2H4JFJ9	uncultured_Caudovirales_phage	96.5	1.0e-230
WP_004150961.1|512174_512510_+|head	phage head closure protein	head	A0A2H4JHK5	uncultured_Caudovirales_phage	57.8	3.7e-26
WP_001547824.1|512506_512806_+|head,tail	phage gp6-like head-tail connector protein	head,tail	A0A2H4JD08	uncultured_Caudovirales_phage	80.8	3.4e-39
WP_004150959.1|512805_513249_+	HNH endonuclease	NA	A0A2H4JAS8	uncultured_Caudovirales_phage	91.8	2.8e-77
WP_004150957.1|513241_513394_+	hypothetical protein	NA	A0A2H4JCY9	uncultured_Caudovirales_phage	88.0	2.4e-17
WP_000113647.1|513524_513881_+|terminase	phage terminase small subunit P27 family	terminase	A0A2H4JHS3	uncultured_Caudovirales_phage	99.2	5.5e-60
WP_004150955.1|513864_515526_+|terminase	terminase large subunit	terminase	A0A2H4JB64	uncultured_Caudovirales_phage	98.0	0.0e+00
WP_004150954.1|515528_515720_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000462905.1|515873_516170_-	DNA-binding transcriptional regulator Fis	NA	NA	NA	NA	NA
515871:515888	attR	GTATCAGTTCATGCCGTA	NA	NA	NA	NA
WP_004144972.1|516194_517160_-|tRNA	tRNA dihydrouridine synthase DusB	tRNA	NA	NA	NA	NA
WP_002918745.1|517517_518399_-	50S ribosomal protein L11 methyltransferase	NA	NA	NA	NA	NA
WP_002918740.1|519852_520095_-	YhdT family protein	NA	NA	NA	NA	NA
WP_002918738.1|520205_521555_-	acetyl-CoA carboxylase biotin carboxylase subunit	NA	NA	NA	NA	NA
WP_002918736.1|521565_522033_-	acetyl-CoA carboxylase biotin carboxyl carrier protein	NA	NA	NA	NA	NA
WP_002918732.1|522055_522508_-	type II 3-dehydroquinate dehydratase	NA	NA	NA	NA	NA
WP_002918689.1|522731_523340_-	protein-methionine-sulfoxide reductase heme-binding subunit MsrQ	NA	NA	NA	NA	NA
WP_022537156.1|523339_524371_-	protein-methionine-sulfoxide reductase catalytic subunit MsrP	NA	NA	NA	NA	NA
WP_002918687.1|524568_524760_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002918686.1|524839_526780_+	RNase E specificity factor CsrD	NA	NA	NA	NA	NA
WP_002918653.1|527085_528129_+	rod shape-determining protein MreB	NA	F2Y0P3	Organic_Lake_phycodnavirus	22.3	6.7e-05
WP_004149974.1|528199_529192_+	rod shape-determining protein MreC	NA	NA	NA	NA	NA
WP_002918648.1|529191_529680_+	rod shape-determining protein MreD	NA	NA	NA	NA	NA
WP_002918646.1|529687_530269_+	septum formation inhibitor Maf	NA	NA	NA	NA	NA
WP_002918644.1|530271_531741_+	ribonuclease G	NA	NA	NA	NA	NA
WP_004150952.1|531778_535576_+	AsmA2 domain-containing protein	NA	NA	NA	NA	NA
WP_002918642.1|535664_537110_+|protease	metalloprotease TldD	protease	NA	NA	NA	NA
WP_002918641.1|537145_538075_-	HTH-type transcriptional activator AaeR	NA	NA	NA	NA	NA
WP_002918640.1|538206_538410_+	AaeX family protein	NA	NA	NA	NA	NA
WP_002918639.1|538417_539350_+	p-hydroxybenzoic acid efflux pump subunit AaeA	NA	NA	NA	NA	NA
WP_085955245.1|540057_541250_-|transposase	IS3-like element ISKpn18 family transposase	transposase	U5P429	Shigella_phage	43.5	3.5e-50
WP_002918629.1|542708_542984_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002918627.1|543034_543301_-	peroxide/acid stress response protein YhcN	NA	NA	NA	NA	NA
WP_002918626.1|543399_543663_-	peroxide/acid stress response protein YhcN	NA	NA	NA	NA	NA
WP_002918625.1|544038_544509_-	transcriptional regulator ArgR	NA	NA	NA	NA	NA
WP_002918570.1|544923_545862_+	malate dehydrogenase	NA	NA	NA	NA	NA
WP_002918568.1|545998_547057_-	outer membrane-stress sensor serine endopeptidase DegS	NA	NA	NA	NA	NA
WP_002918566.1|547144_548512_-|protease	serine endoprotease DegQ	protease	A0A1B1IT49	uncultured_Mediterranean_phage	25.3	6.0e-22
WP_002918565.1|548685_549084_-	DUF1043 family protein	NA	NA	NA	NA	NA
WP_004144945.1|549274_550402_+	cell division protein ZapE	NA	NA	NA	NA	NA
WP_002918559.1|550667_551096_+	50S ribosomal protein L13	NA	NA	NA	NA	NA
WP_000829818.1|551111_551504_+	30S ribosomal protein S9	NA	NA	NA	NA	NA
WP_135801240.1|551561_551846_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002918467.1|551815_552454_+	stringent starvation protein A	NA	NA	NA	NA	NA
WP_002918465.1|552457_552952_+|protease	ClpXP protease specificity-enhancing factor	protease	A0A1S5R3H3	Pseudomonas_phage	54.8	1.5e-26
WP_002918463.1|553076_553781_+	N-acetylmannosamine-6-phosphate 2-epimerase	NA	NA	NA	NA	NA
WP_002918458.1|555264_559725_-	glutamate synthase large subunit	NA	NA	NA	NA	NA
WP_002918455.1|560398_561331_+	TIGR01212 family radical SAM protein	NA	A0A2H4PQV5	Staphylococcus_phage	33.8	3.4e-16
WP_002918453.1|561382_562666_-	MFS transporter	NA	NA	NA	NA	NA
WP_002918451.1|562751_563768_-	Zn-dependent oxidoreductase	NA	NA	NA	NA	NA
WP_004144931.1|563735_563900_+	hypothetical protein	NA	NA	NA	NA	NA
WP_085955245.1|564603_565796_-|transposase	IS3-like element ISKpn18 family transposase	transposase	U5P429	Shigella_phage	43.5	3.5e-50
>prophage 2
NC_022082	Klebsiella pneumoniae JM45, complete sequence	5273813	1274713	1320949	5273813	tRNA,integrase,terminase,capsid,lysis,portal,tail,head,coat,plate	Salmonella_phage(83.72%)	61	1273008:1273054	1309574:1309620
1273008:1273054	attL	TTTGGTGGAGCTGGCGGGAGTTGAACCCGCGTCCGAAATTCCTACAT	NA	NA	NA	NA
WP_004151020.1|1274713_1275739_-|integrase	site-specific integrase	integrase	A0A1S6L016	Salmonella_phage	93.8	1.5e-190
WP_004151019.1|1275741_1276371_-	phage repressor protein CI	NA	A0A1S6KZZ7	Salmonella_phage	54.5	1.4e-61
WP_001397669.1|1276493_1276736_+	hypothetical protein	NA	A0A1S6KZZ6	Salmonella_phage	98.8	4.0e-38
WP_004151018.1|1276768_1277278_+	phage regulatory CII family protein	NA	A0A1S6L008	Salmonella_phage	85.8	1.1e-77
WP_004151017.1|1277285_1277486_+	DUF2724 domain-containing protein	NA	A0A1S6L005	Salmonella_phage	68.8	4.5e-19
WP_004144796.1|1277449_1277788_+	DUF5347 domain-containing protein	NA	A0A218M4I7	Erwinia_phage	58.0	6.2e-29
WP_004151016.1|1277855_1278089_+	DUF2732 family protein	NA	A0A1S6L021	Salmonella_phage	90.9	6.0e-31
WP_004151014.1|1278088_1278316_+	TraR/DksA family transcriptional regulator	NA	A0A1S6L007	Salmonella_phage	92.0	5.1e-35
WP_004151013.1|1278312_1279164_+	DNA adenine methylase	NA	A0A1S6L011	Salmonella_phage	75.4	2.2e-115
WP_004151012.1|1279160_1281545_+	replication endonuclease	NA	A0A1S6L028	Salmonella_phage	87.9	0.0e+00
WP_004151011.1|1281707_1281896_+	hypothetical protein	NA	A0A1S6L006	Salmonella_phage	90.3	2.2e-23
WP_004151010.1|1281907_1282141_+	DinI family protein	NA	A0A0M4S6H1	Salmonella_phage	96.1	2.0e-34
WP_041937848.1|1282260_1282920_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004151008.1|1282906_1283986_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004151007.1|1283985_1284987_-	hypothetical protein	NA	NA	NA	NA	NA
WP_024940854.1|1285508_1285778_+	hypothetical protein	NA	D2IZW1	Enterococcus_phage	41.3	1.4e-15
WP_004151006.1|1285834_1286878_-|portal	phage portal protein	portal	A0A1S6KZW5	Salmonella_phage	85.6	3.1e-172
WP_019405037.1|1286877_1288641_-|terminase	terminase ATPase subunit family protein	terminase	A0A1S6KZW3	Salmonella_phage	91.8	0.0e+00
WP_004151004.1|1288781_1289615_+|capsid	GPO family capsid scaffolding protein	capsid	A0A1S6KZW9	Salmonella_phage	77.6	4.4e-100
WP_004151003.1|1289631_1290684_+|capsid	phage major capsid protein, P2 family	capsid	A0A1S6KZZ3	Salmonella_phage	91.0	6.8e-175
WP_004134644.1|1290687_1291341_+|terminase	terminase endonuclease subunit	terminase	A0A1S6KZX1	Salmonella_phage	80.0	1.9e-90
WP_004151002.1|1291436_1291901_+|head	head completion/stabilization protein	head	A0A1S6KZW8	Salmonella_phage	85.7	1.5e-73
WP_004151001.1|1291900_1292104_+|tail	tail protein X	tail	E5G6M9	Salmonella_phage	89.6	9.8e-30
WP_004134639.1|1292107_1292323_+	hypothetical protein	NA	E5G6N0	Salmonella_phage	88.7	6.1e-30
WP_004151000.1|1292303_1292813_+	lysozyme	NA	E5G6N1	Salmonella_phage	85.2	1.6e-81
WP_004150999.1|1292817_1293201_+	hypothetical protein	NA	A0A1S6KZZ2	Salmonella_phage	45.4	1.9e-18
WP_004150998.1|1293197_1293626_+|lysis	LysB family phage lysis regulatory protein	lysis	A0A1S6KZX8	Salmonella_phage	82.5	7.1e-54
WP_072093160.1|1293600_1293759_+	hypothetical protein	NA	A0A1S6KZX6	Salmonella_phage	75.0	9.0e-15
WP_004150997.1|1293721_1294144_+|tail	phage tail protein	tail	A0A1S6KZY0	Salmonella_phage	83.2	8.2e-63
WP_004150996.1|1294136_1294583_+	phage virion morphogenesis protein	NA	A0A1S6L001	Salmonella_phage	72.3	2.5e-54
WP_004150995.1|1294605_1295472_-	hypothetical protein	NA	NA	NA	NA	NA
WP_020956565.1|1295566_1296139_+|plate	phage baseplate assembly protein V	plate	E5G6N6	Salmonella_phage	70.3	1.5e-75
WP_004150993.1|1296135_1296498_+|plate	baseplate assembly protein	plate	A0A1S6KZZ4	Salmonella_phage	85.6	8.4e-48
WP_004150992.1|1296484_1297393_+|plate	baseplate assembly protein	plate	E5G6N8	Salmonella_phage	68.9	1.9e-109
WP_004152935.1|1297385_1298057_+|tail	phage tail protein I	tail	A0A1S6L000	Salmonella_phage	58.9	3.2e-61
WP_004150990.1|1298058_1300008_+|coat	spore coat protein CotH	coat	Q6QI97	Burkholderia_phage	38.9	1.0e-06
WP_004200602.1|1300017_1301136_+	hypothetical protein	NA	A0A248XD67	Klebsiella_phage	38.0	4.4e-55
WP_004150988.1|1301187_1302261_+|tail	phage tail protein	tail	A0A1S6KZZ8	Salmonella_phage	53.6	6.6e-40
WP_004150987.1|1302409_1303582_+|tail	phage tail sheath protein	tail	A0A1S6KZY7	Salmonella_phage	91.5	3.4e-207
WP_004150986.1|1303591_1304107_+|tail	phage major tail tube protein	tail	E5G6P8	Salmonella_phage	84.2	1.4e-80
WP_004150985.1|1304159_1304459_+|tail	phage tail assembly protein	tail	E5G6P9	Salmonella_phage	78.0	8.2e-33
WP_002896220.1|1304473_1304593_+|tail	GpE family phage tail protein	tail	E5G6Q0	Salmonella_phage	87.2	2.2e-13
WP_072093161.1|1304819_1307216_+|tail	phage tail tape measure protein	tail	E5FFG5	Burkholderia_phage	44.5	8.1e-107
WP_004150983.1|1307212_1307698_+|tail	phage tail protein	tail	E5G6Q2	Salmonella_phage	80.1	5.2e-61
WP_004150982.1|1307694_1308789_+	phage late control D family protein	NA	E5G6Q3	Salmonella_phage	83.6	2.4e-170
WP_004150981.1|1308855_1309074_+	positive regulator of late gene transcription	NA	Q53ZE7	Salmonella_virus	72.2	1.9e-26
WP_004150980.1|1309101_1309479_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002914164.1|1310082_1310565_-	SsrA-binding protein SmpB	NA	W5RAM5	Staphylococcus_phage	47.4	2.3e-29
1309574:1309620	attR	TTTGGTGGAGCTGGCGGGAGTTGAACCCGCGTCCGAAATTCCTACAT	NA	NA	NA	NA
WP_004188817.1|1310675_1311152_+	type II toxin-antitoxin system RatA family toxin	NA	NA	NA	NA	NA
WP_002914161.1|1311141_1311432_+	RnfH family protein	NA	NA	NA	NA	NA
WP_002914160.1|1311498_1311840_-	outer membrane protein assembly factor BamE	NA	NA	NA	NA	NA
WP_004145681.1|1311821_1311962_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002914159.1|1311987_1313649_-	DNA repair protein RecN	NA	NA	NA	NA	NA
WP_002914158.1|1313735_1314614_-	NAD(+) kinase	NA	NA	NA	NA	NA
WP_002914155.1|1314739_1315330_+	nucleotide exchange factor GrpE	NA	NA	NA	NA	NA
WP_004149392.1|1315449_1316736_-	HlyC/CorC family transporter	NA	NA	NA	NA	NA
WP_002914153.1|1316755_1317547_-	inner membrane protein YpjD	NA	NA	NA	NA	NA
WP_002914152.1|1317710_1319075_+	signal recognition particle protein	NA	NA	NA	NA	NA
WP_002914149.1|1319334_1319583_+	30S ribosomal protein S16	NA	NA	NA	NA	NA
WP_004150977.1|1319601_1320150_+	ribosome maturation factor RimM	NA	NA	NA	NA	NA
WP_002914147.1|1320181_1320949_+|tRNA	tRNA (guanosine(37)-N1)-methyltransferase TrmD	tRNA	NA	NA	NA	NA
>prophage 3
NC_022082	Klebsiella pneumoniae JM45, complete sequence	5273813	1759379	1766284	5273813	tRNA	Planktothrix_phage(33.33%)	6	NA	NA
WP_004180551.1|1759379_1760243_+	ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	27.5	5.7e-10
WP_004899467.1|1760253_1761027_+	ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	36.7	3.9e-26
WP_004151134.1|1761267_1762164_-	lipid kinase YegS	NA	A0A1V0SBJ0	Catovirus	29.8	6.1e-15
WP_004144192.1|1762406_1763768_-|tRNA	tRNA 5-hydroxyuridine modification protein YegQ	tRNA	Q6DW11	Phage_TP	94.8	1.8e-207
WP_004175198.1|1764086_1764809_-	two-component system response regulator BaeR	NA	W8CYM9	Bacillus_phage	33.2	8.3e-31
WP_019705218.1|1764805_1766284_-	two-component system sensor histidine kinase BaeS	NA	W8CYF6	Bacillus_phage	28.3	8.5e-30
>prophage 4
NC_022082	Klebsiella pneumoniae JM45, complete sequence	5273813	2758586	2768000	5273813		Escherichia_phage(87.5%)	9	NA	NA
WP_160463746.1|2758586_2760221_+	DUF4981 domain-containing protein	NA	L0N6M2	Herpes_simplex_virus	55.8	3.1e-182
WP_004151612.1|2760275_2761541_+	MFS transporter	NA	NA	NA	NA	NA
WP_001620097.1|2761571_2762660_-	AAA family ATPase	NA	A0A077SLJ9	Escherichia_phage	100.0	8.0e-211
WP_002904006.1|2762746_2763007_-	hypothetical protein	NA	A0A077SK33	Escherichia_phage	97.7	3.5e-40
WP_004176269.1|2763304_2764165_+	class A broad-spectrum beta-lactamase SHV-11	NA	A0A077SL40	Escherichia_phage	99.3	2.2e-155
WP_002210513.1|2764185_2764947_-	DeoR/GlpR transcriptional regulator	NA	A0A077SK06	Escherichia_phage	100.0	1.9e-134
WP_004151610.1|2765207_2766110_+	NAD(P)-dependent oxidoreductase	NA	A0A077SLF7	Escherichia_phage	99.3	7.7e-159
WP_004151609.1|2766121_2767387_+	four-carbon acid sugar kinase family protein	NA	A0A077SLJ7	Escherichia_phage	99.5	6.6e-233
WP_002210516.1|2767379_2768000_+	aldolase	NA	A0A077SK32	Escherichia_phage	100.0	8.0e-115
>prophage 5
NC_022082	Klebsiella pneumoniae JM45, complete sequence	5273813	2962565	3037312	5273813	integrase,terminase,tail,holin,plate	Klebsiella_phage(20.83%)	80	2986199:2986214	3041240:3041255
WP_002902268.1|2962565_2963651_-|plate	type VI secretion system baseplate subunit TssG	plate	NA	NA	NA	NA
WP_004151598.1|2963614_2965369_-|plate	type VI secretion system baseplate subunit TssF	plate	NA	NA	NA	NA
WP_004151599.1|2967041_2970467_-	type VI secretion protein VasK	NA	NA	NA	NA	NA
WP_002902254.1|2970450_2971590_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002902252.1|2971586_2971844_-	PAAR domain-containing protein	NA	NA	NA	NA	NA
WP_002902180.1|2974293_2974824_-	T6SS immunity phospholipase A1-binding lipoprotein Tli1-KP	NA	NA	NA	NA	NA
WP_002902172.1|2975489_2976020_-	T6SS immunity phospholipase A1-binding lipoprotein Tli1-KP	NA	NA	NA	NA	NA
WP_002902169.1|2976083_2976863_-	DUF4123 domain-containing protein	NA	NA	NA	NA	NA
WP_004228410.1|2976863_2979233_-	type VI secretion system tip protein VgrG	NA	A0A2H4JCD4	uncultured_Caudovirales_phage	33.8	9.1e-18
WP_002902163.1|2979234_2981889_-	type VI secretion system ATPase TssH	NA	K4FB40	Cronobacter_phage	33.4	2.5e-96
WP_002902160.1|2982153_2982645_-	Hcp family type VI secretion system effector	NA	NA	NA	NA	NA
WP_004151602.1|2982649_2984356_-	OmpA family protein	NA	NA	NA	NA	NA
WP_004151603.1|2984352_2985042_-	DotU family type IV/VI secretion system protein	NA	NA	NA	NA	NA
WP_004218490.1|2985038_2986382_-|plate	type VI secretion system baseplate subunit TssK	plate	NA	NA	NA	NA
2986199:2986214	attL	CCTGCAGGCGGCCCAG	NA	NA	NA	NA
WP_002902148.1|2986391_2987936_-	type VI secretion system contractile sheath large subunit	NA	NA	NA	NA	NA
WP_002902144.1|2987978_2988470_-	type VI secretion system contractile sheath small subunit	NA	NA	NA	NA	NA
WP_004230193.1|2988628_2988751_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002902136.1|2989315_2989564_+	DinI-like family protein	NA	S5MQI1	Escherichia_phage	70.4	1.4e-25
WP_002902133.1|2989786_2990071_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002902131.1|2990175_2990385_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002902128.1|2990381_2991113_-	hypothetical protein	NA	NA	NA	NA	NA
WP_020956789.1|2991123_2994072_-	hypothetical protein	NA	A0A286S1P0	Klebsiella_phage	68.3	4.1e-44
WP_004152652.1|2994148_2997217_-	hypothetical protein	NA	A0A286S259	Klebsiella_phage	97.5	0.0e+00
WP_004152651.1|2997213_2997594_-	hypothetical protein	NA	A0A286S2A6	Klebsiella_phage	99.2	1.8e-72
WP_004152650.1|2997603_2998086_-	DUF1833 family protein	NA	A0A286S2B1	Klebsiella_phage	94.4	1.7e-80
WP_004152649.1|2998266_2998731_-	hypothetical protein	NA	A0A286S298	Klebsiella_phage	67.8	6.7e-58
WP_004152648.1|2999045_2999381_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004217331.1|2999464_3002362_-|tail	tail protein	tail	A0A2H4J107	uncultured_Caudovirales_phage	32.7	1.6e-104
WP_099119318.1|3002623_3002815_-	hypothetical protein	NA	S4TR42	Salmonella_phage	78.3	7.8e-05
WP_004217333.1|3003039_3003396_-	hypothetical protein	NA	A0A1V0E5P9	Salmonella_phage	75.0	1.1e-44
WP_016831940.1|3003472_3003679_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004226994.1|3003816_3004299_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004217341.1|3004352_3005525_-	Ig domain-containing protein	NA	A0A0D4DBN5	Acinetobacter_phage	27.0	1.2e-23
WP_004190640.1|3005548_3005941_-	electron transfer flavoprotein subunit beta	NA	NA	NA	NA	NA
WP_004217343.1|3005937_3006489_-	hypothetical protein	NA	G8C7Q1	Escherichia_phage	39.9	1.3e-28
WP_004217344.1|3006490_3006874_-	hypothetical protein	NA	A0A0S2SYG4	Pseudomonas_phage	45.2	7.1e-21
WP_004190646.1|3006860_3007094_-	hypothetical protein	NA	A0A2H4J0Y9	uncultured_Caudovirales_phage	47.1	5.8e-10
WP_004217346.1|3007103_3007358_-	hypothetical protein	NA	J9Q7U0	Salmonella_phage	52.4	1.0e-20
WP_004217348.1|3007359_3007755_-	hypothetical protein	NA	A0A1B1P9F2	Acinetobacter_phage	38.5	4.3e-13
WP_142689607.1|3007795_3008068_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004190653.1|3008076_3009030_-	Ig domain-containing protein	NA	A0A1B0VMF8	Pseudomonas_phage	74.4	5.0e-132
WP_004217351.1|3009040_3009826_-	hypothetical protein	NA	A0A1B0VMG1	Pseudomonas_phage	63.9	1.0e-66
WP_019405022.1|3010356_3011469_-	hypothetical protein	NA	I6PD76	Cronobacter_phage	55.1	5.6e-111
WP_004218551.1|3011452_3012853_-	DUF4055 domain-containing protein	NA	A0A1B0VMH0	Pseudomonas_phage	53.5	1.1e-127
WP_004190663.1|3012852_3014160_-|terminase	terminase	terminase	A0A1B1P9C9	Acinetobacter_phage	58.9	3.6e-149
WP_004218556.1|3014137_3015142_-|terminase	terminase small subunit	terminase	Q5QF76	Pseudomonas_virus	45.5	1.5e-38
WP_004218558.1|3016004_3016250_-	DUF2560 family protein	NA	A0A286N2R1	Klebsiella_phage	96.3	4.6e-34
WP_004190672.1|3017208_3017484_-	hypothetical protein	NA	A0A286N2Q8	Klebsiella_phage	72.5	2.2e-08
WP_004190674.1|3017480_3017825_-	hypothetical protein	NA	A0A286N2Q7	Klebsiella_phage	80.7	2.0e-38
WP_004218565.1|3017821_3018361_-	glycoside hydrolase family 108 protein	NA	A0A286N2Q6	Klebsiella_phage	98.9	3.3e-101
WP_024940884.1|3018357_3018657_-|holin	holin	holin	A0A286N2Q5	Klebsiella_phage	100.0	4.5e-47
WP_004232548.1|3019306_3019996_-	antiterminator-like protein	NA	I6PDF8	Cronobacter_phage	53.1	2.1e-55
WP_004218534.1|3019995_3020136_-	YlcG family protein	NA	NA	NA	NA	NA
WP_004218533.1|3020132_3020771_-	hypothetical protein	NA	H6WRY9	Salmonella_phage	69.8	3.2e-74
WP_004218532.1|3020763_3021432_-	serine/threonine protein phosphatase	NA	K7P6H8	Enterobacteria_phage	78.7	1.4e-104
WP_004243010.1|3021428_3021596_-	NinE family protein	NA	K7P7K0	Enterobacteria_phage	62.5	4.6e-09
WP_004218531.1|3021576_3022044_-	recombination protein NinB	NA	Q8VNP6	Enterobacteria_phage	45.8	3.4e-33
WP_004243011.1|3022176_3022455_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004218530.1|3022564_3023593_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004196831.1|3023800_3024046_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004218528.1|3024101_3024404_-	MarR family transcriptional regulator	NA	NA	NA	NA	NA
WP_004201118.1|3024400_3025249_-	ATP-binding protein	NA	K7PLU3	Enterobacteria_phage	60.1	5.1e-88
WP_004201117.1|3025245_3026106_-	replication protein	NA	K7PGT1	Enterobacteria_phage	53.3	1.0e-59
WP_001548453.1|3026191_3026413_-	hypothetical protein	NA	G8EYH8	Enterobacteria_phage	41.7	6.9e-05
WP_004201115.1|3026453_3026681_-	helix-turn-helix domain-containing protein	NA	Q76H55	Enterobacteria_phage	77.1	1.4e-24
WP_004201113.1|3026792_3027491_+	helix-turn-helix transcriptional regulator	NA	Q76H56	Enterobacteria_phage	84.1	3.7e-108
WP_004201109.1|3027778_3028855_+	ParA family protein	NA	H2BD62	Pseudomonas_phage	37.9	9.1e-58
WP_004201108.1|3028936_3029140_-	hypothetical protein	NA	A0A192Y6Q5	Salmonella_phage	71.6	3.9e-18
WP_004219883.1|3029450_3029576_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004135674.1|3029568_3029763_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004201105.1|3029851_3030136_+	host nuclease inhibitor GamL	NA	G8C7T1	Escherichia_phage	79.8	1.1e-39
WP_004201103.1|3030151_3030997_+	phage recombination protein Bet	NA	A0A1I9KF88	Aeromonas_phage	59.2	1.8e-69
WP_088224434.1|3030993_3031281_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004201102.1|3031282_3031963_+	YqaJ viral recombinase family protein	NA	A0A0M3ULE0	Salmonella_phage	91.2	8.2e-121
WP_004151898.1|3031959_3032388_+	hypothetical protein	NA	M9NYX4	Enterobacteria_phage	80.3	7.5e-64
WP_004151899.1|3032384_3033047_+	DNA methyltransferase	NA	G8C7S6	Escherichia_phage	84.6	2.7e-105
WP_004151900.1|3033254_3034472_-|integrase	site-specific integrase	integrase	K7PGY1	Enterobacteria_phage	51.9	8.6e-121
WP_004151901.1|3034618_3035509_+	peptide ABC transporter permease SapC	NA	NA	NA	NA	NA
WP_004140266.1|3035508_3036501_+	peptide ABC transporter ATP-binding protein SapD	NA	G9BWD6	Planktothrix_phage	27.2	3.0e-07
WP_004140269.1|3036502_3037312_+	peptide ABC transporter ATP-binding protein SapF	NA	A0A2H4PQG7	Staphylococcus_phage	28.9	2.1e-14
3041240:3041255	attR	CCTGCAGGCGGCCCAG	NA	NA	NA	NA
>prophage 6
NC_022082	Klebsiella pneumoniae JM45, complete sequence	5273813	3413578	3506778	5273813	tRNA,integrase,terminase,protease,capsid,lysis,portal,tail,head,plate	Salmonella_phage(56.9%)	96	3469354:3469372	3506853:3506871
WP_002898139.1|3413578_3414871_-|tRNA	serine--tRNA ligase	tRNA	A0A1B1IVT2	uncultured_Mediterranean_phage	44.7	7.3e-94
WP_002898137.1|3414961_3416305_-	replication-associated recombination protein RarA	NA	G3MBE0	Bacillus_virus	40.8	7.3e-81
WP_002898132.1|3416313_3416925_-	outer membrane lipoprotein chaperone LolA	NA	NA	NA	NA	NA
WP_021197892.1|3417047_3419555_-	DNA translocase FtsK	NA	S5VNE3	Mycobacterium_phage	49.2	3.0e-88
WP_000228469.1|3421687_3422182_-	leucine-responsive transcriptional regulator Lrp	NA	NA	NA	NA	NA
WP_004147787.1|3422465_3422597_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002898019.1|3422714_3423683_+	thioredoxin-disulfide reductase	NA	A0A2I2L5E1	Orpheovirus	44.0	3.2e-62
WP_002898017.1|3423797_3425564_+	cysteine/glutathione ABC transporter permease/ATP-binding protein CydD	NA	W8CYL7	Bacillus_phage	25.9	2.3e-21
WP_004150847.1|3425564_3427286_+	cysteine/glutathione ABC transporter ATP-binding protein/permease CydC	NA	A0A2R8FG22	Brazilian_cedratvirus	34.3	1.5e-14
WP_004141853.1|3427312_3428032_+|tRNA	leucyl/phenylalanyl-tRNA--protein transferase	tRNA	NA	NA	NA	NA
WP_001040187.1|3428385_3428604_+	translation initiation factor IF-1	NA	NA	NA	NA	NA
WP_002896522.1|3428724_3431004_-|protease	ATP-dependent Clp protease ATP-binding subunit ClpA	protease	A0A223W0B1	Agrobacterium_phage	42.0	1.6e-165
WP_002896520.1|3431034_3431352_-|protease	ATP-dependent Clp protease adapter ClpS	protease	A0A1B1IT64	uncultured_Mediterranean_phage	45.7	2.0e-13
WP_002896516.1|3431677_3431899_+	cold shock-like protein CspD	NA	A0A2H4N7Y6	Lake_Baikal_phage	61.2	1.3e-16
WP_004150848.1|3431975_3433916_-	macrolide ABC transporter ATP-binding protein/permease MacB	NA	G9BWD6	Planktothrix_phage	40.5	1.9e-37
WP_002896440.1|3433912_3435028_-	macrolide transporter subunit MacA	NA	A0A140XAI1	Dickeya_phage	52.7	1.3e-06
WP_002896437.1|3435174_3436833_-	ATP-dependent endonuclease	NA	NA	NA	NA	NA
WP_002896434.1|3437252_3437948_+	aquaporin Z	NA	NA	NA	NA	NA
WP_041937875.1|3438056_3438962_+	lysine exporter LysO family protein	NA	NA	NA	NA	NA
WP_002896412.1|3439105_3440758_+	hydroxylamine reductase	NA	NA	NA	NA	NA
WP_002896410.1|3440768_3441737_+	NADH oxidoreductase	NA	NA	NA	NA	NA
WP_002896408.1|3441948_3442383_-	DoxX family protein	NA	NA	NA	NA	NA
WP_002896406.1|3442534_3444253_+	ubiquinone-dependent pyruvate dehydrogenase	NA	NA	NA	NA	NA
WP_002896404.1|3444291_3445293_+	low-specificity L-threonine aldolase	NA	NA	NA	NA	NA
WP_002896401.1|3445303_3446746_+	SDR family oxidoreductase	NA	NA	NA	NA	NA
WP_002896399.1|3446833_3447847_+	NAD(P)-dependent oxidoreductase	NA	NA	NA	NA	NA
WP_002896397.1|3447843_3448674_-	N-acetylmuramoyl-L-alanine amidase	NA	A0A1B0UZW5	Roseobacter_phage	31.6	4.1e-05
WP_004150851.1|3448705_3449845_-	GGDEF domain-containing protein	NA	NA	NA	NA	NA
WP_002896394.1|3450722_3451238_+	lipoprotein	NA	NA	NA	NA	NA
WP_002896392.1|3451464_3452193_+	arginine ABC transporter ATP-binding protein ArtP	NA	G9BWD6	Planktothrix_phage	37.1	1.2e-29
WP_002896390.1|3452213_3452945_+	arginine ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_002896386.1|3452951_3453668_+	arginine ABC transporter permease ArtQ	NA	NA	NA	NA	NA
WP_004150852.1|3453667_3454336_+	arginine ABC transporter permease ArtM	NA	NA	NA	NA	NA
WP_002896384.1|3454519_3455251_+	arginine ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_002896382.1|3455293_3456766_-	two-component sensor histidine kinase	NA	W8CYF6	Bacillus_phage	31.8	7.9e-28
WP_002896380.1|3456762_3457479_-	response regulator transcription factor	NA	W8CYM9	Bacillus_phage	36.9	2.1e-34
WP_002896378.1|3457557_3458685_-	23S rRNA (uracil(747)-C(5))-methyltransferase RlmC	NA	A0A2K5B251	Erysipelothrix_phage	25.6	1.3e-19
WP_002896376.1|3458726_3459215_-	DUF2593 family protein	NA	NA	NA	NA	NA
WP_002896372.1|3459272_3460118_-	putrescine ABC transporter permease PotI	NA	NA	NA	NA	NA
WP_002896371.1|3460114_3461068_-	putrescine ABC transporter permease PotH	NA	NA	NA	NA	NA
WP_004176719.1|3461078_3462245_-	putrescine ABC transporter ATP-binding subunit PotG	NA	G3M9Y6	Bacillus_virus	34.9	2.3e-30
WP_002896368.1|3462375_3463488_-	spermidine/putrescine ABC transporter substrate-binding protein PotF	NA	NA	NA	NA	NA
WP_002896365.1|3463836_3464316_-	YbjN domain-containing protein	NA	NA	NA	NA	NA
WP_002896363.1|3464404_3465307_-	30S ribosomal protein S6--L-glutamate ligase	NA	A0A1D7SR78	Cyanophage	35.3	2.0e-34
WP_002896354.1|3466128_3466416_-	YbjC family protein	NA	NA	NA	NA	NA
WP_002896352.1|3466618_3466882_+	GrxA family glutaredoxin	NA	A0A2I7SAE2	Vibrio_phage	73.1	1.6e-27
WP_002896351.1|3466888_3467272_-	membrane protein	NA	NA	NA	NA	NA
WP_004179131.1|3467538_3469224_+	aspartate:alanine antiporter	NA	NA	NA	NA	NA
WP_004226292.1|3469215_3469338_-	hypothetical protein	NA	NA	NA	NA	NA
3469354:3469372	attL	ATGGGTTTTTTGTTGCCTG	NA	NA	NA	NA
WP_000972391.1|3469443_3469662_-	transcriptional activator Ogr/delta	NA	Q53ZE7	Salmonella_virus	69.0	7.5e-20
WP_002896225.1|3469753_3470854_-	phage late control D family protein	NA	A0A1S6KZZ5	Salmonella_phage	87.4	4.9e-176
WP_002896224.1|3470850_3471336_-|tail	phage tail protein	tail	E5G6Q2	Salmonella_phage	75.6	7.2e-63
WP_014342962.1|3471332_3473726_-|tail	phage tail tape measure protein	tail	E5FFG5	Burkholderia_phage	44.0	1.1e-106
WP_002896220.1|3473952_3474072_-|tail	GpE family phage tail protein	tail	E5G6Q0	Salmonella_phage	87.2	2.2e-13
WP_002896204.1|3474086_3474386_-|tail	phage tail assembly protein	tail	E5G6P9	Salmonella_phage	79.0	3.7e-33
WP_002896201.1|3474438_3474954_-|tail	phage major tail tube protein	tail	E5G6P8	Salmonella_phage	85.4	1.3e-81
WP_002896193.1|3474963_3476136_-|tail	phage tail sheath protein	tail	A0A1S6KZY7	Salmonella_phage	93.3	1.9e-210
WP_002896191.1|3476274_3477351_-|tail	phage tail protein	tail	Q37842	Escherichia_phage	44.8	1.2e-25
WP_004232615.1|3477380_3477542_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002896186.1|3477580_3478312_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004152882.1|3478315_3481267_-	hypothetical protein	NA	A0A2H4N7A3	Pectobacterium_phage	50.9	1.2e-06
WP_004150856.1|3481268_3481868_-|tail	phage tail protein I	tail	A0A1S6L000	Salmonella_phage	60.5	1.3e-58
WP_002896182.1|3481860_3482769_-|plate	baseplate assembly protein	plate	E5G6N8	Salmonella_phage	66.9	7.6e-106
WP_002896179.1|3482755_3483118_-|plate	baseplate assembly protein	plate	A0A1S6KZZ4	Salmonella_phage	84.7	5.8e-49
WP_002896177.1|3483114_3483687_-|plate	phage baseplate assembly protein V	plate	E5G6N6	Salmonella_phage	72.3	4.7e-77
WP_004226282.1|3483801_3483966_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004199112.1|3483964_3484474_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002896175.1|3484470_3484917_-	phage virion morphogenesis protein	NA	A0A1S6L001	Salmonella_phage	71.2	2.2e-50
WP_002896172.1|3484909_3485341_-|tail	phage tail protein	tail	A0A1S6KZY0	Salmonella_phage	82.5	9.9e-64
WP_002896170.1|3485303_3485450_-	hypothetical protein	NA	A0A1S6KZX6	Salmonella_phage	76.1	6.0e-13
WP_002896168.1|3485436_3485865_-|lysis	LysB family phage lysis regulatory protein	lysis	A0A1S6KZX8	Salmonella_phage	77.9	9.6e-51
WP_002896163.1|3485861_3486245_-	hypothetical protein	NA	A0A1S6KZZ2	Salmonella_phage	42.0	2.1e-17
WP_002896161.1|3486249_3486759_-	lysozyme	NA	E5G6N1	Salmonella_phage	83.4	2.1e-81
WP_002896158.1|3486739_3486955_-	hypothetical protein	NA	E5G6N0	Salmonella_phage	90.1	3.6e-30
WP_002896155.1|3486958_3487162_-|tail	tail protein X	tail	A0A1S6KZY4	Salmonella_phage	88.1	1.3e-29
WP_002896151.1|3487161_3487626_-|head	head completion/stabilization protein	head	A0A1S6KZW8	Salmonella_phage	89.0	8.4e-77
WP_000059191.1|3487721_3488372_-|terminase	terminase endonuclease subunit	terminase	E5G6M7	Salmonella_phage	96.3	8.7e-112
WP_002895972.1|3488375_3489434_-|capsid	phage major capsid protein, P2 family	capsid	E5G6M6	Salmonella_phage	93.1	1.1e-180
WP_002895967.1|3489450_3490284_-|capsid	GPO family capsid scaffolding protein	capsid	A0A1S6KZW9	Salmonella_phage	88.8	6.3e-123
WP_004150858.1|3490426_3492193_+|terminase	terminase ATPase subunit family protein	terminase	A0A1S6KZW3	Salmonella_phage	99.0	0.0e+00
WP_002895959.1|3492192_3493218_+|portal	phage portal protein	portal	A0A1S6KZW5	Salmonella_phage	86.7	7.6e-171
WP_004199124.1|3493279_3495022_-	AIPR family protein	NA	NA	NA	NA	NA
WP_000700647.1|3495297_3495975_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001217575.1|3496089_3496323_-	DinI family protein	NA	E5G6M1	Salmonella_phage	100.0	4.7e-36
WP_001154434.1|3496333_3496522_-	hypothetical protein	NA	E5G6M0	Salmonella_phage	98.4	5.5e-27
WP_004150863.1|3499085_3499943_-	DNA adenine methylase	NA	E5G6L8	Salmonella_phage	95.4	2.0e-156
WP_000752622.1|3499939_3500167_-	TraR/DksA family transcriptional regulator	NA	E5G6L7	Salmonella_phage	98.7	6.0e-36
WP_004150864.1|3500166_3500400_-	DUF2732 family protein	NA	E5G6L6	Salmonella_phage	96.1	4.1e-32
WP_000963473.1|3500467_3500809_-	DUF5347 domain-containing protein	NA	E5G6L5	Salmonella_phage	99.1	4.6e-56
WP_000956179.1|3500772_3500973_-	DUF2724 domain-containing protein	NA	E5G6L4	Salmonella_phage	97.0	1.6e-32
WP_000460893.1|3500980_3501490_-	phage regulatory CII family protein	NA	E5G6L3	Salmonella_phage	98.8	5.8e-87
WP_000188448.1|3501522_3501744_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004152885.1|3501889_3502768_+	phage repressor protein CI	NA	A0A1S6KZZ7	Salmonella_phage	39.9	1.7e-30
WP_004150866.1|3502779_3503724_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004178082.1|3503822_3505310_-	group II intron reverse transcriptase/maturase	NA	A0A0U4J920	Pseudomonas_phage	35.5	1.2e-31
WP_014342959.1|3505797_3506778_+|integrase	tyrosine-type recombinase/integrase	integrase	A0A218M4I3	Erwinia_phage	57.2	1.4e-97
3506853:3506871	attR	ATGGGTTTTTTGTTGCCTG	NA	NA	NA	NA
>prophage 7
NC_022082	Klebsiella pneumoniae JM45, complete sequence	5273813	3951694	3992917	5273813	tRNA,integrase,capsid,terminase	Salmonella_phage(18.6%)	61	3945741:3945787	3989991:3990037
3945741:3945787	attL	AATGGCACGCCCTACAGGATTCGAACCTGTGACCTACGGCTTAGAAG	NA	NA	NA	NA
WP_020958142.1|3951694_3952927_-	hypothetical protein	NA	A0A077KGW9	Edwardsiella_phage	50.7	8.7e-105
WP_020958143.1|3952934_3953291_-	hypothetical protein	NA	NA	NA	NA	NA
WP_041937855.1|3953745_3954336_-	hypothetical protein	NA	A0A077KAY0	Edwardsiella_phage	35.3	1.2e-24
WP_020958145.1|3954325_3955195_-	hypothetical protein	NA	NA	NA	NA	NA
WP_019725008.1|3955191_3955497_-	hypothetical protein	NA	A0A077K9U4	Edwardsiella_phage	48.5	3.6e-20
WP_020958146.1|3955498_3956338_-	hypothetical protein	NA	A0A077KGW3	Edwardsiella_phage	31.4	5.9e-28
WP_020958147.1|3956341_3958300_-	lytic transglycosylase domain-containing protein	NA	A0A2H4J9N7	uncultured_Caudovirales_phage	38.4	4.4e-42
WP_020958148.1|3958280_3958427_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001518122.1|3958504_3958981_-	hypothetical protein	NA	A0A068CGG2	Acinetobacter_phage	29.8	5.5e-07
WP_001518123.1|3959060_3959618_-	rha family phage regulatory protein	NA	A0A088CBJ5	Shigella_phage	85.9	4.5e-85
WP_004196864.1|3959798_3960242_-	hypothetical protein	NA	NA	NA	NA	NA
WP_020958149.1|3960241_3961723_-	DUF3383 domain-containing protein	NA	Q2NPD0	Xanthomonas_phage	34.6	1.8e-59
WP_004196838.1|3961726_3962278_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004196845.1|3962259_3962628_-	hypothetical protein	NA	Q6UKE6	Burkholderia_virus	30.6	4.3e-07
WP_020958150.1|3962624_3963188_-	hypothetical protein	NA	A0A190XCA2	Acinetobacter_phage	35.6	7.0e-17
WP_041937856.1|3963190_3963634_-	DUF4054 domain-containing protein	NA	A0A1X9SF97	Acinetobacter_phage	38.2	1.1e-12
WP_009308036.1|3963960_3964998_-	DUF2184 domain-containing protein	NA	A0A219YBB0	Aeromonas_phage	50.3	6.5e-85
WP_004196856.1|3964997_3965480_-	hypothetical protein	NA	A0A219YBF2	Aeromonas_phage	51.0	3.5e-33
WP_077253382.1|3965481_3967299_-	DUF2213 domain-containing protein	NA	A0A219YCD3	Aeromonas_phage	37.5	1.1e-58
WP_014342909.1|3967362_3968052_-|capsid	minor capsid protein	capsid	H9C0V1	Aeromonas_phage	52.2	6.7e-62
WP_020958153.1|3968104_3969625_-	DUF1073 domain-containing protein	NA	A0A2R3UAL5	Myoviridae_environmental_samples	44.8	1.7e-105
WP_004196799.1|3969625_3971302_-|terminase	phage terminase large subunit	terminase	H9C191	Pectobacterium_phage	74.4	1.8e-249
WP_019725076.1|3971303_3971789_-	DUF2280 domain-containing protein	NA	H9C190	Pectobacterium_phage	79.5	4.1e-66
WP_020958154.1|3971820_3972396_-	hypothetical protein	NA	I6S676	Salmonella_phage	81.6	6.7e-92
WP_020958155.1|3972527_3972884_-	hypothetical protein	NA	NA	NA	NA	NA
WP_041937858.1|3973088_3973478_-	DUF2570 domain-containing protein	NA	A0A192Y6H8	Salmonella_phage	50.0	1.4e-24
WP_041937859.1|3973474_3973978_-	lysozyme	NA	M1FJA0	Enterobacteria_phage	80.8	5.5e-74
WP_004146347.1|3973980_3974295_-	hypothetical protein	NA	H6WRZ3	Salmonella_phage	86.1	6.3e-44
WP_041937860.1|3974933_3975713_-	antitermination protein	NA	Q76H66	Enterobacteria_phage	76.7	6.3e-101
WP_014342901.1|3975709_3975832_-	hypothetical protein	NA	NA	NA	NA	NA
WP_041937861.1|3975828_3976008_-	hypothetical protein	NA	NA	NA	NA	NA
WP_014342900.1|3976004_3976643_-	hypothetical protein	NA	H6WRY9	Salmonella_phage	69.3	1.4e-74
WP_023342724.1|3976635_3976806_-	hypothetical protein	NA	G8C7V4	Escherichia_phage	73.2	5.7e-15
WP_004151288.1|3976805_3977261_-	hypothetical protein	NA	K7P7B8	Enterobacteria_phage	69.5	8.0e-56
WP_014342899.1|3977761_3978715_-	DUF550 domain-containing protein	NA	S4TSR6	Salmonella_phage	42.8	2.5e-51
WP_041937862.1|3978711_3979230_-	hypothetical protein	NA	G9L6B3	Escherichia_phage	92.7	2.3e-91
WP_014342898.1|3979229_3979904_-	ead/Ea22-like family protein	NA	C6ZR30	Salmonella_phage	63.0	7.8e-07
WP_014342897.1|3979896_3980028_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004151294.1|3980141_3980648_-	hypothetical protein	NA	A0A0A6Z565	Enterobacter_phage	59.6	3.0e-27
WP_004151295.1|3980644_3980938_-	protein ren	NA	O48423	Enterobacteria_phage	65.6	3.3e-26
WP_004230547.1|3980937_3982353_-	AAA family ATPase	NA	Q9MCT4	Escherichia_phage	67.1	1.8e-183
WP_004230546.1|3982357_3983209_-	hypothetical protein	NA	F1C5C3	Cronobacter_phage	56.3	5.3e-85
WP_004151298.1|3983249_3983396_-	hypothetical protein	NA	NA	NA	NA	NA
WP_020958158.1|3983430_3983715_-	bacteriophage CII family protein	NA	K7PHN8	Enterobacterial_phage	57.4	8.1e-22
WP_004194000.1|3983754_3983982_-	Cro/Cl family transcriptional regulator	NA	A0A2I6PIE5	Escherichia_phage	61.2	1.9e-18
WP_041937863.1|3984050_3984773_+	helix-turn-helix transcriptional regulator	NA	E7C9R0	Salmonella_phage	63.2	9.4e-75
WP_039108792.1|3984973_3985321_+	hypothetical protein	NA	NA	NA	NA	NA
WP_014342895.1|3985359_3985482_+	hypothetical protein	NA	NA	NA	NA	NA
WP_014342894.1|3985880_3986006_+	hypothetical protein	NA	NA	NA	NA	NA
WP_071646962.1|3985998_3986205_+	cell division inhibitor protein	NA	A0A0M4S6W3	Salmonella_phage	94.1	3.1e-31
WP_041937865.1|3986282_3986480_+	hypothetical protein	NA	NA	NA	NA	NA
WP_020958161.1|3986476_3986635_+	hypothetical protein	NA	A0A1R3Y5R4	Salmonella_virus	57.8	1.0e-05
WP_009483856.1|3986631_3987285_+	single-stranded DNA-binding protein	NA	A0A1W6JP21	Morganella_phage	62.3	4.0e-64
WP_041937866.1|3987268_3987559_+	hypothetical protein	NA	NA	NA	NA	NA
WP_020958162.1|3987555_3987861_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_020958163.1|3987857_3988385_+	phage N-6-adenine-methyltransferase	NA	Q9ZWX6	Enterobacteria_phage	61.0	1.9e-56
WP_020958164.1|3988381_3988600_+	TraR/DksA family transcriptional regulator	NA	A0A0K2FI84	Escherichia_phage	53.6	5.2e-13
WP_004151317.1|3988601_3988937_+	excisionase family DNA-binding protein	NA	NA	NA	NA	NA
WP_004191604.1|3988813_3989977_+|integrase	site-specific integrase	integrase	G8C7S0	Escherichia_phage	87.1	5.0e-203
WP_004143016.1|3991273_3991486_+	ribosome-associated protein YbcJ	NA	NA	NA	NA	NA
3989991:3990037	attR	AATGGCACGCCCTACAGGATTCGAACCTGTGACCTACGGCTTAGAAG	NA	NA	NA	NA
WP_004143010.1|3991531_3992917_-|tRNA	cysteine--tRNA ligase	tRNA	M1PG92	Moumouvirus	35.4	3.5e-46
>prophage 8
NC_022082	Klebsiella pneumoniae JM45, complete sequence	5273813	4202472	4214125	5273813	integrase	Enterobacteria_phage(70.0%)	14	4202324:4202337	4206537:4206550
4202324:4202337	attL	TCTGACATATTTTT	NA	NA	NA	NA
WP_004144574.1|4202472_4203576_+	glutamate 5-kinase	NA	A0A1X9I5D0	Streptococcus_phage	40.5	4.8e-62
WP_002889940.1|4203586_4204840_+	glutamate-5-semialdehyde dehydrogenase	NA	A0A1X9I5D4	Streptococcus_phage	44.9	8.9e-89
WP_002889938.1|4205192_4206383_+|integrase	tyrosine-type recombinase/integrase	integrase	Q7M297	Enterobacteria_phage	62.7	6.4e-145
WP_004152029.1|4206370_4207321_+	AAA family ATPase	NA	A0A1X9IGI7	Lactococcus_phage	27.1	1.2e-13
4206537:4206550	attR	AAAAATATGTCAGA	NA	NA	NA	NA
WP_020802988.1|4208091_4208241_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002889930.1|4208313_4208880_-	phage polarity suppression protein	NA	Q7M2A1	Enterobacteria_phage	64.3	1.5e-59
WP_002889919.1|4208897_4209143_-	hypothetical protein	NA	Q7M294	Enterobacteria_phage	58.0	1.9e-19
WP_002889917.1|4209139_4209877_-	hypothetical protein	NA	Q7M2A2	Enterobacteria_phage	60.7	9.0e-73
WP_004903606.1|4210176_4210314_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002889915.1|4210418_4210685_+	AlpA family transcriptional regulator	NA	Q7M299	Enterobacteria_phage	71.6	2.6e-30
WP_072028197.1|4210687_4211239_+	ash family protein	NA	Q7M2A7	Enterobacteria_phage	70.4	1.8e-33
WP_004219964.1|4211283_4211463_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002889897.1|4211459_4211780_+	DUF5375 domain-containing protein	NA	NA	NA	NA	NA
WP_002889890.1|4211791_4214125_+	DNA primase	NA	Q7M2A8	Enterobacteria_phage	82.2	0.0e+00
>prophage 9
NC_022082	Klebsiella pneumoniae JM45, complete sequence	5273813	4682250	4688074	5273813		Enterobacteria_phage(100.0%)	8	NA	NA
WP_004152207.1|4682250_4684584_-	DNA primase	NA	Q7M2A8	Enterobacteria_phage	83.9	0.0e+00
WP_004152206.1|4684598_4684919_-	DUF5375 domain-containing protein	NA	NA	NA	NA	NA
WP_004152205.1|4684915_4685143_-	hypothetical protein	NA	NA	NA	NA	NA
WP_072093163.1|4685139_4685682_-	ash family protein	NA	Q7M2A7	Enterobacteria_phage	69.4	1.1e-30
WP_000556592.1|4685684_4685951_-	AlpA family transcriptional regulator	NA	Q7M299	Enterobacteria_phage	71.6	2.0e-30
WP_004152204.1|4686510_4687248_+	hypothetical protein	NA	Q7M2A2	Enterobacteria_phage	59.4	1.1e-70
WP_004152203.1|4687244_4687490_+	hypothetical protein	NA	Q7M294	Enterobacteria_phage	56.8	5.5e-19
WP_004152202.1|4687507_4688074_+	phage polarity suppression protein	NA	Q7M2A1	Enterobacteria_phage	63.8	9.7e-59
>prophage 1
NC_022078	Klebsiella pneumoniae JM45 plasmid p1, complete sequence	317154	11299	64340	317154	transposase,integrase	Escherichia_phage(23.81%)	49	38638:38670	64361:64393
WP_004118231.1|11299_11467_+|integrase	integrase	integrase	NA	NA	NA	NA
WP_004118840.1|11751_12879_+	transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_004118229.1|12875_13469_+	ANTAR domain-containing protein	NA	NA	NA	NA	NA
WP_004152279.1|13465_14314_+	ABC transporter permease	NA	NA	NA	NA	NA
WP_004118227.1|14313_15234_+	ABC transporter permease	NA	NA	NA	NA	NA
WP_004152278.1|15246_16851_+	ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_004118225.1|16895_17843_+	acetamidase/formamidase family protein	NA	A0A1V0S8X7	Catovirus	22.7	9.6e-11
WP_004118832.1|17850_19584_+	ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	29.6	6.9e-15
WP_004152557.1|23407_23755_-	IS66 family insertion sequence element accessory protein TnpB	NA	A0A0P0ZDM8	Stx2-converting_phage	95.7	2.0e-59
WP_020956879.1|23751_24138_-|transposase	transposase	transposase	B6DZU5	Stx2-converting_phage	90.7	1.1e-58
WP_004118217.1|24685_25321_-	His-Xaa-Ser repeat protein HxsA	NA	NA	NA	NA	NA
WP_000005560.1|25317_26430_-	His-Xaa-Ser system radical SAM maturase HxsC	NA	S5WIP3	Leptospira_phage	33.8	1.5e-47
WP_004118216.1|26422_27811_-	His-Xaa-Ser system radical SAM maturase HxsB	NA	S5VT21	Leptospira_phage	29.0	6.3e-51
WP_000333416.1|27810_28083_-	His-Xaa-Ser system protein HxsD	NA	NA	NA	NA	NA
WP_001166628.1|29759_30215_-	Hg(II)-responsive transcriptional regulator	NA	NA	NA	NA	NA
WP_001294656.1|30286_30652_+	mercuric ion transporter MerT	NA	NA	NA	NA	NA
WP_000732275.1|30667_30943_+	mercury resistance system periplasmic binding protein MerP	NA	NA	NA	NA	NA
WP_000522996.1|30970_31396_+	organomercurial transporter MerC	NA	NA	NA	NA	NA
WP_000209296.1|31434_33120_+	mercury(II) reductase	NA	A0A2K5B2C5	Erysipelothrix_phage	29.1	1.8e-39
WP_001277466.1|33137_33503_+	mercury resistance co-regulator MerD	NA	NA	NA	NA	NA
WP_001087807.1|33499_33736_+	broad-spectrum mercury transporter MerE	NA	NA	NA	NA	NA
WP_001446012.1|33719_33839_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000993245.1|33801_34014_+	DUF3330 domain-containing protein	NA	NA	NA	NA	NA
WP_010791757.1|34172_35855_+|integrase,transposase	DDE-type integrase/transposase/recombinase	integrase,transposase	M4T586	Rhodobacter_phage	24.7	3.7e-05
WP_000393453.1|35857_36766_+	AAA family ATPase	NA	NA	NA	NA	NA
WP_000801210.1|36762_37980_+	TniQ family protein	NA	NA	NA	NA	NA
38638:38670	attL	CGGCACTGTTGCAAAGTTAGCGATGAGGCAGCC	NA	NA	NA	NA
WP_000412211.1|39661_40321_+	type A-1 chloramphenicol O-acetyltransferase	NA	G3CFL0	Escherichia_phage	100.0	8.4e-131
WP_000656305.1|40521_40899_-	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_001138064.1|40965_43932_-|transposase	Tn3-like element TnAs3 family transposase	transposase	A0A1B0V7H9	Salmonella_phage	73.6	0.0e+00
WP_000147567.1|43934_44495_-	recombinase family protein	NA	A0A1B0V7I5	Salmonella_phage	86.2	4.0e-49
WP_000654802.1|46512_47481_-|transposase	IS5-like element IS903B family transposase	transposase	A0A1B0VFY5	Salmonella_phage	98.8	1.1e-184
WP_001039464.1|48061_48448_+	hypothetical protein	NA	NA	NA	NA	NA
WP_020956880.1|48587_49556_-|transposase	IS5 family transposase	transposase	A0A1B0VFY5	Salmonella_phage	96.0	1.9e-179
WP_072196731.1|51712_51838_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004178082.1|51830_53318_-	group II intron reverse transcriptase/maturase	NA	A0A0U4J920	Pseudomonas_phage	35.5	1.2e-31
WP_000776034.1|53723_54155_+	translesion error-prone DNA polymerase V autoproteolytic subunit	NA	A0A1W6JNS2	Morganella_phage	53.3	1.6e-29
WP_004118291.1|54154_55426_+	Y-family DNA polymerase	NA	F1C5A5	Cronobacter_phage	63.3	4.9e-151
WP_000064120.1|55507_56482_-	ParB/RepB/Spo0J family partition protein	NA	Q38420	Escherichia_phage	54.4	2.6e-88
WP_000368714.1|56481_57687_-	ParA family protein	NA	A0A077SL49	Escherichia_phage	69.6	2.4e-163
WP_000339857.1|58101_58371_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004118283.1|58547_59414_-	replication initiation protein	NA	A0A222YYK1	Escherichia_phage	31.1	1.5e-23
WP_032409716.1|59943_60048_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000764642.1|60176_60434_+	hypothetical protein	NA	NA	NA	NA	NA
WP_020956881.1|60491_61268_-|integrase	phage integrase family protein	integrase	I3WFA4	Macacine_betaherpesvirus	91.1	7.0e-52
WP_020956882.1|61279_61966_-	hypothetical protein	NA	NA	NA	NA	NA
WP_020956883.1|62029_62323_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001261276.1|62911_63142_+	AbrB/MazE/SpoVT family DNA-binding domain-containing protein	NA	NA	NA	NA	NA
WP_000754566.1|63138_63555_+	type II toxin-antitoxin system VapC family toxin	NA	NA	NA	NA	NA
WP_001067834.1|63635_64340_+|transposase	IS6-like element IS26 family transposase	transposase	A0A077SL39	Escherichia_phage	99.6	3.1e-139
64361:64393	attR	GGCTGCCTCATCGCTAACTTTGCAACAGTGCCG	NA	NA	NA	NA
>prophage 2
NC_022078	Klebsiella pneumoniae JM45 plasmid p1, complete sequence	317154	69198	76764	317154	integrase	Salmonella_phage(50.0%)	12	66372:66386	80456:80470
66372:66386	attL	GAACTTCTCGGCCGG	NA	NA	NA	NA
WP_000845039.1|69198_70212_-|integrase	class 1 integron integrase IntI1	integrase	A0A1P8DJJ6	Virus_Rctr41k	45.5	1.0e-71
WP_001083725.1|70356_70854_+	trimethoprim-resistant dihydrofolate reductase DfrA12	NA	A0A0A0PL85	Bacillus_phage	40.9	7.5e-23
WP_001336345.1|70965_71256_+	DUF1010 domain-containing protein	NA	NA	NA	NA	NA
WP_001206356.1|71261_72053_+	ANT(3'')-Ia family aminoglycoside nucleotidyltransferase AadA2	NA	NA	NA	NA	NA
WP_000679427.1|72216_72564_+	quaternary ammonium compound efflux SMR transporter QacE delta 1	NA	NA	NA	NA	NA
WP_000259031.1|72557_73397_+	sulfonamide-resistant dihydropteroate synthase Sul1	NA	A0A0B5J4J5	Pandoravirus	27.2	5.0e-11
WP_000376616.1|73524_73728_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000184001.1|73882_75088_+	chromate efflux transporter	NA	NA	NA	NA	NA
WP_000130000.1|75098_75404_+	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_001323888.1|75447_75615_-	hypothetical protein	NA	A0A1B0V7I9	Salmonella_phage	98.2	2.3e-24
WP_001161490.1|75603_76164_+	recombinase family protein	NA	A0A1B0V7I5	Salmonella_phage	100.0	1.1e-59
WP_015058874.1|76167_76764_+	DUF4158 domain-containing protein	NA	A0A1B0V7H9	Salmonella_phage	85.1	4.7e-64
80456:80470	attR	CCGGCCGAGAAGTTC	NA	NA	NA	NA
>prophage 3
NC_022078	Klebsiella pneumoniae JM45 plasmid p1, complete sequence	317154	111066	177511	317154	protease,transposase,integrase	Salmonella_phage(32.14%)	63	140114:140173	155130:155950
WP_013213984.1|111066_114072_-|transposase	Tn3 family transposase	transposase	Q1MVP5	Enterobacteria_phage	99.2	0.0e+00
WP_001217881.1|114234_114792_+	recombinase family protein	NA	Q1MVP4	Enterobacteria_phage	98.4	2.0e-93
WP_013213985.1|114914_115895_+|transposase	IS481-like element ISKpn27 family transposase	transposase	A8RHK4	Spiroplasma_virus	27.4	2.9e-10
WP_014343469.1|116007_116154_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004199234.1|116170_117052_+	carbapenem-hydrolyzing class A beta-lactamase KPC-2	NA	A0A1B0VBP7	Salmonella_phage	52.2	2.2e-73
WP_013213987.1|118286_118583_-	transcriptional regulator	NA	NA	NA	NA	NA
WP_013213988.1|118628_118784_-	hypothetical protein	NA	NA	NA	NA	NA
WP_013213989.1|118911_119337_-	antirestriction protein	NA	A0A2D0W8Z5	Bordetella_virus	37.3	5.3e-17
WP_013213990.1|119447_119726_-	hypothetical protein	NA	NA	NA	NA	NA
WP_014343470.1|119709_120105_-	hypothetical protein	NA	NA	NA	NA	NA
WP_014343471.1|120259_120820_-	replication protein	NA	NA	NA	NA	NA
WP_001323888.1|121112_121280_-	hypothetical protein	NA	A0A1B0V7I9	Salmonella_phage	98.2	2.3e-24
WP_001161490.1|121268_121829_+	recombinase family protein	NA	A0A1B0V7I5	Salmonella_phage	100.0	1.1e-59
WP_001138014.1|121832_124799_+|transposase	Tn3-like element TnAs1 family transposase	transposase	A0A1B0V7H9	Salmonella_phage	100.0	0.0e+00
WP_004193160.1|126054_126273_-	hypothetical protein	NA	NA	NA	NA	NA
WP_020956916.1|126465_127434_-|transposase	IS5-like element IS903B family transposase	transposase	A0A1B0VFY5	Salmonella_phage	99.1	3.0e-185
WP_012579082.1|127468_128344_-	class A extended-spectrum beta-lactamase CTX-M-24	NA	A0A1B0VBP7	Salmonella_phage	99.3	2.3e-152
WP_014342101.1|128323_128446_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000608644.1|128593_129856_-|transposase	IS1380-like element ISEc9 family transposase	transposase	A0A1B0VDR3	Salmonella_phage	100.0	1.3e-39
WP_000427614.1|131391_132396_-|transposase	IS110-like element IS5075 family transposase	transposase	NA	NA	NA	NA
WP_003100881.1|132474_135441_-|transposase	Tn3-like element ISPa38 family transposase	transposase	A0A1B0V7H9	Salmonella_phage	73.2	0.0e+00
WP_001247892.1|135515_135806_+	nucleotidyltransferase	NA	NA	NA	NA	NA
WP_001293886.1|135802_136204_+	DUF86 domain-containing protein	NA	NA	NA	NA	NA
WP_000215515.1|136193_136550_+	cupin domain-containing protein	NA	NA	NA	NA	NA
WP_000091613.1|136804_137119_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000792636.1|137291_137825_-	phospholipase D family protein	NA	A0A1B2LRT6	Wolbachia_phage	33.9	5.8e-21
WP_012561144.1|137824_138820_-	Flp pilus assembly complex ATPase component TadA	NA	NA	NA	NA	NA
WP_012561145.1|138861_140022_-	TrbI/VirB10 family protein	NA	NA	NA	NA	NA
WP_162471274.1|140021_140201_-	hypothetical protein	NA	NA	NA	NA	NA
140114:140173	attL	GGGCACTGTTGCAAATAGTCGGTGGTGATAAACTTATCATCCCCTTTTGCTGATGGAGCT	NA	NA	NA	NA
WP_001067855.1|140177_140882_+|transposase	IS6-like element IS26 family transposase	transposase	A0A077SL39	Escherichia_phage	100.0	1.8e-139
WP_001425784.1|140933_141410_+	recombinase family protein	NA	Q1MVP4	Enterobacteria_phage	99.4	9.2e-79
WP_000027057.1|141592_142453_+	class A broad-spectrum beta-lactamase TEM-1	NA	Q1MVP3	Enterobacteria_phage	100.0	4.6e-161
WP_012372818.1|142622_143378_+	16S rRNA (guanine(1405)-N(7))-methyltransferase RmtB1	NA	NA	NA	NA	NA
WP_014342204.1|143458_144007_-	Na+/H+ antiporter	NA	NA	NA	NA	NA
WP_014342205.1|144042_144420_+	molecular chaperone GroEL	NA	A0A2I7SAK5	Vibrio_phage	58.1	8.2e-22
WP_012372820.1|144646_146179_+|transposase	IS91 family transposase	transposase	NA	NA	NA	NA
WP_001253717.1|146270_147062_-	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_001257840.1|147082_148258_-	tetracycline efflux MFS transporter Tet(G)	NA	NA	NA	NA	NA
WP_000163574.1|148361_148988_+	tetracycline resistance transcriptional repressor TetR(G)	NA	NA	NA	NA	NA
WP_001747812.1|148984_149167_-	DUF3363 domain-containing protein	NA	NA	NA	NA	NA
WP_000214125.1|149194_150409_-	chloramphenicol/florfenicol efflux MFS transporter FloR2	NA	S4TR35	Salmonella_phage	23.7	9.8e-16
WP_000259026.1|150625_151597_-	dihydropteroate synthase	NA	NA	NA	NA	NA
WP_071827503.1|152012_152624_+|integrase	tyrosine-type recombinase/integrase	integrase	A0A1P8DJJ6	Virus_Rctr41k	34.8	2.2e-24
WP_020956917.1|152734_153634_+	class A extended-spectrum beta-lactamase VEB-3	NA	NA	NA	NA	NA
WP_001067855.1|154420_155125_-|transposase	IS6-like element IS26 family transposase	transposase	A0A077SL39	Escherichia_phage	100.0	1.8e-139
WP_000018329.1|155275_156091_+	aminoglycoside O-phosphotransferase APH(3')-Ia	NA	A0A193DTG4	Autographa_californica_nuclear_polyhedrosis_virus	100.0	6.1e-163
155130:155950	attR	AGCTCCATCAGCAAAAGGGGATGATAAGTTTATCACCACCGACTATTTGCAACAGTGCCCTCTGATGTTACATTGCACAAGATAAAAATATATCATCATGAACAATAAAACTGTCTGCTTACATAAACAGTAATACAAGGGGTGTTATGAGCCATATTCAACGGGAAACGTCTTGCTCGAGGCCGCGATTAAATTCCAACATGGATGCTGATTTATATGGGTATAAATGGGCTCGCGATAATGTCGGGCAATCAGGTGCGACAATCTATCGATTGTATGGGAAGCCCGATGCGCCAGAGTTGTTTCTGAAACATGGCAAAGGTAGCGTTGCCAATGATGTTACAGATGAGATGGTCAGACTAAACTGGCTGACGGAATTTATGCCTCTTCCGACCATCAAGCATTTTATCCGTACTCCTGATGATGCATGGTTACTCACCACTGCGATCCCCGGGAAAACAGCATTCCAGGTATTAGAAGAATATCCTGATTCAGGTGAAAATATTGTTGATGCGCTGGCAGTGTTCCTGCGCCGGTTGCATTCGATTCCTGTTTGTAATTGTCCTTTTAACAGCGATCGCGTATTTCGTCTCGCTCAGGCGCAATCACGAATGAATAACGGTTTGGTTGATGCGAGTGATTTTGATGACGAGCGTAATGGCTGGCCTGTTGAACAAGTCTGGAAAGAAATGCATAAGCTTTTGCCATTCTCACCGGATTCAGTCGTCACTCATGGTGATTTCTCACTTGATAACCTTATTTTTGACGAGGGGAAATTAATAGGTTGTATTGATGTTGGACGAGTCGGAATCGCAGACCGA	NA	NA	NA	NA
WP_044117068.1|156280_156949_-|transposase	IS6 family transposase	transposase	A0A077SL39	Escherichia_phage	99.5	1.9e-130
WP_001067855.1|158252_158957_+|transposase	IS6-like element IS26 family transposase	transposase	A0A077SL39	Escherichia_phage	100.0	1.8e-139
WP_004152692.1|159578_160448_-	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_004152693.1|160441_161452_-	phosphonate dehydrogenase PtxD	NA	A0A1V0SBV6	Catovirus	25.1	1.4e-15
WP_004152694.1|161460_162288_-	phosphonate ABC transporter, permease protein PhnE	NA	NA	NA	NA	NA
WP_004152695.1|162296_163160_-	phosphate/phosphite/phosphonate ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_004153729.1|163156_163984_-	phosphonate ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	37.6	2.6e-20
WP_000019473.1|165426_166407_-|transposase	IS5-like element ISKpn26 family transposase	transposase	Q38213	Escherichia_phage	99.1	8.9e-185
WP_004118209.1|167608_167872_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_004118208.1|167886_168150_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004152118.1|168393_168675_+	helix-turn-helix domain-containing protein	NA	A0A1B1IUF9	uncultured_Mediterranean_phage	38.2	5.2e-05
WP_004152117.1|168709_169279_+	small heat shock protein sHSP20	NA	NA	NA	NA	NA
WP_004152116.1|169393_172189_+	heat shock survival AAA family ATPase ClpK	NA	K4FB40	Cronobacter_phage	41.0	5.2e-129
WP_004152115.1|172188_172386_+	hypothetical protein	NA	NA	NA	NA	NA
WP_009483782.1|172623_173373_+	diguanylate cyclase	NA	NA	NA	NA	NA
WP_004152113.1|173359_174322_+|protease	M48 family metalloprotease	protease	NA	NA	NA	NA
WP_020314316.1|176164_177511_-|transposase	ISNCY family transposase	transposase	NA	NA	NA	NA
