The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
NC_021877	Burkholderia pseudomallei MSHR305 chromosome 2, complete sequence	3373917	259712	331228	3373917	plate,holin	Vibrio_phage(25.0%)	53	NA	NA
WP_004525541.1|259712_260480_-|holin	phosphocholine cytidylyltransferase family protein	holin	NA	NA	NA	NA
WP_004542630.1|260518_261520_-	HpnL family protein	NA	NA	NA	NA	NA
WP_004542606.1|261516_262290_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004188272.1|262286_262976_-	CDP-alcohol phosphatidyltransferase family protein	NA	NA	NA	NA	NA
WP_004188420.1|263341_264856_+	acetyl-CoA hydrolase/transferase family protein	NA	NA	NA	NA	NA
WP_004525545.1|266565_267504_+	type VI secretion system ImpA family N-terminal domain-containing protein	NA	NA	NA	NA	NA
WP_004202234.1|267537_268086_+	type VI secretion system contractile sheath small subunit	NA	NA	NA	NA	NA
WP_004190846.1|268088_269594_+	type VI secretion system contractile sheath large subunit	NA	NA	NA	NA	NA
WP_004530039.1|269737_270265_+	type VI secretion system tube protein Hcp	NA	NA	NA	NA	NA
WP_004190879.1|270344_270776_+	GPW/gp25 family protein	NA	NA	NA	NA	NA
WP_004196180.1|270789_272652_+|plate	type VI secretion system baseplate subunit TssF	plate	NA	NA	NA	NA
WP_004190851.1|272648_273638_+|plate	type VI secretion system baseplate subunit TssG	plate	NA	NA	NA	NA
WP_004525547.1|273640_276511_+	type VI secretion system ATPase TssH	NA	A0A2I7REQ1	Vibrio_phage	27.2	2.4e-60
WP_004525548.1|276501_278793_+	type VI secretion system tip protein VgrG	NA	NA	NA	NA	NA
WP_004190563.1|278958_281247_+	type VI secretion system tip protein VgrG	NA	NA	NA	NA	NA
WP_004542632.1|281250_283467_+	pentapeptide repeat-containing protein	NA	NA	NA	NA	NA
WP_004525550.1|283466_284537_+	pentapeptide repeat-containing protein	NA	NA	NA	NA	NA
WP_004530790.1|284539_285256_+	DUF3540 domain-containing protein	NA	NA	NA	NA	NA
WP_004190606.1|285298_285688_+	DUF4150 domain-containing protein	NA	NA	NA	NA	NA
WP_004202226.1|285693_286287_+	type VI secretion lipoprotein TssJ	NA	NA	NA	NA	NA
WP_020850152.1|286283_287645_+|plate	type VI secretion system baseplate subunit TssK	plate	NA	NA	NA	NA
WP_004525553.1|287727_289386_+	DotU family type IV/VI secretion system protein	NA	NA	NA	NA	NA
WP_004525554.1|289382_292886_+	type VI secretion system membrane subunit TssM	NA	NA	NA	NA	NA
WP_004190863.1|292944_293304_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004190471.1|293326_293752_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004536812.1|294072_294348_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004524288.1|294898_295798_+	alpha/beta hydrolase	NA	NA	NA	NA	NA
WP_004542286.1|295839_296130_-	hypothetical protein	NA	NA	NA	NA	NA
WP_020850390.1|296019_297339_+	glycosyltransferase	NA	NA	NA	NA	NA
WP_004542407.1|297335_298919_+	DHA2 family efflux MFS transporter permease subunit	NA	NA	NA	NA	NA
WP_020850268.1|299207_300203_+	glycosyltransferase family 2 protein	NA	NA	NA	NA	NA
WP_004528656.1|300498_302082_+	efflux transporter outer membrane subunit	NA	NA	NA	NA	NA
WP_004186853.1|302574_303828_+	efflux RND transporter periplasmic adaptor subunit	NA	NA	NA	NA	NA
WP_004543122.1|304360_306025_-	glycoside hydrolase family 32 protein	NA	F8WPR5	Bacillus_phage	31.6	9.2e-57
WP_004186967.1|306157_307642_-	glycoside hydrolase family 68 protein	NA	NA	NA	NA	NA
WP_004530800.1|307911_308928_+	substrate-binding domain-containing protein	NA	NA	NA	NA	NA
WP_004523135.1|309381_310581_+	formaldehyde dehydrogenase, glutathione-independent	NA	A0A2K9L7I1	Tupanvirus	27.2	8.4e-12
WP_004198247.1|310758_311784_-	GlxA family transcriptional regulator	NA	NA	NA	NA	NA
WP_004543129.1|312218_313493_+	serine hydroxymethyltransferase	NA	A0A219Y950	Aeromonas_phage	54.1	9.0e-105
WP_004186989.1|313565_314537_+	membrane dipeptidase	NA	NA	NA	NA	NA
WP_004186987.1|314687_315221_+	4-vinyl reductase	NA	NA	NA	NA	NA
WP_004523137.1|315281_317345_+	NADH:flavin oxidoreductase	NA	NA	NA	NA	NA
WP_004186901.1|317347_319273_+	(Fe-S)-binding protein	NA	NA	NA	NA	NA
WP_004202150.1|319277_320450_+	electron transfer flavoprotein subunit alpha/FixB family protein	NA	NA	NA	NA	NA
WP_004530055.1|320446_321232_+	drug:proton antiporter	NA	NA	NA	NA	NA
WP_004543128.1|321256_322525_+	aromatic ring-hydroxylating dioxygenase subunit alpha	NA	NA	NA	NA	NA
WP_004543120.1|322545_323691_+	hybrid-cluster NAD(P)-dependent oxidoreductase	NA	NA	NA	NA	NA
WP_004186918.1|323800_324664_+	glycine betaine ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_004530057.1|324844_326500_+	APC family permease	NA	NA	NA	NA	NA
WP_004186920.1|326586_327462_-	formyltetrahydrofolate deformylase	NA	NA	NA	NA	NA
WP_021252052.1|327605_328478_-	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_004543140.1|328640_330194_+|holin	choline-sulfatase	holin	NA	NA	NA	NA
WP_041188444.1|330190_331228_+|holin	choline ABC transporter substrate-binding protein	holin	NA	NA	NA	NA
>prophage 2
NC_021877	Burkholderia pseudomallei MSHR305 chromosome 2, complete sequence	3373917	1065273	1072034	3373917		Burkholderia_virus(50.0%)	8	NA	NA
WP_006027262.1|1065273_1065570_+	type II toxin-antitoxin system RelE/ParE family toxin	NA	A4JWV2	Burkholderia_virus	99.0	5.6e-50
WP_004202809.1|1065572_1065929_+	putative addiction module antidote protein	NA	A4JWV1	Burkholderia_virus	100.0	3.9e-42
WP_004542845.1|1065972_1066122_-	hypothetical protein	NA	A4JWV0	Burkholderia_virus	96.3	9.1e-09
WP_020850286.1|1067118_1067601_-	DUF2778 domain-containing protein	NA	NA	NA	NA	NA
WP_041188525.1|1067670_1068570_-	hypothetical protein	NA	A0JC16	Ralstonia_phage	39.1	6.3e-36
WP_020850011.1|1069071_1069656_-	hypothetical protein	NA	A0A0K2QQ53	Ralstonia_phage	53.1	2.5e-09
WP_020850148.1|1069755_1071132_-	type II/III secretion system protein	NA	NA	NA	NA	NA
WP_020850003.1|1071128_1072034_-	AAA family ATPase	NA	Q6UAZ2	Ralstonia_phage	37.2	1.1e-27
>prophage 3
NC_021877	Burkholderia pseudomallei MSHR305 chromosome 2, complete sequence	3373917	2049365	2131656	3373917	portal,transposase,protease,tRNA	Leptospira_phage(18.18%)	44	NA	NA
WP_004540193.1|2049365_2050343_+|transposase	IS110 family transposase	transposase	NA	NA	NA	NA
WP_024430891.1|2050485_2051730_-	alginate lyase family protein	NA	NA	NA	NA	NA
WP_152641030.1|2051728_2052169_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_085966798.1|2054009_2055109_-|transposase	IS3 family transposase	transposase	S5WIU1	Leptospira_phage	37.3	9.1e-37
WP_144084137.1|2058239_2058644_-	hypothetical protein	NA	NA	NA	NA	NA
WP_071898245.1|2058591_2059101_-	AAA family ATPase	NA	NA	NA	NA	NA
WP_024429309.1|2060823_2062053_-	DUF3443 family protein	NA	NA	NA	NA	NA
WP_020850102.1|2062079_2062559_-	DUF2844 domain-containing protein	NA	NA	NA	NA	NA
WP_124518502.1|2064778_2064880_-	IS66 family insertion sequence hypothetical protein	NA	NA	NA	NA	NA
WP_004540565.1|2064910_2065129_-	IS66 family insertion sequence element accessory protein TnpB	NA	NA	NA	NA	NA
WP_004540443.1|2065576_2066290_-	response regulator transcription factor	NA	NA	NA	NA	NA
WP_071898247.1|2068481_2068982_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004540369.1|2070099_2071521_-	Do family serine endopeptidase	NA	A0A1B1IT49	uncultured_Mediterranean_phage	28.5	1.5e-20
WP_004540191.1|2071860_2072703_-	peptidyl-prolyl cis-trans isomerase	NA	NA	NA	NA	NA
WP_004540242.1|2072773_2073553_-	SapC family protein	NA	NA	NA	NA	NA
WP_124518497.1|2073562_2075893_-	hypothetical protein	NA	NA	NA	NA	NA
WP_020849944.1|2076017_2092313_-	putative bpaA	NA	NA	NA	NA	NA
WP_043944145.1|2092602_2092959_-	H-NS histone family protein	NA	NA	NA	NA	NA
WP_085966799.1|2094426_2095525_+|transposase	IS3 family transposase	transposase	S5WIU1	Leptospira_phage	43.0	3.3e-55
WP_080002865.1|2095658_2096270_-	MepB family protein	NA	NA	NA	NA	NA
WP_020849899.1|2097516_2098779_-	group II intron reverse transcriptase/maturase	NA	A0A0U4J920	Pseudomonas_phage	31.7	3.1e-33
WP_004190933.1|2102900_2104943_-	RNA polymerase sigma factor RpoD	NA	A0A2I7SAT0	Vibrio_phage	32.0	4.2e-35
WP_004540553.1|2105001_2105340_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004190679.1|2105386_2107261_-	DNA primase	NA	A0A0K1LMQ9	Caulobacter_phage	36.2	4.9e-67
WP_004190948.1|2107355_2107802_-	GatB/YqeY domain-containing protein	NA	A0A292GL36	Xanthomonas_phage	48.6	8.8e-23
WP_004190342.1|2107968_2108181_-	30S ribosomal protein S21	NA	NA	NA	NA	NA
WP_004540586.1|2108260_2109484_-	NAD(P)/FAD-dependent oxidoreductase	NA	NA	NA	NA	NA
WP_011204325.1|2109629_2110670_+|tRNA	tRNA (adenosine(37)-N6)-threonylcarbamoyltransferase complex transferase subunit TsaD	tRNA	A0A0R6PI74	Moraxella_phage	53.1	1.7e-93
WP_004195713.1|2111066_2111876_-	GTP cyclohydrolase I FolE2	NA	NA	NA	NA	NA
WP_004540286.1|2112026_2113931_-	1-deoxy-D-xylulose-5-phosphate synthase	NA	NA	NA	NA	NA
WP_004525142.1|2114014_2114899_-	(2E,6E)-farnesyl diphosphate synthase	NA	NA	NA	NA	NA
WP_004190549.1|2114895_2115189_-	exodeoxyribonuclease VII small subunit	NA	NA	NA	NA	NA
WP_004190814.1|2115458_2116565_+	aromatic ring-hydroxylating dioxygenase subunit alpha	NA	NA	NA	NA	NA
WP_004190656.1|2116712_2117582_+	sulfurtransferase	NA	NA	NA	NA	NA
WP_004190499.1|2117640_2118516_-	dienelactone hydrolase family protein	NA	NA	NA	NA	NA
WP_004529029.1|2119079_2121029_+	membrane protein	NA	NA	NA	NA	NA
WP_004190401.1|2121250_2122633_-	NAD(P)/FAD-dependent oxidoreductase	NA	NA	NA	NA	NA
WP_004540200.1|2122951_2125723_-	DNA polymerase I	NA	S5M8J1	Bacillus_phage	30.0	6.4e-71
WP_004530319.1|2125724_2126474_+	TIGR00730 family Rossman fold protein	NA	A0A1D8KUT5	Synechococcus_phage	37.8	5.6e-22
WP_004529031.1|2126891_2127176_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004540549.1|2127835_2128327_+	DUF523 domain-containing protein	NA	NA	NA	NA	NA
WP_004540321.1|2128763_2129027_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004540326.1|2129205_2130432_-|protease	trypsin-like serine protease	protease	NA	NA	NA	NA
WP_004553592.1|2131368_2131656_+|portal	phage portal protein	portal	K4NZV0	Burkholderia_phage	94.4	1.7e-43
>prophage 4
NC_021877	Burkholderia pseudomallei MSHR305 chromosome 2, complete sequence	3373917	2502762	2574069	3373917	plate,transposase,integrase	Planktothrix_phage(14.29%)	47	2497390:2497409	2577668:2577687
2497390:2497409	attL	TTCGCCGCGCCGTTTGTCGC	NA	NA	NA	NA
WP_004540471.1|2502762_2504448_-|integrase	tyrosine-type recombinase/integrase	integrase	NA	NA	NA	NA
WP_020850088.1|2504897_2509466_-	RHS domain-containing protein	NA	A0A2H4JFP5	uncultured_Caudovirales_phage	34.3	2.4e-22
WP_004524859.1|2509479_2510748_-	hypothetical protein	NA	NA	NA	NA	NA
WP_009935223.1|2512683_2513130_-	hypothetical protein	NA	NA	NA	NA	NA
WP_153260275.1|2513108_2513699_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004540568.1|2514283_2514883_-	dicarboxylate/amino acid:cation symporter	NA	NA	NA	NA	NA
WP_004524853.1|2514907_2515318_-	RidA family protein	NA	NA	NA	NA	NA
WP_004524852.1|2515432_2516542_-	asparaginase	NA	NA	NA	NA	NA
WP_004557904.1|2516722_2517355_+	PAS domain-containing protein	NA	NA	NA	NA	NA
WP_004524850.1|2518256_2518694_-	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_020849981.1|2519930_2521004_-	porin	NA	NA	NA	NA	NA
WP_004540527.1|2521421_2522846_-	aldehyde dehydrogenase (NADP(+))	NA	NA	NA	NA	NA
WP_011205727.1|2523061_2524246_-	fumarylacetoacetate hydrolase family protein	NA	NA	NA	NA	NA
WP_020850047.1|2524256_2525144_-	aldose 1-epimerase	NA	NA	NA	NA	NA
WP_004524844.1|2525146_2525917_-	SDR family oxidoreductase	NA	NA	NA	NA	NA
WP_020850130.1|2525931_2526795_-	sugar ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	25.4	1.9e-13
WP_004524842.1|2526791_2527760_-	ABC transporter permease	NA	NA	NA	NA	NA
WP_004540209.1|2527780_2528779_-	sugar ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_004524840.1|2528816_2530019_-	mandelate racemase/muconate lactonizing enzyme family protein	NA	Q6A202	Oenococcus_phage	31.9	6.9e-46
WP_004557914.1|2530029_2530743_-	FadR family transcriptional regulator	NA	NA	NA	NA	NA
WP_004540362.1|2530874_2531765_+	SMP-30/gluconolactonase/LRE family protein	NA	NA	NA	NA	NA
WP_004540151.1|2532205_2532802_-	plasmid pRiA4b ORF-3 family protein	NA	A0A2H4PDG5	Mycobacterium_phage	38.1	6.0e-27
WP_020850197.1|2533855_2535118_-	group II intron reverse transcriptase/maturase	NA	A0A0U4J920	Pseudomonas_phage	31.5	2.0e-32
WP_004540399.1|2536294_2536642_-	IS66 family insertion sequence element accessory protein TnpB	NA	A0A0P0ZBY2	Stx2-converting_phage	72.9	2.1e-40
WP_004552577.1|2536638_2537046_-|transposase	transposase	transposase	A0A0P0ZCV4	Stx2-converting_phage	37.3	2.9e-12
WP_038733539.1|2537478_2539512_-	hypothetical protein	NA	NA	NA	NA	NA
WP_038733536.1|2539752_2541924_-	alpha-galactosidase	NA	NA	NA	NA	NA
WP_004524829.1|2541928_2542780_-	carbohydrate ABC transporter permease	NA	NA	NA	NA	NA
WP_004524828.1|2542780_2543704_-	sugar ABC transporter permease	NA	NA	NA	NA	NA
WP_004540455.1|2543765_2545007_-	extracellular solute-binding protein	NA	NA	NA	NA	NA
WP_020849913.1|2545042_2546287_-	ATP-binding cassette domain-containing protein	NA	G9BWD6	Planktothrix_phage	32.8	7.1e-22
WP_041188417.1|2546329_2546968_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004536893.1|2548740_2549895_-	LacI family DNA-binding transcriptional regulator	NA	NA	NA	NA	NA
WP_004524822.1|2551238_2551979_+	hypothetical protein	NA	NA	NA	NA	NA
WP_024429920.1|2552407_2552563_+	recombinase family protein	NA	A0A286S1P7	Klebsiella_phage	75.7	1.8e-07
WP_020850165.1|2552528_2553035_+	recombinase family protein	NA	A0JC18	Ralstonia_phage	51.7	2.2e-17
WP_076847933.1|2555321_2555888_-	suppressor of fused domain protein	NA	NA	NA	NA	NA
WP_171820160.1|2555889_2556372_-	hypothetical protein	NA	NA	NA	NA	NA
WP_085966800.1|2559025_2560206_-|transposase	IS3-like element ISBps1 family transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	42.9	2.2e-60
WP_004540288.1|2560832_2561984_+	hypothetical protein	NA	NA	NA	NA	NA
WP_071811398.1|2561994_2562282_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_004540427.1|2563289_2565221_-|transposase	transposase	transposase	S5WIU1	Leptospira_phage	50.4	6.9e-32
WP_041188419.1|2565150_2565861_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004203275.1|2565876_2568081_-	type VI secretion system tip protein VgrG	NA	A0A077K8Q4	Ralstonia_phage	29.9	9.6e-46
WP_004540478.1|2568077_2570744_-	type VI secretion system ATPase TssH	NA	K4FB40	Cronobacter_phage	30.7	1.8e-78
WP_004540225.1|2570722_2572201_-|plate	type VI secretion system baseplate subunit TssG	plate	NA	NA	NA	NA
WP_004524812.1|2572197_2574069_-|plate	type VI secretion system baseplate subunit TssF	plate	NA	NA	NA	NA
2577668:2577687	attR	TTCGCCGCGCCGTTTGTCGC	NA	NA	NA	NA
>prophage 1
NC_021884	Burkholderia pseudomallei MSHR305 chromosome 1, complete sequence	4054155	1354755	1365712	4054155	protease	Agrobacterium_phage(16.67%)	10	NA	NA
WP_004196461.1|1354755_1357056_-|protease	ATP-dependent Clp protease ATP-binding subunit ClpA	protease	A0A223W0B1	Agrobacterium_phage	42.1	5.1e-167
WP_004194131.1|1357052_1357367_-|protease	ATP-dependent Clp protease adapter ClpS	protease	A0A218MMY6	uncultured_virus	44.6	4.4e-13
WP_004196460.1|1357899_1358103_+	cold-shock protein	NA	A0A2H4N7Y6	Lake_Baikal_phage	81.8	6.8e-23
WP_004541727.1|1358232_1359843_-	multicopper oxidase family protein	NA	NA	NA	NA	NA
WP_004189626.1|1359855_1360038_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004189552.1|1360010_1361270_-	NADP-dependent isocitrate dehydrogenase	NA	Q77Z09	Phage_21	63.0	5.2e-12
WP_004189780.1|1361537_1362116_+	pseudouridine synthase	NA	NA	NA	NA	NA
WP_071810810.1|1362377_1362596_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004530837.1|1362787_1363297_+	DUF192 domain-containing protein	NA	A0A1B1IUW8	uncultured_Mediterranean_phage	41.2	5.5e-13
WP_004197486.1|1363597_1365712_+	elongation factor G	NA	E4ZFJ7	Streptococcus_phage	26.7	5.8e-56
>prophage 2
NC_021884	Burkholderia pseudomallei MSHR305 chromosome 1, complete sequence	4054155	2120502	2185668	4054155	transposase,portal,protease,tRNA	Streptococcus_phage(12.5%)	58	NA	NA
WP_020850758.1|2120502_2121966_+|transposase	IS1182-like element ISBma2 family transposase	transposase	A0A1X9I5T2	Streptococcus_phage	38.3	1.2e-79
WP_004199069.1|2122070_2123258_-	methionine adenosyltransferase	NA	A0A2H4PQS6	Staphylococcus_phage	60.7	2.2e-121
WP_004523078.1|2123523_2124408_+	lipid A biosynthesis lauroyl acyltransferase	NA	A0A1W6JP29	Morganella_phage	30.1	7.3e-29
WP_004199067.1|2124448_2125318_+	diaminopimelate epimerase	NA	NA	NA	NA	NA
WP_020850774.1|2125365_2126079_+	DUF484 family protein	NA	NA	NA	NA	NA
WP_004523080.1|2126116_2127049_+	tyrosine recombinase XerC	NA	G1JX48	Mycobacterium_phage	28.0	2.4e-14
WP_004542863.1|2127137_2128415_+	class I SAM-dependent rRNA methyltransferase	NA	NA	NA	NA	NA
WP_009972676.1|2128592_2129678_+	GTP-binding protein	NA	NA	NA	NA	NA
WP_004198318.1|2130227_2130644_+	RNA polymerase-binding protein DksA	NA	NA	NA	NA	NA
WP_004203414.1|2130898_2131435_+|protease	ATP-dependent protease subunit HslV	protease	NA	NA	NA	NA
WP_004198316.1|2131444_2132788_+|protease	ATP-dependent protease ATPase subunit HslU	protease	A0A191ZC11	Erwinia_phage	28.8	3.7e-40
WP_004198315.1|2133214_2133757_-	response regulator transcription factor	NA	NA	NA	NA	NA
WP_004198314.1|2133776_2135057_-	HAMP domain-containing histidine kinase	NA	NA	NA	NA	NA
WP_004198312.1|2135074_2135326_-	cysteine-rich CWC family protein	NA	NA	NA	NA	NA
WP_004200214.1|2135650_2136550_+	acetylglutamate kinase	NA	NA	NA	NA	NA
WP_004198307.1|2136546_2137350_+	pyrimidine 5'-nucleotidase	NA	NA	NA	NA	NA
WP_004525865.1|2137316_2138009_+	nucleoid occlusion factor SlmA	NA	NA	NA	NA	NA
WP_004198305.1|2138358_2139504_+	homoserine O-acetyltransferase	NA	NA	NA	NA	NA
WP_004543091.1|2139500_2140115_+	methionine biosynthesis protein MetW	NA	NA	NA	NA	NA
WP_004523086.1|2140126_2141440_+	AmpG family muropeptide MFS transporter	NA	NA	NA	NA	NA
WP_004535313.1|2141429_2142482_+	M48 family metallopeptidase	NA	NA	NA	NA	NA
WP_004525862.1|2142854_2143799_-	AraC family transcriptional regulator	NA	NA	NA	NA	NA
WP_004523088.1|2144010_2145075_+	NAD(P)-dependent alcohol dehydrogenase	NA	A0A2K9L339	Tupanvirus	45.8	1.3e-80
WP_004191998.1|2145349_2146813_-|transposase	IS1182-like element ISBma2 family transposase	transposase	A0A1X9I5T2	Streptococcus_phage	38.6	8.8e-80
WP_004190029.1|2146973_2147744_-	exodeoxyribonuclease III	NA	R4TWA8	Phaeocystis_globosa_virus	33.8	3.4e-30
WP_004523089.1|2147776_2148616_-	polyphosphate kinase	NA	NA	NA	NA	NA
WP_004523090.1|2148742_2150215_-|tRNA	Asp-tRNA(Asn)/Glu-tRNA(Gln) amidotransferase subunit GatB	tRNA	NA	NA	NA	NA
WP_004525859.1|2150217_2151708_-|tRNA	Asp-tRNA(Asn)/Glu-tRNA(Gln) amidotransferase subunit GatA	tRNA	NA	NA	NA	NA
WP_004189769.1|2151820_2152120_-|tRNA	Asp-tRNA(Asn)/Glu-tRNA(Gln) amidotransferase subunit GatC	tRNA	NA	NA	NA	NA
WP_004189550.1|2152485_2153529_+	rod shape-determining protein	NA	NA	NA	NA	NA
WP_004189331.1|2153648_2154722_+	rod shape-determining protein MreC	NA	NA	NA	NA	NA
WP_004523092.1|2154718_2155231_+	rod shape-determining protein MreD	NA	NA	NA	NA	NA
WP_004543095.1|2155414_2157826_+	penicillin-binding protein 2	NA	NA	NA	NA	NA
WP_004189171.1|2157837_2158986_+	rod shape-determining protein RodA	NA	NA	NA	NA	NA
WP_004543106.1|2159279_2160056_-	sel1 repeat family protein	NA	NA	NA	NA	NA
WP_004189570.1|2160052_2160838_-	2-dehydro-3-deoxyglucarate aldolase	NA	NA	NA	NA	NA
WP_004189793.1|2161262_2161715_-	6-carboxytetrahydropterin synthase QueD	NA	A0A088FAL2	Vibrio_phage	30.8	7.6e-14
WP_004189241.1|2161734_2162367_-	7-carboxy-7-deazaguanine synthase	NA	R4TAH8	Halovirus	30.9	2.1e-06
WP_004190026.1|2162460_2163195_-	7-cyano-7-deazaguanine synthase QueC	NA	A0A1B0Z0B4	Vibrio_phage	42.5	1.6e-50
WP_004189647.1|2163662_2164346_-	response regulator	NA	NA	NA	NA	NA
WP_004523096.1|2164346_2166755_-	PAS domain-containing sensor histidine kinase	NA	NA	NA	NA	NA
WP_004543101.1|2166756_2167347_-	DUF4390 domain-containing protein	NA	NA	NA	NA	NA
WP_020850535.1|2167343_2168753_-	16S rRNA (cytosine(967)-C(5))-methyltransferase RsmB	NA	NA	NA	NA	NA
WP_004189409.1|2169248_2170106_-|protease	zinc metalloprotease HtpX	protease	NA	NA	NA	NA
WP_004543107.1|2170215_2170851_-	LysE family translocator	NA	NA	NA	NA	NA
WP_004543102.1|2170971_2171955_-|tRNA	methionyl-tRNA formyltransferase	tRNA	E3SNR5	Prochlorococcus_phage	38.0	1.3e-07
WP_004525852.1|2171986_2172490_-	peptide deformylase	NA	A0A067XQZ3	Caulobacter_phage	34.3	2.1e-12
WP_020850823.1|2172718_2173909_+	DNA-protecting protein DprA	NA	S6BFL3	Thermus_phage	39.2	2.0e-21
WP_004190199.1|2173968_2174340_+	thioredoxin family protein	NA	NA	NA	NA	NA
WP_004523103.1|2174550_2177160_+	DNA topoisomerase III	NA	A0A2P1ELA0	Moumouvirus	25.7	7.7e-18
WP_004189230.1|2177383_2178439_-	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_004523104.1|2178877_2179894_+	D-2-hydroxyacid dehydrogenase family protein	NA	NA	NA	NA	NA
WP_004543112.1|2180014_2180884_-	patatin-like phospholipase family protein	NA	NA	NA	NA	NA
WP_004200732.1|2180921_2181326_-	PaaI family thioesterase	NA	NA	NA	NA	NA
WP_004543096.1|2182199_2183204_+	SIR2 family protein	NA	NA	NA	NA	NA
WP_004200731.1|2183740_2184223_+	DUF2778 domain-containing protein	NA	NA	NA	NA	NA
WP_004523107.1|2184219_2184504_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004543108.1|2184576_2185668_-|portal	phage portal protein	portal	A4JWQ2	Burkholderia_virus	91.7	2.2e-192
>prophage 3
NC_021884	Burkholderia pseudomallei MSHR305 chromosome 1, complete sequence	4054155	2400031	2411250	4054155	integrase	Burkholderia_virus(22.22%)	10	2397444:2397461	2414030:2414047
2397444:2397461	attL	CGCGGCGAGCGCGTCGAG	NA	NA	NA	NA
WP_004524472.1|2400031_2402119_+	UvrD-helicase domain-containing protein	NA	A7KV33	Bacillus_phage	35.8	1.9e-99
WP_004202928.1|2402441_2403341_-	c-type cytochrome	NA	NA	NA	NA	NA
WP_041188602.1|2404523_2405111_+|integrase	site-specific integrase	integrase	A0A0S2SYQ7	Pseudomonas_phage	50.6	3.1e-44
WP_009922658.1|2405490_2405808_+	helix-turn-helix transcriptional regulator	NA	A0A088CD40	Shigella_phage	57.0	6.2e-15
WP_004541800.1|2405807_2406725_+	DUF4935 domain-containing protein	NA	A4PE40	Ralstonia_virus	40.6	8.9e-46
WP_009922654.1|2406978_2407521_+	PAAR domain-containing protein	NA	A4JWV5	Burkholderia_virus	56.4	3.3e-48
WP_009932249.1|2407778_2408231_+	VRR-NUC domain-containing protein	NA	Q8W6S1	Burkholderia_virus	58.8	2.3e-31
WP_004525722.1|2408230_2409310_+	DUF3396 domain-containing protein	NA	A9YX32	Burkholderia_phage	99.0	2.2e-160
WP_004525721.1|2409466_2409715_+	BrnA antitoxin family protein	NA	K4NZP3	Burkholderia_phage	97.6	4.0e-41
WP_004195754.1|2410605_2411250_+	lytic polysaccharide monooxygenase	NA	A0A0K1Y848	Apis_mellifera_filamentous_virus	30.4	5.7e-07
2414030:2414047	attR	CTCGACGCGCTCGCCGCG	NA	NA	NA	NA
>prophage 4
NC_021884	Burkholderia pseudomallei MSHR305 chromosome 1, complete sequence	4054155	2655509	2682071	4054155	tail,protease,plate,integrase	Burkholderia_phage(44.44%)	30	2656082:2656128	2671559:2671605
WP_004527881.1|2655509_2656031_+|protease	ClpXP protease specificity-enhancing factor	protease	A0A1S5R3H3	Pseudomonas_phage	51.0	1.9e-21
2656082:2656128	attL	ATTTGTAATCATCAGGTGGCGGGTTCGAGTCCTGCAGCCGGCACCAA	NA	NA	NA	NA
WP_004542707.1|2656224_2657271_+|integrase	site-specific integrase	integrase	W6MYA3	Pseudomonas_phage	38.7	3.9e-53
WP_004542657.1|2659033_2659288_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004542680.1|2659301_2659952_+	hypothetical protein	NA	NA	NA	NA	NA
WP_020850759.1|2659963_2660356_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004542725.1|2660348_2661197_+	type IV secretion system protein	NA	NA	NA	NA	NA
WP_143291333.1|2661256_2661508_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004542660.1|2661660_2661942_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004542720.1|2662360_2665336_+	conjugative relaxase	NA	V5UQN3	Mycobacterium_phage	28.8	4.5e-06
WP_020850657.1|2665361_2665613_-	hypothetical protein	NA	NA	NA	NA	NA
WP_076847806.1|2666087_2666534_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004542662.1|2666530_2666800_+	hypothetical protein	NA	NA	NA	NA	NA
WP_020850845.1|2666816_2667476_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004542700.1|2667588_2668503_-	three-Cys-motif partner protein TcmP	NA	NA	NA	NA	NA
WP_076847687.1|2668514_2669357_-	phage Gp37/Gp68 family protein	NA	Q8W6R4	Burkholderia_virus	43.3	2.9e-67
WP_076847807.1|2669651_2670290_+	DUF4433 domain-containing protein	NA	NA	NA	NA	NA
WP_020850538.1|2670304_2671366_+	macro domain-containing protein	NA	B3FJ30	Pseudomonas_phage	36.5	3.1e-18
WP_004542696.1|2672208_2672535_+|plate	baseplate J-like protein, truncation	plate	K4NZR5	Burkholderia_phage	100.0	1.3e-52
2671559:2671605	attR	ATTTGTAATCATCAGGTGGCGGGTTCGAGTCCTGCAGCCGGCACCAA	NA	NA	NA	NA
WP_004542714.1|2672527_2672941_+|tail	phage tail protein I	tail	K4NXA0	Burkholderia_phage	99.2	1.5e-69
WP_020850622.1|2672958_2673441_+	DNA methylase	NA	K4NZW3	Burkholderia_phage	87.6	4.5e-73
WP_111952238.1|2673834_2674425_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004542688.1|2674528_2674894_-	phage virion morphogenesis protein	NA	K4NZQ8	Burkholderia_phage	89.3	5.1e-53
WP_004521948.1|2674995_2675781_-	DotU family type IV/VI secretion system protein	NA	NA	NA	NA	NA
WP_004521949.1|2675777_2677124_-|plate	type VI secretion system baseplate subunit TssK	plate	NA	NA	NA	NA
WP_004521950.1|2677232_2677847_-	type VI secretion system lipoprotein TssJ	NA	NA	NA	NA	NA
WP_004531875.1|2678221_2678893_+	tetratricopeptide repeat protein	NA	NA	NA	NA	NA
WP_004521952.1|2678929_2679448_+	type VI secretion system contractile sheath small subunit	NA	NA	NA	NA	NA
WP_004521953.1|2679464_2680955_+	type VI secretion system contractile sheath large subunit	NA	NA	NA	NA	NA
WP_004527837.1|2681027_2681531_+	type VI secretion system tube protein Hcp	NA	NA	NA	NA	NA
WP_004204912.1|2681588_2682071_+|plate	type VI secretion system baseplate subunit TssE	plate	NA	NA	NA	NA
>prophage 5
NC_021884	Burkholderia pseudomallei MSHR305 chromosome 1, complete sequence	4054155	3031530	3040775	4054155		Hokovirus(16.67%)	7	NA	NA
WP_004194034.1|3031530_3033483_+	molecular chaperone DnaK	NA	A0A1V0SH73	Hokovirus	49.2	2.7e-148
WP_004533593.1|3033749_3034880_+	molecular chaperone DnaJ	NA	A0A1V0SBY2	Catovirus	27.6	3.8e-22
WP_004541188.1|3034913_3036920_+	bifunctional anthranilate synthase component I family protein/class IV aminotransferase	NA	S4VT78	Pandoravirus	34.6	4.8e-52
WP_004194137.1|3037103_3037919_-	3-methyl-2-oxobutanoate hydroxymethyltransferase	NA	A0A0N7HVJ8	Ostreococcus_lucimarinus_virus	33.3	8.8e-37
WP_004532195.1|3037983_3038667_-	deoxynucleoside kinase	NA	A0A249XZR7	Enterococcus_phage	26.0	2.0e-05
WP_004194373.1|3038663_3039191_-	2-amino-4-hydroxy-6- hydroxymethyldihydropteridine diphosphokinase	NA	NA	NA	NA	NA
WP_004541275.1|3039227_3040775_-	polynucleotide adenylyltransferase PcnB	NA	H7BUW3	unidentified_phage	30.9	1.2e-23
>prophage 6
NC_021884	Burkholderia pseudomallei MSHR305 chromosome 1, complete sequence	4054155	3378977	3387792	4054155		Bacillus_phage(16.67%)	8	NA	NA
WP_004522358.1|3378977_3380378_+	UDP-glucose/GDP-mannose dehydrogenase family protein	NA	A0A127AXI2	Bacillus_phage	38.5	1.9e-79
WP_009921652.1|3380409_3381333_+	D-glycero-beta-D-manno-heptose-7-phosphate kinase	NA	A0A2H4N7X4	Lake_Baikal_phage	27.1	1.3e-15
WP_004190173.1|3381391_3382384_+	ADP-glyceromanno-heptose 6-epimerase	NA	R9S880	Prochlorococcus_phage	30.9	9.1e-28
WP_004539941.1|3382455_3382773_+	helix-hairpin-helix domain-containing protein	NA	NA	NA	NA	NA
WP_004532363.1|3383096_3383999_+	cysteine synthase CysM	NA	A0A1X9I5F1	Streptococcus_phage	39.9	1.9e-53
WP_004539874.1|3384225_3385509_-	lytic murein transglycosylase B	NA	NA	NA	NA	NA
WP_004522362.1|3385687_3386611_+	histone deacetylase family protein	NA	A0A2K9KZC4	Tupanvirus	36.2	2.4e-43
WP_041188594.1|3386949_3387792_-	alpha/beta hydrolase	NA	A7XCB7	Tanapox_virus	27.0	7.2e-18
>prophage 7
NC_021884	Burkholderia pseudomallei MSHR305 chromosome 1, complete sequence	4054155	3462894	3542132	4054155	portal,head,terminase,integrase,holin,tail,protease	Burkholderia_virus(30.3%)	81	3469440:3469457	3492230:3492247
WP_004192020.1|3462894_3464403_+|protease	DegQ family serine endoprotease	protease	A0A1B1IT49	uncultured_Mediterranean_phage	27.7	2.8e-20
WP_004539792.1|3464399_3464654_+	glutaredoxin family protein	NA	NA	NA	NA	NA
WP_004193305.1|3464895_3466689_+	elongation factor 4	NA	E4ZFJ7	Streptococcus_phage	23.5	2.1e-22
WP_004193513.1|3466704_3467598_+	signal peptidase I	NA	NA	NA	NA	NA
WP_004539775.1|3467748_3469152_+	ribonuclease III	NA	G8DDA3	Micromonas_pusilla_virus	30.3	4.9e-19
WP_004191678.1|3469221_3470121_+	GTPase Era	NA	NA	NA	NA	NA
3469440:3469457	attL	CAGCACCGCGCTCAACCG	NA	NA	NA	NA
WP_004524618.1|3470140_3470968_+	DNA repair protein RecO	NA	NA	NA	NA	NA
WP_004192885.1|3470964_3471738_+	pyridoxine 5'-phosphate synthase	NA	NA	NA	NA	NA
WP_004191194.1|3471743_3472175_+	holo-ACP synthase	NA	NA	NA	NA	NA
WP_004539664.1|3472202_3473231_+	beta-N-acetylhexosaminidase	NA	NA	NA	NA	NA
WP_004192300.1|3473344_3474742_-	sigma-54-dependent Fis family transcriptional regulator	NA	NA	NA	NA	NA
WP_004193484.1|3475013_3475571_-	elongation factor P	NA	NA	NA	NA	NA
WP_004540031.1|3475760_3476981_-	elongation factor P maturation arginine rhamnosyltransferase EarP	NA	NA	NA	NA	NA
WP_004527460.1|3477204_3479448_+	excinuclease ABC subunit UvrC	NA	NA	NA	NA	NA
WP_004192722.1|3479575_3480169_+	CDP-diacylglycerol--glycerol-3-phosphate 3-phosphatidyltransferase	NA	NA	NA	NA	NA
WP_004539938.1|3480933_3482133_+|integrase	tyrosine-type recombinase/integrase	integrase	A0A1L7DQ84	Ralstonia_phage	34.7	7.9e-18
WP_080002859.1|3482149_3483097_-	conjugal transfer protein TraN	NA	NA	NA	NA	NA
WP_004539756.1|3483140_3483467_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_020850651.1|3483463_3483724_-	hypothetical protein	NA	NA	NA	NA	NA
WP_041188621.1|3483720_3484065_-	hypothetical protein	NA	X5I2N5	Pseudomonas_phage	71.0	6.7e-31
WP_076847822.1|3485344_3485683_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004539721.1|3485784_3487101_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004539952.1|3487100_3487547_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004539947.1|3487543_3487903_-	hypothetical protein	NA	NA	NA	NA	NA
WP_020850499.1|3487907_3488117_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004539642.1|3488124_3488277_-	hypothetical protein	NA	NA	NA	NA	NA
WP_020850728.1|3488279_3488495_-	hypothetical protein	NA	NA	NA	NA	NA
WP_020850435.1|3489061_3489589_-	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_004539980.1|3489682_3489889_+	hypothetical protein	NA	NA	NA	NA	NA
WP_020850469.1|3489963_3490488_+	hypothetical protein	NA	C7BGG0	Burkholderia_phage	45.0	6.2e-28
WP_004540057.1|3490496_3490889_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004539611.1|3491043_3493782_+	virulence protein E	NA	A0A2D1GN57	Marinobacter_phage	43.3	1.1e-91
3492230:3492247	attR	CGGTTGAGCGCGGTGCTG	NA	NA	NA	NA
WP_076847724.1|3494061_3494859_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004539817.1|3495077_3495836_+	hypothetical protein	NA	A0A1B0Z000	Pseudomonas_phage	42.7	5.0e-34
WP_020850831.1|3496017_3496647_+	hypothetical protein	NA	A0A2H4JCL4	uncultured_Caudovirales_phage	32.3	1.6e-06
WP_020850857.1|3496594_3498664_+|terminase	phage terminase large subunit family protein	terminase	A0A1B2LRQ2	Wolbachia_phage	34.0	1.3e-100
WP_004540003.1|3498666_3498873_+	hypothetical protein	NA	A0A2H4JA19	uncultured_Caudovirales_phage	46.8	6.5e-05
WP_004539741.1|3498874_3500398_+|portal	phage portal protein	portal	B7SYD6	Stenotrophomonas_phage	38.6	1.2e-84
WP_020850433.1|3500387_3502466_+|head,protease	caudovirus prohead protease family protein	head,protease	A0A076G7Y9	Pseudoalteromonas_phage	29.8	1.9e-67
WP_004540064.1|3502531_3502867_+	DUF2190 family protein	NA	NA	NA	NA	NA
WP_004539750.1|3502869_3503166_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004539916.1|3503162_3503588_+	hypothetical protein	NA	NA	NA	NA	NA
WP_020850716.1|3503618_3504557_+	hypothetical protein	NA	G8CLB2	Synechococcus_phage	36.8	9.7e-48
WP_004540052.1|3504615_3504954_+	hypothetical protein	NA	F4YCS5	Synechococcus_phage	29.1	1.8e-07
WP_043944506.1|3505025_3505331_+	DUF1799 domain-containing protein	NA	A0A0H5ARS5	Pseudomonas_phage	44.3	7.6e-10
WP_004539854.1|3505375_3508156_+|tail	phage tail length tape measure family protein	tail	C4ML16	Xanthomonas_virus	26.1	1.3e-18
WP_076847725.1|3508145_3508484_+|tail	phage tail protein	tail	K7PHL4	Enterobacterial_phage	42.3	2.4e-17
WP_020850804.1|3508485_3509889_+|tail	tail fiber domain-containing protein	tail	Q8W6T4	Burkholderia_virus	75.9	3.0e-194
WP_004539780.1|3509885_3510578_+|tail	phage minor tail protein L	tail	Q6JIL5	Burkholderia_virus	65.0	2.9e-81
WP_004539701.1|3510582_3511314_+	C40 family peptidase	NA	Q8W6T2	Burkholderia_virus	50.4	1.3e-63
WP_004539859.1|3511310_3511892_+|tail	tail assembly protein	tail	Q3HQU4	Burkholderia_phage	55.7	6.9e-52
WP_004540110.1|3511888_3515260_+	host specificity protein J	NA	A4JX16	Burkholderia_virus	48.3	2.8e-302
WP_020850420.1|3515259_3515565_+	hypothetical protein	NA	Q8W6S9	Burkholderia_virus	73.5	1.6e-39
WP_020850642.1|3515564_3516302_+	hypothetical protein	NA	Q8W6S8	Burkholderia_virus	68.0	2.8e-98
WP_004539903.1|3516359_3516644_+|holin	holin	holin	C7BGD7	Burkholderia_phage	90.4	4.7e-38
WP_020850783.1|3516646_3517141_+	glycoside hydrolase family 104 protein	NA	Q6J1Q5	Burkholderia_virus	79.9	6.9e-69
WP_004540004.1|3517137_3517632_+	DUF2514 family protein	NA	Q6J1Q4	Burkholderia_virus	54.5	6.7e-32
WP_004539787.1|3517799_3518588_+	DNA adenine methylase	NA	Q8W6S4	Burkholderia_virus	90.5	6.1e-144
WP_004540087.1|3518698_3519586_+	hypothetical protein	NA	Q8W6S3	Burkholderia_virus	64.1	2.1e-92
WP_004539830.1|3519692_3520082_-	hypothetical protein	NA	NA	NA	NA	NA
WP_041188619.1|3520119_3520380_-	hypothetical protein	NA	C7BGE3	Burkholderia_phage	83.7	2.8e-37
WP_144084165.1|3520344_3520848_+	SOS response-associated peptidase family protein	NA	A0A1S5NTJ1	Burkholderia_phage	85.8	8.3e-70
WP_004539946.1|3520888_3521830_-	DUF3800 domain-containing protein	NA	NA	NA	NA	NA
WP_158332260.1|3521974_3522037_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004193834.1|3523292_3523805_-	GAF domain-containing protein	NA	NA	NA	NA	NA
WP_004197652.1|3523969_3524878_-	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_004191946.1|3525004_3525871_+	pirin family protein	NA	NA	NA	NA	NA
WP_004554230.1|3526112_3526616_+	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_004191283.1|3526750_3527623_-	cytochrome c oxidase assembly protein	NA	NA	NA	NA	NA
WP_004192175.1|3527633_3528080_-	copper chaperone PCu(A)C	NA	NA	NA	NA	NA
WP_004539914.1|3528106_3528805_-	SCO family protein	NA	NA	NA	NA	NA
WP_076847727.1|3528971_3529193_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004533988.1|3529125_3529935_+	trehalose-phosphatase	NA	NA	NA	NA	NA
WP_004203013.1|3529931_3531308_+	alpha,alpha-trehalose-phosphate synthase (UDP-forming)	NA	NA	NA	NA	NA
WP_004539709.1|3531369_3533241_-	ABC transporter ATP-binding protein	NA	W8CYL7	Bacillus_phage	27.1	3.7e-38
WP_004192961.1|3533807_3534872_+	glycosyltransferase family 4 protein	NA	NA	NA	NA	NA
WP_004535747.1|3535138_3536110_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004204640.1|3536165_3536627_+	DUF2214 family protein	NA	NA	NA	NA	NA
WP_004524631.1|3536776_3537949_-	FAD-binding oxidoreductase	NA	NA	NA	NA	NA
WP_004191212.1|3538047_3539196_-	branched-chain amino acid ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_004191603.1|3540029_3542132_-|holin	phospholipase C, phosphocholine-specific	holin	NA	NA	NA	NA
>prophage 8
NC_021884	Burkholderia pseudomallei MSHR305 chromosome 1, complete sequence	4054155	3692675	3785056	4054155	capsid,portal,head,lysis,terminase,plate,integrase,tail,tRNA,protease	uncultured_Caudovirales_phage(22.73%)	100	3701447:3701465	3759628:3759646
WP_004192783.1|3692675_3694202_-|tRNA	lysine--tRNA ligase	tRNA	A0A1V0SAC0	Catovirus	35.6	2.8e-84
WP_004199566.1|3694295_3695400_-	peptide chain release factor 2	NA	A0A0S4KWG0	Pseudomonas_phage	37.1	2.2e-06
WP_004191649.1|3695739_3697434_-	single-stranded-DNA-specific exonuclease RecJ	NA	A0A0K2FM92	Brevibacillus_phage	27.3	1.1e-28
WP_004193226.1|3697449_3698526_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004540060.1|3699093_3700347_+	lipoprotein-releasing ABC transporter permease subunit	NA	NA	NA	NA	NA
WP_004195923.1|3700339_3701089_+	lipoprotein-releasing ABC transporter ATP-binding protein LolD	NA	G9BWD6	Planktothrix_phage	38.3	2.2e-34
WP_004192516.1|3701093_3701882_+	TatD family hydrolase	NA	NA	NA	NA	NA
3701447:3701465	attL	GCTGCGGCTCGCGCGCGAG	NA	NA	NA	NA
WP_020850592.1|3701934_3704463_+	DNA internalization-related competence protein ComEC/Rec2	NA	NA	NA	NA	NA
WP_004540067.1|3704499_3705327_+	alpha/beta hydrolase	NA	NA	NA	NA	NA
WP_004192790.1|3705583_3707245_+	CTP synthase	NA	A0A1J0FA14	Only_Syngen_Nebraska_virus	52.0	1.9e-150
WP_004539923.1|3707241_3708096_+	3-deoxy-8-phosphooctulonate synthase	NA	E3T537	Cafeteria_roenbergensis_virus	40.9	8.9e-48
WP_004192585.1|3708199_3709483_+	phosphopyruvate hydratase	NA	W6LP63	Streptococcus_phage	62.6	6.4e-151
WP_004191789.1|3709574_3710006_+	cell division protein FtsB	NA	NA	NA	NA	NA
WP_004532146.1|3710231_3710579_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004191092.1|3710662_3711613_-	Hsp33 family molecular chaperone HslO	NA	NA	NA	NA	NA
WP_004524734.1|3711651_3712176_-	gamma carbonic anhydrase family protein	NA	NA	NA	NA	NA
WP_004191514.1|3712385_3713204_+	ferritin-like domain-containing protein	NA	NA	NA	NA	NA
WP_004192762.1|3713358_3714249_+	alpha/beta fold hydrolase	NA	NA	NA	NA	NA
WP_004193008.1|3714516_3715347_+	PHP domain-containing protein	NA	NA	NA	NA	NA
WP_004192132.1|3715411_3716041_+	threonylcarbamoyl-AMP synthase	NA	NA	NA	NA	NA
WP_004192745.1|3716139_3716805_+|protease	site-2 protease family protein	protease	NA	NA	NA	NA
WP_004191887.1|3716813_3718016_+|tRNA	tryptophan--tRNA ligase	tRNA	NA	NA	NA	NA
WP_004192474.1|3718012_3718630_+	class I SAM-dependent methyltransferase	NA	NA	NA	NA	NA
WP_004191516.1|3718674_3719577_+	4-hydroxy-tetrahydrodipicolinate synthase	NA	NA	NA	NA	NA
WP_004524737.1|3719687_3720830_+	outer membrane protein assembly factor BamC	NA	NA	NA	NA	NA
WP_004193059.1|3720834_3721611_+	MBL fold metallo-hydrolase	NA	U5PVD0	Bacillus_phage	26.6	3.3e-09
WP_004539920.1|3722337_3723525_-	cupin domain-containing protein	NA	NA	NA	NA	NA
WP_004524740.1|3723593_3724139_+	peptidylprolyl isomerase	NA	NA	NA	NA	NA
WP_004540138.1|3724118_3725417_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004539925.1|3725403_3728088_-	DNA mismatch repair protein MutS	NA	A0A1V0SDQ0	Indivirus	24.3	9.3e-27
WP_004539636.1|3728247_3729549_+|integrase	integrase family protein	integrase	C7BGE7	Burkholderia_phage	58.9	1.8e-148
WP_009890227.1|3729499_3729742_-	AlpA family phage regulatory protein	NA	C7BGF0	Burkholderia_phage	59.2	9.3e-19
WP_004539932.1|3729750_3730224_-	hypothetical protein	NA	B5TA88	Burkholderia_phage	71.4	2.3e-05
WP_004555250.1|3730232_3730562_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004540046.1|3730675_3731992_-	ParB N-terminal domain-containing protein	NA	NA	NA	NA	NA
WP_004539832.1|3731991_3732441_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004534172.1|3732437_3733043_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004539634.1|3733039_3733375_-	hypothetical protein	NA	NA	NA	NA	NA
WP_128972336.1|3733426_3733615_-	NlpBDapX lipoprotein	NA	NA	NA	NA	NA
WP_004555253.1|3733749_3734238_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004555254.1|3734191_3734692_-	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_024430958.1|3734808_3735018_+	hypothetical protein	NA	NA	NA	NA	NA
WP_009944042.1|3735104_3735635_+	hypothetical protein	NA	C7BGG0	Burkholderia_phage	46.8	4.4e-29
WP_024464805.1|3735648_3736002_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004539945.1|3736308_3736779_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004540079.1|3736898_3739391_+	virulence protein E	NA	A0A2D1GN57	Marinobacter_phage	41.8	3.6e-97
WP_020850498.1|3739600_3740188_+	hypothetical protein	NA	NA	NA	NA	NA
WP_041188588.1|3740535_3740910_+	hypothetical protein	NA	NA	NA	NA	NA
WP_020850524.1|3741276_3741846_+	MarR family transcriptional regulator	NA	NA	NA	NA	NA
WP_004552756.1|3741808_3743794_+|terminase	phage terminase large subunit family protein	terminase	A0A2D1GMT1	Marinobacter_phage	53.4	2.1e-180
WP_004533700.1|3743804_3744011_+	hypothetical protein	NA	NA	NA	NA	NA
WP_020850457.1|3744007_3745501_+|portal	phage portal protein	portal	A0A2H4JFL5	uncultured_Caudovirales_phage	51.2	4.4e-135
WP_004540078.1|3745497_3746577_+|protease	Clp protease ClpP	protease	A0A2H4JDI2	uncultured_Caudovirales_phage	37.1	1.6e-46
WP_004539732.1|3746603_3746948_+|head	head decoration protein	head	NA	NA	NA	NA
WP_080002857.1|3746982_3748008_+|capsid	major capsid protein	capsid	A0A2H4J890	uncultured_Caudovirales_phage	58.8	8.3e-109
WP_004539695.1|3748011_3748302_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004539763.1|3748303_3748834_+|tail	phage tail protein	tail	A0A2H4JBV1	uncultured_Caudovirales_phage	28.0	9.2e-11
WP_020850797.1|3748823_3749357_+	hypothetical protein	NA	Q9JML9	Wolbachia_phage	39.5	1.4e-22
WP_004539840.1|3749359_3750040_+|plate	phage baseplate assembly protein V	plate	A0A1B2LRU5	Wolbachia_phage	34.4	1.2e-18
WP_004539700.1|3750104_3750311_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004539881.1|3750307_3750652_+	GPW/gp25 family protein	NA	A0A2H4JA09	uncultured_Caudovirales_phage	50.0	3.0e-23
WP_004533630.1|3750648_3751542_+|plate	baseplate J/gp47 family protein	plate	D5LGZ3	Escherichia_phage	40.7	1.9e-48
WP_004539949.1|3751534_3752110_+|tail	phage tail protein I	tail	Q6QI98	Burkholderia_phage	47.7	6.0e-32
WP_004539647.1|3752097_3753561_+	hypothetical protein	NA	A4JWL8	Burkholderia_virus	77.8	8.0e-214
WP_004539865.1|3753576_3754029_+|tail	tail assembly chaperone	tail	A4JWL9	Burkholderia_virus	76.8	1.8e-44
WP_004539720.1|3754094_3755264_+|tail	phage tail sheath family protein	tail	A0A2H4J869	uncultured_Caudovirales_phage	72.9	6.9e-160
WP_004540135.1|3755274_3755778_+|tail	phage major tail tube protein	tail	Q7M2A5	Pseudomonas_phage	50.6	1.6e-41
WP_004533642.1|3755847_3756150_+|tail	phage tail assembly protein	tail	V5YST8	Pseudomonas_phage	37.2	1.5e-05
WP_004539677.1|3756237_3758652_+|tail	phage tail tape measure protein	tail	A0A2H4JG00	uncultured_Caudovirales_phage	34.3	6.4e-67
WP_004539752.1|3758660_3759542_+|tail	phage tail protein	tail	A0A2H4J875	uncultured_Caudovirales_phage	37.4	3.9e-30
WP_004540041.1|3759516_3759723_+|tail	tail protein X	tail	A0A2H4J9Z9	uncultured_Caudovirales_phage	61.2	4.0e-15
3759628:3759646	attR	CTCGCGCGCGAGCCGCAGC	NA	NA	NA	NA
WP_004539808.1|3759732_3760785_+	phage late control protein	NA	A0A2H4JBF6	uncultured_Caudovirales_phage	44.5	1.7e-77
WP_004533694.1|3760860_3761055_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004539628.1|3761047_3761545_+	lysozyme	NA	A4JX20	Burkholderia_virus	78.2	2.2e-67
WP_004539940.1|3761544_3762090_+|lysis	lysis protein	lysis	Q8W6S5	Burkholderia_virus	96.7	6.4e-84
WP_004540080.1|3762233_3763022_+	DNA adenine methylase	NA	Q8W6S4	Burkholderia_virus	97.7	6.1e-152
WP_004539736.1|3763062_3763773_-	immunity 52 family protein	NA	A4PE26	Ralstonia_virus	41.5	1.4e-38
WP_012730038.1|3763784_3764453_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004539924.1|3764737_3765244_-	DUF4123 domain-containing protein	NA	A4PE24	Ralstonia_virus	39.4	5.1e-19
WP_004539640.1|3765240_3765666_-	PAAR domain-containing protein	NA	A4JWV5	Burkholderia_virus	49.4	4.9e-15
WP_020850431.1|3766063_3766444_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004540114.1|3766903_3767131_-	hypothetical protein	NA	NA	NA	NA	NA
WP_133604798.1|3767127_3767526_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004540053.1|3768178_3768640_+	excisionase family DNA-binding protein	NA	K4ICM4	Acidithiobacillus_phage	67.3	6.7e-50
WP_004539802.1|3768644_3769220_+	PIN domain-containing protein	NA	K4HZX4	Acidithiobacillus_phage	70.4	5.4e-73
WP_004540097.1|3769405_3771622_+	ATP-binding protein	NA	NA	NA	NA	NA
WP_004191077.1|3772870_3773050_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004527347.1|3773233_3773506_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004191664.1|3773774_3774578_-	inositol monophosphatase	NA	NA	NA	NA	NA
WP_004524745.1|3774621_3774873_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004539789.1|3774878_3775790_+	RNA methyltransferase	NA	NA	NA	NA	NA
WP_004539737.1|3775980_3776766_+	serine O-acetyltransferase	NA	NA	NA	NA	NA
WP_020850718.1|3777101_3777902_-	UDP-2,3-diacylglucosamine diphosphatase	NA	NA	NA	NA	NA
WP_004193779.1|3777926_3778418_-	peptidyl-prolyl cis-trans isomerase	NA	A0A1V0SCU1	Indivirus	33.3	4.2e-10
WP_004191635.1|3778498_3779074_-	peptidyl-prolyl cis-trans isomerase	NA	A0A1V0SCU1	Indivirus	39.3	5.3e-12
WP_004195907.1|3779130_3779853_-	tetratricopeptide repeat protein	NA	NA	NA	NA	NA
WP_004192752.1|3780084_3781482_+|tRNA	cysteine--tRNA ligase	tRNA	M1PG92	Moumouvirus	33.8	1.8e-42
WP_004205123.1|3781529_3782468_+	DNA-3-methyladenine glycosylase 2 family protein	NA	NA	NA	NA	NA
WP_004193249.1|3782571_3783543_+	acetyl-CoA carboxylase carboxyltransferase subunit alpha	NA	NA	NA	NA	NA
WP_004538130.1|3783586_3785056_+|tRNA	tRNA lysidine(34) synthetase TilS	tRNA	NA	NA	NA	NA
>prophage 9
NC_021884	Burkholderia pseudomallei MSHR305 chromosome 1, complete sequence	4054155	3978101	3986294	4054155		Burkholderia_virus(50.0%)	12	NA	NA
WP_004196630.1|3978101_3978365_+	hypothetical protein	NA	Q8W6S4	Burkholderia_virus	85.5	2.2e-26
WP_076839978.1|3978348_3978534_+	hypothetical protein	NA	Q8W6S4	Burkholderia_virus	83.3	5.8e-21
WP_009920998.1|3978554_3979280_-	immunity 52 family protein	NA	A4PE26	Ralstonia_virus	44.0	5.8e-32
WP_004539879.1|3980229_3980736_-	DUF4123 domain-containing protein	NA	A4PE24	Ralstonia_virus	40.9	1.3e-19
WP_004539795.1|3980732_3981158_-	PAAR domain-containing protein	NA	A4JWV5	Burkholderia_virus	49.4	3.8e-15
WP_009937072.1|3981438_3981834_-	hypothetical protein	NA	NA	NA	NA	NA
WP_009919883.1|3982085_3982313_+	hypothetical protein	NA	Q8W6S4	Burkholderia_virus	72.7	4.2e-21
WP_004527234.1|3982348_3982582_-	immunity 52 family protein	NA	A4PE26	Ralstonia_virus	60.6	4.3e-13
WP_004550288.1|3982657_3983119_-	avidin	NA	NA	NA	NA	NA
WP_004193710.1|3984057_3984240_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004193371.1|3984366_3984990_-	phospholipase D family protein	NA	NA	NA	NA	NA
WP_004539691.1|3985184_3986294_-	class II histone deacetylase	NA	A0A2K9L2T7	Tupanvirus	31.3	1.6e-36
