The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
NC_021870	Salmonella bongori N268-08, complete sequence	4683551	479332	535885	4683551	protease,capsid,transposase,plate,head,tRNA,terminase,tail	Pseudomonas_phage(19.44%)	74	NA	NA
WP_020843478.1|479332_479605_+	helix-turn-helix domain-containing protein	NA	M1PVU4	Vibrio_phage	46.9	2.0e-09
WP_020843479.1|479614_481654_+|transposase	Mu transposase C-terminal domain-containing protein	transposase	A0A2D1GNK9	Pseudomonas_phage	47.5	9.2e-168
WP_020843480.1|481664_482612_+	AAA family ATPase	NA	A0A2D1GNS0	Pseudomonas_phage	37.8	4.7e-50
WP_020843481.1|482654_482879_+	hypothetical protein	NA	NA	NA	NA	NA
WP_020843483.1|483227_483470_+	hypothetical protein	NA	NA	NA	NA	NA
WP_020843484.1|483484_483730_+	hypothetical protein	NA	NA	NA	NA	NA
WP_020843485.1|483719_484244_+	host-nuclease inhibitor Gam family protein	NA	C9DGL8	Escherichia_phage	69.9	1.1e-61
WP_020843486.1|484251_484479_+	ANR family transcriptional regulator	NA	NA	NA	NA	NA
WP_020843487.1|484459_484651_+	hypothetical protein	NA	A0A2D1GNV5	Pseudomonas_phage	50.0	3.1e-09
WP_020843488.1|484731_485109_+	hypothetical protein	NA	A0A240F4V4	Ochrobactrum_phage	51.7	1.1e-21
WP_020843489.1|485101_485821_+	DUF2786 domain-containing protein	NA	NA	NA	NA	NA
WP_020843490.1|485817_486345_+	hypothetical protein	NA	NA	NA	NA	NA
WP_020843491.1|486346_486562_+	hypothetical protein	NA	NA	NA	NA	NA
WP_020843492.1|486558_486783_+	hypothetical protein	NA	NA	NA	NA	NA
WP_020843493.1|486779_487043_+	DUF4752 family protein	NA	T1S9K2	Salmonella_phage	48.1	2.0e-14
WP_024143170.1|487042_487282_+	hypothetical protein	NA	NA	NA	NA	NA
WP_020843496.1|487506_487926_+	regulatory protein GemA	NA	A0A2D1GNN4	Pseudomonas_phage	60.3	6.7e-41
WP_020843497.1|487940_488222_+	hypothetical protein	NA	NA	NA	NA	NA
WP_020843499.1|488380_488848_+	rhomboid protein	NA	A0A2D1GNW5	Pseudomonas_phage	35.6	3.1e-18
WP_020843500.1|488875_489163_+	hypothetical protein	NA	NA	NA	NA	NA
WP_020843502.1|489240_489438_+	hypothetical protein	NA	NA	NA	NA	NA
WP_020843503.1|489434_490187_+	site-specific DNA-methyltransferase	NA	Q775B4	Bordetella_phage	48.3	8.9e-60
WP_020843504.1|490183_490720_+	lysozyme	NA	NA	NA	NA	NA
WP_024143172.1|490701_491262_+	hypothetical protein	NA	NA	NA	NA	NA
WP_042916743.1|491239_491476_+	hypothetical protein	NA	NA	NA	NA	NA
WP_020843507.1|491475_491976_+	DUF1804 family protein	NA	I6PBD1	Pseudomonas_phage	52.4	3.6e-41
WP_020843508.1|491962_492181_+	hypothetical protein	NA	NA	NA	NA	NA
WP_020843509.1|492191_492446_+	hypothetical protein	NA	NA	NA	NA	NA
WP_024143173.1|492452_493226_-	DUF4145 domain-containing protein	NA	A4JX50	Burkholderia_virus	45.1	8.1e-08
WP_020843514.1|493224_493416_+	hypothetical protein	NA	NA	NA	NA	NA
WP_020843515.1|493543_495181_+|terminase	phage terminase large subunit	terminase	B7SDN0	Haemophilus_phage	62.7	5.8e-189
WP_020843516.1|495189_496761_+	DUF935 domain-containing protein	NA	A0A125RNC0	Pseudomonas_phage	45.4	4.2e-120
WP_020843517.1|496747_497920_+|capsid	minor capsid protein	capsid	A4JWJ6	Burkholderia_virus	48.3	1.0e-62
WP_020843518.1|497919_498471_+	phage virion morphogenesis protein	NA	A0A2H4J9E5	uncultured_Caudovirales_phage	34.7	1.6e-21
WP_020843519.1|498685_499846_+|protease	phage protease	protease	A0A0M5N0Q6	Ralstonia_phage	44.2	2.7e-63
WP_020843520.1|499845_500244_+	hypothetical protein	NA	NA	NA	NA	NA
WP_020843521.1|500253_501165_+|head	Mu-like prophage major head subunit gpT family protein	head	A0A2H4J778	uncultured_Caudovirales_phage	61.6	1.7e-105
WP_020843522.1|501164_501563_+	hypothetical protein	NA	NA	NA	NA	NA
WP_020843523.1|501574_502003_+	DUF1320 family protein	NA	A0A1X9SGZ3	Bradyrhizobium_phage	36.8	1.0e-15
WP_020843524.1|501999_502653_+	DUF1834 family protein	NA	A0A0M3LQJ7	Mannheimia_phage	36.5	3.1e-24
WP_020843525.1|502649_502898_+	hypothetical protein	NA	NA	NA	NA	NA
WP_020843526.1|502894_504331_+|tail	phage tail sheath subtilisin-like domain-containing protein	tail	A0A0M3LQC3	Mannheimia_phage	46.2	1.4e-98
WP_020843527.1|504342_504717_+	hypothetical protein	NA	A0A0M3LRV6	Mannheimia_phage	55.4	6.9e-29
WP_020843528.1|504713_505103_+	hypothetical protein	NA	NA	NA	NA	NA
WP_077909539.1|505251_507459_+|tail	phage tail tape measure protein	tail	A0A0M3LPB6	Mannheimia_phage	35.2	7.1e-65
WP_020843531.1|507455_508874_+	DNA circularization N-terminal domain-containing protein	NA	A0A2H4JGT4	uncultured_Caudovirales_phage	29.5	1.5e-44
WP_020843532.1|508857_510087_+|tail	phage tail protein	tail	F6MIL3	Haemophilus_phage	38.5	6.3e-71
WP_020843533.1|510086_510740_+|plate	phage baseplate assembly protein V	plate	A0A0M3LPA3	Mannheimia_phage	45.8	1.3e-46
WP_020843534.1|510793_511144_+	phage GP46 family protein	NA	A0A2H4JDR8	uncultured_Caudovirales_phage	60.3	5.3e-31
WP_020843535.1|511144_512203_+|plate	baseplate J/gp47 family protein	plate	F6MIL6	Haemophilus_phage	46.4	3.5e-78
WP_020843536.1|512199_512769_+	YmfQ family protein	NA	F6MIL7	Haemophilus_phage	44.1	3.4e-35
WP_139836191.1|512991_514038_+|tail	tail fiber protein	tail	A0A0M3ULH6	Salmonella_phage	47.3	6.4e-48
WP_020843538.1|514034_514859_+	macro domain-containing protein	NA	A0A0M4QWS3	Salmonella_phage	89.4	1.1e-138
WP_020843539.1|514848_515418_+|tail	tail fiber assembly protein	tail	A0A0M4RTP2	Salmonella_phage	75.5	5.5e-78
WP_020843541.1|516450_516930_-|tRNA	Cys-tRNA(Pro)/Cys-tRNA(Cys) deacylase YbaK	tRNA	NA	NA	NA	NA
WP_000365142.1|517131_517926_-	TraB/GumN family protein	NA	NA	NA	NA	NA
WP_024143178.1|518079_520581_-	copper-exporting P-type ATPase CopA	NA	A0A218MNH6	uncultured_virus	38.0	1.0e-112
WP_020843543.1|520698_521115_+	Cu(I)-responsive transcriptional regulator	NA	NA	NA	NA	NA
WP_020843544.1|521115_521568_-	NfeD family protein	NA	NA	NA	NA	NA
WP_020843545.1|521564_522482_-	SPFH/Band 7/PHB domain protein	NA	NA	NA	NA	NA
WP_020843546.1|522628_523306_+	iron ABC transporter ATP-binding protein FetA	NA	G3M9Y6	Bacillus_virus	32.2	1.7e-22
WP_020843547.1|523292_524072_+	iron export ABC transporter permease subunit FetB	NA	NA	NA	NA	NA
WP_000116050.1|524161_525016_-	co-chaperone YbbN	NA	NA	NA	NA	NA
WP_020843549.1|525075_525846_-	SDR family oxidoreductase	NA	NA	NA	NA	NA
WP_001010568.1|526008_526623_-|protease	multifunctional acyl-CoA thioesterase I/protease I/lysophospholipase L1	protease	NA	NA	NA	NA
WP_001110588.1|526593_527280_+	ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	35.9	3.8e-33
WP_020843550.1|527276_529691_+	ABC transporter permease	NA	NA	NA	NA	NA
WP_171503600.1|529978_530077_+	hypothetical protein	NA	NA	NA	NA	NA
WP_020843552.1|530229_531318_-|tRNA	tRNA 2-selenouridine(34) synthase MnmH	tRNA	NA	NA	NA	NA
WP_020843553.1|531413_532481_-	5-(carboxyamino)imidazole ribonucleotide synthase	NA	NA	NA	NA	NA
WP_000098731.1|532477_532987_-	5-(carboxyamino)imidazole ribonucleotide mutase	NA	NA	NA	NA	NA
WP_000212275.1|533106_533829_-	UDP-2,3-diacylglucosamine diphosphatase	NA	NA	NA	NA	NA
WP_000255986.1|533831_534326_-	peptidylprolyl isomerase B	NA	NA	NA	NA	NA
WP_000912380.1|534499_535885_+|tRNA	cysteine--tRNA ligase	tRNA	M1PG92	Moumouvirus	35.5	1.5e-44
>prophage 2
NC_021870	Salmonella bongori N268-08, complete sequence	4683551	981194	1048993	4683551	protease,capsid,holin,transposase,head,terminase,portal,integrase,tail	Salmonella_phage(36.54%)	79	998053:998112	1049790:1049867
WP_024143201.1|981194_982955_-|protease	Lon protease family protein	protease	NA	NA	NA	NA
WP_000877171.1|983140_983593_+	macrodomain Ter protein MatP	NA	NA	NA	NA	NA
WP_024143202.1|983663_984713_-	porin OmpA	NA	NA	NA	NA	NA
WP_020843814.1|985069_985579_-	cell division inhibitor SulA	NA	NA	NA	NA	NA
WP_020843815.1|985795_986410_+	TfoX/Sxy family DNA transformation protein	NA	NA	NA	NA	NA
WP_000950885.1|986387_988541_-	TIGR01666 family membrane protein	NA	NA	NA	NA	NA
WP_001261225.1|988559_989006_-	YccF domain-containing protein	NA	NA	NA	NA	NA
WP_020843817.1|989128_991183_+	DNA helicase IV	NA	A7KV33	Bacillus_phage	26.4	1.0e-17
WP_020843818.1|991218_991677_-	methylglyoxal synthase	NA	NA	NA	NA	NA
WP_000847728.1|991771_992434_-	DUF2057 family protein	NA	NA	NA	NA	NA
WP_024134977.1|992607_993021_+	CoA-binding protein	NA	NA	NA	NA	NA
WP_000561983.1|993068_993386_-	heat shock protein HspQ	NA	NA	NA	NA	NA
WP_020843819.1|993443_994655_-	23S rRNA (cytosine(1962)-C(5))-methyltransferase RlmI	NA	NA	NA	NA	NA
WP_024143203.1|995442_996222_+	AraC family transcriptional regulator	NA	NA	NA	NA	NA
WP_000029956.1|996270_996552_+	acylphosphatase	NA	NA	NA	NA	NA
WP_000904437.1|996548_996878_-	sulfurtransferase TusE	NA	NA	NA	NA	NA
WP_000374045.1|996959_997619_-|protease	FtsH protease modulator YccA	protease	A0A2H4JFM9	uncultured_Caudovirales_phage	54.4	1.7e-46
998053:998112	attL	CCGGTCTTGAAAACCGGCGACCCGAAAGGGTTCCAGAGTTCGAATCTCTGCGCTTCCGCC	NA	NA	NA	NA
WP_024143204.1|998218_999238_-|integrase	tyrosine-type recombinase/integrase	integrase	A0A192Y7M7	Salmonella_phage	53.2	3.1e-92
WP_000196400.1|999238_999463_-	DUF4224 domain-containing protein	NA	NA	NA	NA	NA
WP_020843824.1|999675_999858_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000205291.1|999860_1000415_-	siphovirus Gp157 family protein	NA	H9C156	Pectobacterium_phage	59.3	5.7e-48
WP_020843825.1|1000411_1002856_-	exodeoxyribonuclease VIII	NA	S4TNL0	Salmonella_phage	89.2	1.0e-250
WP_077909544.1|1002982_1003333_-	DNA breaking-rejoining protein	NA	S4TSN6	Salmonella_phage	94.0	1.7e-58
WP_000551856.1|1003354_1003525_-	hypothetical protein	NA	K7PGY4	Enterobacteria_phage	51.0	8.8e-08
WP_001750115.1|1003922_1004129_+	hypothetical protein	NA	K7P7I0	Enterobacteria_phage	69.1	4.3e-17
WP_001750114.1|1004155_1005097_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001230956.1|1005202_1005598_-	helix-turn-helix domain-containing protein	NA	K7PM35	Enterobacteria_phage	72.5	3.5e-47
WP_000992434.1|1005701_1005938_+	helix-turn-helix domain-containing protein	NA	A0A0M4QX15	Salmonella_phage	73.1	9.0e-27
WP_010835408.1|1005903_1006278_+	hypothetical protein	NA	S4TTD7	Salmonella_phage	98.4	1.9e-63
WP_020843826.1|1006369_1007275_+	replication protein	NA	A0A0M5M7Y1	Salmonella_phage	99.3	4.5e-175
WP_020843827.1|1007271_1007964_+	Replication protein P	NA	G8C7U6	Escherichia_phage	58.9	1.3e-76
WP_042917288.1|1007992_1008607_+	hypothetical protein	NA	M1F3E2	Salmonella_phage	56.3	2.8e-59
WP_020843829.1|1008603_1008837_+	hypothetical protein	NA	S4TVX5	Salmonella_phage	44.6	4.7e-12
WP_024134978.1|1009846_1010173_+	hypothetical protein	NA	NA	NA	NA	NA
WP_020843831.1|1010422_1010632_+	DinI-like family protein	NA	H6WRY5	Salmonella_phage	96.4	7.0e-23
WP_020843832.1|1010697_1012227_-	DUF4041 domain-containing protein	NA	Q5G8X0	Enterobacteria_phage	96.5	1.8e-160
WP_020843833.1|1012793_1013357_+	ORF6N domain-containing protein	NA	A0A2R2Z302	Escherichia_phage	66.4	2.1e-37
WP_001217667.1|1013542_1013776_+	DinI family protein	NA	H6WRY5	Salmonella_phage	98.7	7.3e-37
WP_042916810.1|1013892_1014141_+	hypothetical protein	NA	A0A0U2C0C8	Salmonella_phage	97.6	1.4e-41
WP_020843835.1|1014175_1014778_+	DUF1367 family protein	NA	S4TTI0	Salmonella_phage	98.5	8.3e-109
WP_020843836.1|1014777_1014984_+	hypothetical protein	NA	H6WRY8	Salmonella_phage	86.4	3.2e-28
WP_020843837.1|1014986_1015628_+	recombination protein NinG	NA	S4TSR3	Salmonella_phage	96.7	5.9e-113
WP_024143208.1|1015624_1015765_+	YlcG family protein	NA	A0A0M5M7B2	Salmonella_phage	76.3	7.2e-08
WP_020843838.1|1015761_1016451_+	antiterminator-like protein	NA	I6PDF8	Cronobacter_phage	50.2	5.8e-58
WP_024143209.1|1016717_1017143_+	hypothetical protein	NA	NA	NA	NA	NA
WP_171503638.1|1017213_1017915_+	pertussis toxin-like subunit ArtA	NA	A0A0U2KD26	Escherichia_phage	67.2	2.2e-81
WP_001294877.1|1018152_1018542_+|holin	phage holin family protein	holin	K7PHB9	Enterobacterial_phage	71.8	1.4e-40
WP_000226306.1|1018528_1018810_+|holin	phage holin family protein	holin	K7PKN9	Enterobacterial_phage	80.6	3.3e-36
WP_000372743.1|1018809_1019424_+	glycoside hydrolase family 19 protein	NA	Q8HA86	Salmonella_phage	92.6	2.7e-107
WP_020843840.1|1019420_1019963_+	DUF2514 domain-containing protein	NA	NA	NA	NA	NA
WP_001109263.1|1020212_1020743_+	KilA-N domain-containing protein	NA	A0A2H4FQV0	Salmonella_phage	96.6	9.9e-90
WP_001222152.1|1021142_1021553_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000819054.1|1021641_1021947_+	hypothetical protein	NA	Q8HA83	Salmonella_phage	53.1	6.2e-20
WP_024143211.1|1022049_1022400_+	HNH endonuclease	NA	Q8HA82	Salmonella_phage	75.7	3.6e-48
WP_020843844.1|1022741_1023179_+|terminase	phage terminase small subunit P27 family	terminase	A0A1J0GV10	Halomonas_phage	62.8	2.7e-32
WP_020843845.1|1023178_1024903_+|terminase	terminase large subunit	terminase	Q8W631	Enterobacteria_phage	59.6	2.5e-198
WP_020843846.1|1025075_1026335_+|portal	phage portal protein	portal	Q6UAX8	Klebsiella_phage	88.8	5.4e-219
WP_024143213.1|1026373_1027291_+	S49 family peptidase	NA	Q6UAX7	Klebsiella_phage	76.6	2.5e-128
WP_020843848.1|1027365_1028652_+|capsid	phage major capsid protein	capsid	Q6UAX6	Klebsiella_phage	87.6	4.4e-208
WP_020843849.1|1028707_1028998_+	hypothetical protein	NA	Q6UAX5	Klebsiella_phage	57.8	2.2e-19
WP_020843850.1|1028978_1029302_+|head,tail	phage gp6-like head-tail connector protein	head,tail	Q7Y407	Yersinia_phage	66.0	4.0e-33
WP_020843851.1|1029298_1029643_+	hypothetical protein	NA	Q6UAX3	Klebsiella_phage	64.5	1.4e-36
WP_020843852.1|1029623_1030013_+	hypothetical protein	NA	Q6UAX2	Klebsiella_phage	73.8	8.1e-49
WP_020843853.1|1030009_1030411_+	HK97 gp10 family phage protein	NA	Q6UAX1	Klebsiella_phage	87.2	1.3e-57
WP_020843854.1|1030443_1030917_+|tail	phage tail fiber	tail	Q6UAX0	Klebsiella_phage	78.7	3.2e-63
WP_020843855.1|1030986_1031349_+	hypothetical protein	NA	Q6UAW8	Klebsiella_phage	56.8	7.4e-28
WP_020843856.1|1031599_1034902_+|tail	phage tail tape measure protein	tail	Q6UAW7	Klebsiella_phage	68.1	0.0e+00
WP_020843857.1|1034905_1035238_+|tail	phage tail protein	tail	A0A0P0ZDL9	Stx2-converting_phage	66.1	1.4e-38
WP_020843858.1|1035247_1035943_+|tail	phage minor tail protein L	tail	A0A1B5FP81	Escherichia_phage	77.5	3.2e-104
WP_141023721.1|1036027_1036552_+	hypothetical protein	NA	NA	NA	NA	NA
WP_042916815.1|1036610_1037348_+|tail	phage tail protein	tail	K7PLW1	Enterobacteria_phage	85.2	3.4e-128
WP_042916816.1|1037245_1037893_+|tail	tail assembly protein	tail	A5LH42	Enterobacteria_phage	74.9	7.3e-87
WP_020843862.1|1037955_1041318_+	host specificity protein J	NA	K7PKJ2	Enterobacteria_phage	80.3	0.0e+00
WP_020843863.1|1041423_1042449_+|tail	prophage tail fiber N-terminal domain-containing protein	tail	A0A2D2W685	Pectobacterium_phage	45.7	8.0e-19
WP_024143216.1|1042509_1042767_+	hypothetical protein	NA	NA	NA	NA	NA
WP_042916818.1|1042768_1043881_+	hypothetical protein	NA	NA	NA	NA	NA
WP_024143218.1|1044252_1044825_+	T3SS effector NleG family protein	NA	NA	NA	NA	NA
WP_020843866.1|1045159_1047508_-	type III secretion system effector HECT-type E3 ubiquitin transferase	NA	NA	NA	NA	NA
WP_042916819.1|1047862_1048993_-|transposase	IS200/IS605 family element transposase accessory protein TnpB	transposase	Q9G0F2	Phage_Gifsy-1	97.3	2.6e-212
1049790:1049867	attR	CCGGTCTTGAAAACCGGCGACCCGAAAGGGTTCCAGAGTTCGAATCTCTGCGCTTCCGCCAGATTAAACAAGGGGTTA	NA	NA	NA	NA
>prophage 3
NC_021870	Salmonella bongori N268-08, complete sequence	4683551	1310679	1372766	4683551	capsid,holin,plate,lysis,tRNA,head,terminase,portal,integrase,tail	Enterobacteria_phage(57.78%)	68	1363792:1363807	1376253:1376268
WP_020844032.1|1310679_1312608_+|tRNA	threonine--tRNA ligase	tRNA	A0A2K9L297	Tupanvirus	37.1	3.0e-128
WP_001574431.1|1312611_1313154_+	translation initiation factor IF-3	NA	A0A2L0UZ54	Agrobacterium_phage	32.7	4.8e-15
WP_001124225.1|1313249_1313447_+	50S ribosomal protein L35	NA	NA	NA	NA	NA
WP_000124850.1|1313496_1313853_+	50S ribosomal protein L20	NA	NA	NA	NA	NA
WP_001386830.1|1313973_1314018_+	pheST operon leader peptide PheM	NA	NA	NA	NA	NA
WP_020844033.1|1314154_1315138_+|tRNA	phenylalanine--tRNA ligase subunit alpha	tRNA	A0A2K9L3A8	Tupanvirus	38.5	1.1e-33
WP_020844034.1|1315153_1317541_+|tRNA	phenylalanine--tRNA ligase subunit beta	tRNA	NA	NA	NA	NA
WP_001229266.1|1317545_1317845_+	integration host factor subunit alpha	NA	A0A0H3UZA0	Geobacillus_virus	40.0	7.2e-13
WP_024143244.1|1318200_1318341_-	Hok/Gef family protein	NA	A0A0A7NPZ4	Enterobacteria_phage	73.9	8.2e-12
WP_024143245.1|1318574_1318835_-	ogr/Delta-like zinc finger family protein	NA	NA	NA	NA	NA
WP_020844036.1|1318880_1320011_-	phage late control D family protein	NA	A0A0A7NQ97	Enterobacteria_phage	74.8	8.7e-152
WP_020844037.1|1320169_1321357_+|tail	phage tail sheath family protein	tail	A0A0A7NV69	Enterobacteria_phage	82.2	9.7e-186
WP_020844038.1|1321357_1321870_+|tail	phage major tail tube protein	tail	A0A0A7NPV8	Enterobacteria_phage	67.5	1.3e-62
WP_020844039.1|1321912_1322269_+|tail	tail protein	tail	A0A0A7NPZ0	Enterobacteria_phage	47.4	4.4e-17
WP_001627826.1|1322274_1322433_+|tail	GpE family phage tail protein	tail	A0A0A7NQ96	Enterobacteria_phage	79.6	2.4e-15
WP_020844040.1|1322419_1325380_+|tail	phage tail tape measure protein	tail	A0A0A7NRZ9	Enterobacteria_phage	50.9	1.3e-250
WP_000980424.1|1325393_1325882_+|tail	phage tail protein	tail	A0A0A7NV65	Enterobacteria_phage	79.5	1.5e-71
WP_020844042.1|1327175_1327709_+|tail	tail fiber assembly protein	tail	A0A1S6KZZ1	Salmonella_phage	83.1	2.5e-80
WP_077909551.1|1327712_1328330_-|tail	tail fiber assembly protein	tail	A0A1S6KZY8	Salmonella_phage	85.6	2.0e-97
WP_020844044.1|1328299_1330330_-|tail	phage tail protein	tail	A0A1B0VFW4	Salmonella_phage	95.5	7.4e-234
WP_020844045.1|1330335_1330863_-|tail	phage tail protein I	tail	A0A0A7NPV1	Enterobacteria_phage	61.2	7.1e-56
WP_020844046.1|1330855_1331752_-|plate	baseplate J/gp47 family protein	plate	A0A0A7NPY5	Enterobacteria_phage	68.8	7.5e-106
WP_001658912.1|1331738_1332107_-	GPW/gp25 family protein	NA	A0A0A7NQ90	Enterobacteria_phage	71.3	6.5e-40
WP_020844047.1|1332103_1332694_-|plate	phage baseplate assembly protein V	plate	A0A0A7NRZ3	Enterobacteria_phage	68.6	6.3e-69
WP_020844048.1|1332690_1333326_-	phage virion morphogenesis protein	NA	A0A0A7NV60	Enterobacteria_phage	60.4	1.5e-63
WP_020844049.1|1333322_1333799_-|tail	phage tail protein	tail	A0A0A7NPU6	Enterobacteria_phage	50.3	1.9e-39
WP_020844050.1|1333785_1334277_-|lysis	lysis protein	lysis	S4TNN7	Salmonella_phage	56.2	1.8e-32
WP_001658928.1|1334722_1335061_-|holin	phage holin, lambda family	holin	NA	NA	NA	NA
WP_020844052.1|1335090_1335291_-|tail	tail protein X	tail	A0A0A7NV57	Enterobacteria_phage	80.3	1.5e-22
WP_020844069.1|1340046_1340229_+	hypothetical protein	NA	NA	NA	NA	NA
WP_020844070.1|1340242_1340812_+|tail	phage tail tape measure protein	tail	B9A7B3	Serratia_phage	86.2	6.9e-81
WP_071825969.1|1340708_1341128_+|tail	phage tail tape measure protein	tail	B9A7B3	Serratia_phage	60.6	5.2e-25
WP_020844072.1|1341124_1341319_+	hypothetical protein	NA	NA	NA	NA	NA
WP_077909551.1|1344421_1345039_+|tail	tail fiber assembly protein	tail	A0A1S6KZY8	Salmonella_phage	85.6	2.0e-97
WP_020844042.1|1345042_1345576_-|tail	tail fiber assembly protein	tail	A0A1S6KZZ1	Salmonella_phage	83.1	2.5e-80
WP_020844078.1|1345578_1347468_-|tail	phage tail protein	tail	Q6K1H2	Salmonella_virus	54.9	7.4e-196
WP_020844048.1|1349828_1350464_-	phage virion morphogenesis protein	NA	A0A0A7NV60	Enterobacteria_phage	60.4	1.5e-63
WP_020844050.1|1350922_1351414_-|lysis	lysis protein	lysis	S4TNN7	Salmonella_phage	56.2	1.8e-32
WP_020844090.1|1351420_1351864_-	lysozyme	NA	A0A075B8L0	Enterobacteria_phage	62.5	6.2e-45
WP_001658928.1|1351860_1352199_-|holin	phage holin, lambda family	holin	NA	NA	NA	NA
WP_020844052.1|1352228_1352429_-|tail	tail protein X	tail	A0A0A7NV57	Enterobacteria_phage	80.3	1.5e-22
WP_020844091.1|1352428_1352923_-|head	head completion/stabilization protein	head	A0A0A7NPU2	Enterobacteria_phage	58.9	1.1e-50
WP_020844092.1|1353024_1353855_-|terminase	phage terminase endonuclease subunit	terminase	A0A0A7NPX9	Enterobacteria_phage	66.2	1.1e-90
WP_020844093.1|1353901_1354987_-|capsid	phage major capsid protein, P2 family	capsid	A0A0A7NQ82	Enterobacteria_phage	68.1	1.9e-135
WP_020844094.1|1355010_1355847_-|capsid	GPO family capsid scaffolding protein	capsid	A0A0A7NRY7	Enterobacteria_phage	65.5	1.3e-99
WP_020844095.1|1356003_1357737_+	helix-turn-helix domain-containing protein	NA	A0A0A7NV54	Enterobacteria_phage	74.8	4.2e-262
WP_020844096.1|1357736_1358786_+|portal	phage portal protein	portal	A0A0A7NPT9	Enterobacteria_phage	74.2	4.3e-153
WP_187646278.1|1358976_1359120_-	hypothetical protein	NA	NA	NA	NA	NA
WP_020844097.1|1359832_1361548_+	leucine rich repeat protein	NA	Q9MBM1	Phage_Gifsy-1	53.3	1.8e-132
WP_020844100.1|1362396_1362672_+	phage gene	NA	NA	NA	NA	NA
WP_020844101.1|1362765_1363197_-	hypothetical protein	NA	NA	NA	NA	NA
WP_020844102.1|1363189_1365481_-	replication endonuclease	NA	A0A0A7NQ77	Enterobacteria_phage	59.8	1.5e-238
1363792:1363807	attL	TCTGGCAGGCAAGGCG	NA	NA	NA	NA
WP_020844103.1|1365477_1365870_-	hypothetical protein	NA	NA	NA	NA	NA
WP_071825970.1|1365866_1366478_-	ash family protein	NA	NA	NA	NA	NA
WP_020844105.1|1366474_1367011_-	hypothetical protein	NA	A0A2I7QQL0	Vibrio_phage	33.0	2.1e-07
WP_020844106.1|1367007_1367313_-	DUF4406 domain-containing protein	NA	A0A222YYT7	Escherichia_phage	62.1	3.2e-24
WP_020844107.1|1367312_1368302_-	Dam family site-specific DNA-(adenine-N6)-methyltransferase	NA	A0A1B2IE38	Erwinia_phage	43.4	4.6e-56
WP_020844108.1|1368298_1368538_-	hypothetical protein	NA	NA	NA	NA	NA
WP_020844109.1|1368534_1369068_-	hypothetical protein	NA	NA	NA	NA	NA
WP_023207951.1|1369055_1369313_-	hypothetical protein	NA	NA	NA	NA	NA
WP_020844110.1|1369309_1369750_-	hypothetical protein	NA	NA	NA	NA	NA
WP_020844111.1|1369825_1370017_-	hypothetical protein	NA	NA	NA	NA	NA
WP_020844112.1|1369986_1370190_-	LapA family protein	NA	NA	NA	NA	NA
WP_020844113.1|1370195_1370438_-	hypothetical protein	NA	NA	NA	NA	NA
WP_020844114.1|1370510_1370897_-	hypothetical protein	NA	NA	NA	NA	NA
WP_020844115.1|1371056_1371335_-	hypothetical protein	NA	NA	NA	NA	NA
WP_042916865.1|1371429_1371741_+	helix-turn-helix transcriptional regulator	NA	Q1JS21	Enterobacteria_phage	48.5	5.4e-19
WP_042917319.1|1371830_1372766_+|integrase	tyrosine-type recombinase/integrase	integrase	A0A0M4RTQ0	Salmonella_phage	46.9	1.3e-73
1376253:1376268	attR	TCTGGCAGGCAAGGCG	NA	NA	NA	NA
>prophage 4
NC_021870	Salmonella bongori N268-08, complete sequence	4683551	1942716	2043076	4683551	protease,capsid,holin,plate,tRNA,portal,terminase,integrase,tail	Vibrio_phage(24.14%)	111	1990001:1990016	1998488:1998503
WP_000984498.1|1942716_1943598_-|protease	protease HtpX	protease	NA	NA	NA	NA
WP_020844477.1|1943790_1945839_-	carboxy terminal-processing peptidase	NA	A0A0R6PIZ1	Moraxella_phage	33.5	6.8e-86
WP_000431399.1|1945858_1946545_-	RNA chaperone ProQ	NA	NA	NA	NA	NA
WP_024143302.1|1946642_1947140_-	GAF domain-containing protein	NA	NA	NA	NA	NA
WP_001207303.1|1947268_1948552_+	membrane integrity lipid transport subunit YebS	NA	NA	NA	NA	NA
WP_020844479.1|1948520_1951154_+	PqiB family protein	NA	NA	NA	NA	NA
WP_024143303.1|1951231_1952671_+	16S rRNA (cytosine(1407)-C(5))-methyltransferase RsmF	NA	NA	NA	NA	NA
WP_024135041.1|1952788_1953025_+	DUF1480 family protein	NA	NA	NA	NA	NA
WP_000457838.1|1953134_1953326_+	YebW family protein	NA	NA	NA	NA	NA
WP_020844481.1|1953342_1953993_-	protein-serine/threonine phosphatase	NA	A0A222YWF0	Escherichia_phage	50.0	6.1e-57
WP_024143305.1|1954657_1955380_-	type III secretion system guanine nucleotide exchange factor SopE2	NA	NA	NA	NA	NA
WP_000076084.1|1956004_1956481_+	hypothetical protein	NA	NA	NA	NA	NA
WP_042916912.1|1957066_1958209_+	lipopolysaccharide N-acetylglucosaminyltransferase	NA	NA	NA	NA	NA
WP_000746718.1|1958740_1959091_-	YebY family protein	NA	NA	NA	NA	NA
WP_020844488.1|1959107_1959983_-	copper homeostasis membrane protein CopD	NA	NA	NA	NA	NA
WP_020844489.1|1959983_1960358_-	CopC domain-containing protein YobA	NA	NA	NA	NA	NA
WP_000856226.1|1960495_1960726_+	DNA polymerase III subunit theta	NA	H9C187	Pectobacterium_phage	60.3	1.7e-14
WP_000100264.1|1960833_1961490_+	carbon-nitrogen hydrolase family protein	NA	NA	NA	NA	NA
WP_000944290.1|1961513_1962203_+	exodeoxyribonuclease X	NA	Q6UAU3	Klebsiella_phage	41.6	3.6e-07
WP_000936986.1|1962231_1964283_-	oligopeptidase B	NA	NA	NA	NA	NA
WP_020844490.1|1964495_1965155_-	tellurite resistance TerB family protein	NA	NA	NA	NA	NA
WP_001042121.1|1965248_1965602_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000257721.1|1965668_1965959_-	DNA damage-inducible protein YebG	NA	NA	NA	NA	NA
WP_020844491.1|1966089_1967268_+	formate-dependent phosphoribosylglycinamide formyltransferase	NA	NA	NA	NA	NA
WP_000800498.1|1967340_1967982_-	bifunctional 4-hydroxy-2-oxoglutarate aldolase/2-dehydro-3-deoxy-phosphogluconate aldolase	NA	NA	NA	NA	NA
WP_020844492.1|1968019_1969831_-	phosphogluconate dehydratase	NA	NA	NA	NA	NA
WP_000301707.1|1970065_1971541_-	glucose-6-phosphate dehydrogenase	NA	H6WFS4	Cyanophage	37.1	3.4e-79
WP_001056683.1|1971882_1972728_+	MurR/RpiR family transcriptional regulator	NA	NA	NA	NA	NA
WP_000091174.1|1972875_1974318_+	pyruvate kinase	NA	NA	NA	NA	NA
WP_000448402.1|1974401_1975373_-	lauroyl-Kdo(2)-lipid IV(A) myristoyltransferase	NA	NA	NA	NA	NA
WP_020844493.1|1975489_1976809_-	murein DD-endopeptidase MepM	NA	A8ATH6	Listeria_phage	40.9	2.6e-14
WP_020844494.1|1976824_1977769_-	zinc ABC transporter substrate-binding protein ZnuA	NA	NA	NA	NA	NA
WP_000203016.1|1977847_1978603_+	zinc ABC transporter ATP-binding protein ZnuC	NA	G3M9Y6	Bacillus_virus	29.4	1.1e-17
WP_020844496.1|1978599_1979385_+	zinc ABC transporter permease subunit ZnuB	NA	NA	NA	NA	NA
WP_000568509.1|1979472_1980483_-	Holliday junction branch migration DNA helicase RuvB	NA	A0A127AWE7	Bacillus_phage	26.4	1.8e-07
WP_000580340.1|1980490_1981102_-	Holliday junction branch migration protein RuvA	NA	NA	NA	NA	NA
WP_020844497.1|1981182_1981704_-	crossover junction endodeoxyribonuclease RuvC	NA	G3MA90	Bacillus_virus	35.1	4.5e-10
WP_000907238.1|1981740_1982481_-	YebC/PmpR family DNA-binding transcriptional regulator	NA	NA	NA	NA	NA
WP_000795078.1|1982508_1982961_-	dihydroneopterin triphosphate diphosphatase	NA	NA	NA	NA	NA
WP_001258693.1|1983063_1984836_-|tRNA	aspartate--tRNA ligase	tRNA	NA	NA	NA	NA
WP_020844499.1|1985159_1985726_+	hydrolase	NA	NA	NA	NA	NA
WP_020844500.1|1986048_1986720_+	SOS response-associated peptidase	NA	A0A2H4J5W2	uncultured_Caudovirales_phage	60.8	5.8e-79
WP_024143307.1|1988029_1990009_+	MBL fold metallo-hydrolase	NA	A0A2P0VMX1	Tetraselmis_virus	46.2	2.5e-162
1990001:1990016	attL	ACACCATAAATAAACC	NA	NA	NA	NA
WP_020844503.1|1990060_1990852_+	hypothetical protein	NA	NA	NA	NA	NA
WP_020844504.1|1990999_1993126_-|integrase	tyrosine-type recombinase/integrase	integrase	NA	NA	NA	NA
WP_020844508.1|1994416_1994836_-	translesion error-prone DNA polymerase V autoproteolytic subunit	NA	A0A1W6JNS2	Morganella_phage	59.1	5.0e-36
WP_020844509.1|1995008_1995566_-	recombinase family protein	NA	A0A1S6L009	Salmonella_phage	85.8	9.1e-86
WP_020844510.1|1995595_1996714_+	hypothetical protein	NA	A0A1B0VFW4	Salmonella_phage	74.1	1.8e-165
WP_077909569.1|1996683_1997301_+|tail	tail fiber assembly protein	tail	A0A1S6KZY8	Salmonella_phage	83.6	2.8e-96
WP_020844512.1|1997305_1997839_-|tail	tail fiber assembly protein	tail	A0A1S6KZZ1	Salmonella_phage	82.0	1.6e-79
WP_024143309.1|1999938_2000520_-|tail	phage tail protein I	tail	V9IQK7	Stenotrophomonas_phage	34.1	1.0e-18
1998488:1998503	attR	GGTTTATTTATGGTGT	NA	NA	NA	NA
WP_020844514.1|2000512_2001637_-|plate	baseplate J/gp47 family protein	plate	A0A0C5AEG2	Bacteriophage	44.7	9.4e-90
WP_020844515.1|2001633_2001957_-	hypothetical protein	NA	NA	NA	NA	NA
WP_020844516.1|2001953_2002421_-|tail	phage tail protein	tail	NA	NA	NA	NA
WP_020844517.1|2002417_2003038_-|plate	phage baseplate assembly protein V	plate	A0A067ZIM2	Vibrio_phage	55.9	1.3e-32
WP_001623396.1|2003038_2004040_-	phage late control D	NA	A0A0C5AJ59	Bacteriophage	36.3	1.8e-55
WP_001623395.1|2004029_2004248_-|tail	tail protein X	tail	A0A0C5AEF4	Bacteriophage	50.0	3.2e-10
WP_020844518.1|2004240_2006697_-|tail	phage tail tape measure protein	tail	A0A097I4X9	Vibrio_phage	26.1	6.5e-43
WP_001623392.1|2006851_2007133_-|tail	phage tail assembly protein	tail	NA	NA	NA	NA
WP_001623391.1|2007142_2007664_-|tail	phage major tail tube protein	tail	A0A067ZJA9	Vibrio_phage	53.2	1.2e-47
WP_020844519.1|2007676_2009146_-|tail	bacteriophage tail sheath protein	tail	A0A059WKP9	Vibrio_phage	54.7	3.4e-148
WP_001623389.1|2009145_2009445_-	hypothetical protein	NA	NA	NA	NA	NA
WP_021000628.1|2009444_2009930_-	hypothetical protein	NA	A0A067ZIL8	Vibrio_phage	36.0	8.4e-19
WP_020844520.1|2009926_2010271_-	hypothetical protein	NA	A0A067ZJA6	Vibrio_phage	44.9	1.2e-19
WP_020844521.1|2010277_2010733_-	hypothetical protein	NA	NA	NA	NA	NA
WP_020844522.1|2010733_2011777_-|capsid	major capsid protein	capsid	A0A059WRQ2	Vibrio_phage	44.9	2.4e-71
WP_020844523.1|2011792_2012179_-	hypothetical protein	NA	NA	NA	NA	NA
WP_020844524.1|2012189_2013254_-|protease	Clp protease ClpP	protease	A0A067ZG37	Vibrio_phage	51.4	3.4e-81
WP_020844525.1|2013246_2014809_-|portal	phage portal protein	portal	A0A067ZJA4	Vibrio_phage	64.5	3.2e-189
WP_021000635.1|2014805_2015045_-	hypothetical protein	NA	A0A067ZJ01	Vibrio_phage	54.8	6.8e-14
WP_020844526.1|2015056_2016916_-|terminase	phage terminase large subunit family protein	terminase	A0A059WKL6	Vibrio_phage	63.9	3.3e-233
WP_020844527.1|2016921_2017467_-	hypothetical protein	NA	A0A067ZIZ9	Vibrio_phage	37.2	2.6e-16
WP_020844528.1|2017466_2018057_-	ParB N-terminal domain-containing protein	NA	A0A067ZI74	Vibrio_phage	53.7	1.4e-36
WP_024143310.1|2018580_2019297_-	hypothetical protein	NA	NA	NA	NA	NA
WP_021000639.1|2019655_2020192_+	hypothetical protein	NA	NA	NA	NA	NA
WP_024143312.1|2020332_2020893_+	YfbU family protein	NA	NA	NA	NA	NA
WP_020844530.1|2020918_2021467_-	DUF2514 domain-containing protein	NA	NA	NA	NA	NA
WP_020844531.1|2021463_2022078_-	glycoside hydrolase family 19 protein	NA	Q8HA86	Salmonella_phage	92.6	3.2e-108
WP_020844532.1|2022077_2022359_-|holin	phage holin family protein	holin	K7PKN9	Enterobacterial_phage	79.3	8.2e-35
WP_001294873.1|2022345_2022735_-|holin	phage holin family protein	holin	K7PHB9	Enterobacterial_phage	72.5	4.8e-41
WP_000658036.1|2022824_2023013_-	hypothetical protein	NA	NA	NA	NA	NA
WP_024143313.1|2023290_2023656_-	hypothetical protein	NA	R9TR46	Vibrio_phage	59.8	1.8e-18
WP_020844534.1|2023860_2024676_-	antitermination protein	NA	A0A1B5FPA5	Escherichia_phage	73.4	1.2e-113
WP_020844535.1|2024672_2025533_-	hypothetical protein	NA	A0A1B5FPA6	Escherichia_phage	82.8	4.0e-133
WP_020844536.1|2025532_2026498_-	toprim domain-containing protein	NA	A0A1B5FPA8	Escherichia_phage	96.2	1.4e-179
WP_020844537.1|2026494_2028123_-	DEAD/DEAH box helicase	NA	A0A1B5FPA4	Escherichia_phage	86.0	5.4e-280
WP_020844538.1|2028235_2028604_-	hypothetical protein	NA	A0A1B5FPB1	Escherichia_phage	95.9	1.1e-60
WP_023237655.1|2029102_2029357_-	helix-turn-helix transcriptional regulator	NA	A0A2H4JEY0	uncultured_Caudovirales_phage	52.9	5.7e-11
WP_000497764.1|2029469_2030165_+	helix-turn-helix transcriptional regulator	NA	F1C5C2	Cronobacter_phage	67.5	7.4e-85
WP_020844541.1|2030343_2030661_+	hypothetical protein	NA	A0A286S1T9	Klebsiella_phage	51.0	5.1e-17
WP_020844542.1|2030653_2030848_+	hypothetical protein	NA	NA	NA	NA	NA
WP_020844543.1|2030844_2031030_+	hypothetical protein	NA	NA	NA	NA	NA
WP_020844544.1|2031217_2031427_+	hypothetical protein	NA	NA	NA	NA	NA
WP_020844545.1|2031407_2031767_+	hypothetical protein	NA	A0A1B5FPB3	Escherichia_phage	53.8	3.6e-27
WP_020844546.1|2031766_2032003_+	hypothetical protein	NA	A0A286SGR4	Klebsiella_phage	61.4	6.9e-19
WP_020844547.1|2031992_2032400_+	hypothetical protein	NA	A0A286S1S2	Klebsiella_phage	83.6	2.0e-61
WP_020844548.1|2032411_2033161_+	ORF6N domain-containing protein	NA	A0A1B5FPC0	Escherichia_phage	93.1	5.6e-131
WP_170908756.1|2033469_2033724_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000687973.1|2033720_2033945_+	hypothetical protein	NA	A0A1B5FPG2	Escherichia_phage	69.4	1.3e-19
WP_020844550.1|2033941_2034154_+	hypothetical protein	NA	A0A286S2B6	Klebsiella_phage	74.3	5.4e-23
WP_020844551.1|2034150_2034612_+	hypothetical protein	NA	A0A1B5FPC7	Escherichia_phage	52.6	3.9e-42
WP_020844552.1|2034823_2034970_+	hypothetical protein	NA	A0A1B5FPC2	Escherichia_phage	81.2	1.8e-17
WP_024143316.1|2034977_2035214_+	excisionase family protein	NA	Q8W657	Enterobacteria_phage	93.6	3.5e-39
WP_020844553.1|2035272_2036586_+	DUF3596 domain-containing protein	NA	Q8W658	Enterobacteria_phage	87.2	2.1e-226
WP_049823118.1|2036564_2037338_+	DUF72 domain-containing protein	NA	Q859D1	Escherichia_coli_phage	79.5	2.5e-57
WP_000252974.1|2037389_2037785_+	MAPEG family protein	NA	NA	NA	NA	NA
WP_000019580.1|2037824_2038568_+	carboxy-S-adenosyl-L-methionine synthase CmoA	NA	F5B419	Synechococcus_phage	30.0	1.0e-23
WP_000569031.1|2038564_2039536_+|tRNA	tRNA 5-methoxyuridine(34)/uridine 5-oxyacetic acid(34) synthase CmoB	tRNA	NA	NA	NA	NA
WP_020844555.1|2039771_2040518_-	copper homeostasis protein CutC	NA	NA	NA	NA	NA
WP_020844556.1|2040536_2041106_-	VOC family protein	NA	NA	NA	NA	NA
WP_020844557.1|2041342_2043076_+|tRNA	arginine--tRNA ligase	tRNA	A0A2K9L6Z2	Tupanvirus	33.6	9.8e-86
>prophage 5
NC_021870	Salmonella bongori N268-08, complete sequence	4683551	2262834	2271450	4683551	tRNA	Enterobacteria_phage(66.67%)	9	NA	NA
WP_020844708.1|2262834_2264868_+|tRNA	methionine--tRNA ligase	tRNA	A0A1V0SDF2	Indivirus	27.4	2.8e-55
WP_000703144.1|2265136_2265595_+	YehR family lipoprotein	NA	Q9EYF5	Enterobacteria_phage	69.9	7.1e-52
WP_020844709.1|2265758_2266229_-	DUF1456 family protein	NA	Q9EYF4	Enterobacteria_phage	91.7	1.5e-76
WP_000598645.1|2266275_2266995_-	two-component system response regulator BtsR	NA	NA	NA	NA	NA
WP_000272843.1|2266991_2268677_-	sensor histidine kinase	NA	Q9EYF3	Enterobacteria_phage	89.3	4.6e-274
WP_001240383.1|2268899_2269640_+	HTH-type transcriptional regulator MlrA	NA	Q9EYF2	Enterobacteria_phage	88.1	1.3e-100
WP_001234243.1|2269699_2269807_+	protein YohO	NA	NA	NA	NA	NA
WP_000824740.1|2269787_2270519_-	ABC transporter permease	NA	NA	NA	NA	NA
WP_020844710.1|2270502_2271450_-	ABC transporter ATP-binding protein	NA	F2Y1V5	Organic_Lake_phycodnavirus	27.5	6.2e-10
>prophage 6
NC_021870	Salmonella bongori N268-08, complete sequence	4683551	2701002	2815763	4683551	capsid,holin,transposase,plate,lysis,head,tail,terminase,portal,integrase,tRNA	Salmonella_phage(46.55%)	106	2707004:2707019	2771684:2771699
WP_000083188.1|2701002_2701740_-|tRNA	tRNA(1)(Val) (adenine(37)-N(6))-methyltransferase TrmN	tRNA	NA	NA	NA	NA
WP_020844963.1|2701869_2703204_+	ATP-dependent RNA helicase SrmB	NA	A0A1B1IS59	uncultured_Mediterranean_phage	29.5	6.0e-43
WP_020844964.1|2703221_2704121_-	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_020844965.1|2704223_2704811_+	cysteine/O-acetylserine transporter	NA	NA	NA	NA	NA
WP_000627811.1|2704872_2705256_-	autonomous glycyl radical cofactor GrcA	NA	Q7Y524	Enterobacteria_phage	74.0	6.1e-33
WP_020844966.1|2705574_2706264_+	uracil-DNA glycosylase	NA	A0A172DS90	Canid_alphaherpesvirus	49.5	9.3e-56
WP_000997356.1|2706369_2707407_-|tRNA	tRNA/rRNA methyltransferase	tRNA	NA	NA	NA	NA
2707004:2707019	attL	CTCTGGATAAACCAGG	NA	NA	NA	NA
WP_001098730.1|2707610_2708030_+	thioredoxin TrxC	NA	A0A0K2FIM3	Achromobacter_phage	39.6	3.4e-16
WP_000131406.1|2708102_2708801_+|tRNA	tRNA-uridine aminocarboxypropyltransferase	tRNA	NA	NA	NA	NA
WP_020844967.1|2708836_2711497_+	protein lysine acetyltransferase	NA	NA	NA	NA	NA
WP_000949280.1|2711611_2712967_+	CDP-diacylglycerol--serine O-phosphatidyltransferase	NA	NA	NA	NA	NA
WP_020844968.1|2713011_2713335_+	YfiM family lipoprotein	NA	NA	NA	NA	NA
WP_020844969.1|2713331_2714633_-	MFS transporter	NA	Q6JIH2	Burkholderia_virus	30.1	2.9e-42
WP_020844970.1|2714736_2715192_-	DUF4385 domain-containing protein	NA	E3SMI8	Prochlorococcus_phage	49.3	2.5e-33
WP_001235097.1|2720995_2723569_-	ATP-dependent chaperone ClpB	NA	H6X3M6	Enterobacteria_phage	35.5	3.4e-127
WP_020844971.1|2723698_2724430_-	polyphenol oxidase	NA	NA	NA	NA	NA
WP_020844972.1|2724426_2725407_-	23S rRNA pseudouridine(1911/1915/1917) synthase RluD	NA	NA	NA	NA	NA
WP_020844973.1|2725538_2726276_+	outer membrane protein assembly factor BamD	NA	NA	NA	NA	NA
WP_000178448.1|2726543_2726882_+	ribosome-associated translation inhibitor RaiA	NA	NA	NA	NA	NA
WP_020844974.1|2727042_2727234_+	hypothetical protein	NA	NA	NA	NA	NA
WP_024143378.1|2727384_2728038_-	EspJ family T3SS effector ADP-ribosyltransferase	NA	NA	NA	NA	NA
WP_077909579.1|2728956_2729385_+	pertussis toxin	NA	NA	NA	NA	NA
WP_179124424.1|2729707_2729755_+	pheA operon leader peptide PheL	NA	NA	NA	NA	NA
WP_000200073.1|2729854_2731015_+	bifunctional chorismate mutase/prephenate dehydratase	NA	NA	NA	NA	NA
WP_020844976.1|2730975_2731884_-	SMP-30/gluconolactonase/LRE family protein	NA	NA	NA	NA	NA
WP_020844977.1|2731943_2733065_-	bifunctional chorismate mutase/prephenate dehydrogenase	NA	NA	NA	NA	NA
WP_001168064.1|2733074_2734145_-	3-deoxy-7-phosphoheptulonate synthase AroF	NA	A0A0F6R6T6	Escherichia_coli_O157_typing_phage	51.7	1.5e-89
WP_024143380.1|2735091_2736312_+	diguanylate cyclase DgcN	NA	A0A127AWB9	Bacillus_phage	32.1	1.7e-12
WP_000218686.1|2738042_2739092_-|integrase	site-specific integrase	integrase	A0A0M4S6G4	Salmonella_phage	99.7	3.3e-206
WP_000382813.1|2739113_2739677_-	WYL domain-containing protein	NA	NA	NA	NA	NA
WP_020844986.1|2739676_2740519_-	phage repressor protein CI	NA	Q6K1G0	Salmonella_virus	70.4	5.9e-113
WP_001278192.1|2740632_2740986_+	hypothetical protein	NA	Q6K1F9	Salmonella_virus	100.0	2.3e-58
WP_020844987.1|2741036_2741546_+	phage regulatory CII family protein	NA	Q6K1F8	Salmonella_virus	96.4	4.0e-88
WP_020844988.1|2741553_2741754_+	DUF2724 domain-containing protein	NA	Q6K1F7	Salmonella_virus	92.4	7.4e-30
WP_000963462.1|2741717_2742056_+	DUF5347 domain-containing protein	NA	A0A218M4I7	Erwinia_phage	93.8	6.2e-53
WP_001168393.1|2742123_2742351_+	DUF2732 domain-containing protein	NA	A0A0M3UL87	Salmonella_phage	70.1	1.1e-16
WP_020844989.1|2742350_2742578_+	TraR/DksA family transcriptional regulator	NA	A0A0M4S5Q7	Salmonella_phage	87.5	3.2e-29
WP_020844990.1|2742574_2743159_+	3'-5' exonuclease	NA	A0A1S6L012	Salmonella_phage	78.2	3.6e-85
WP_020844991.1|2743155_2743560_+	hypothetical protein	NA	NA	NA	NA	NA
WP_020844992.1|2743556_2743829_+	DUF5405 family protein	NA	A0A218M4I8	Erwinia_phage	80.0	3.0e-34
WP_020844993.1|2743825_2744632_+	DNA cytosine methyltransferase	NA	D2XJJ8	Escherichia_phage	55.1	2.1e-75
WP_042917005.1|2744625_2746848_+	replication endonuclease	NA	A0A218M4H2	Erwinia_phage	97.0	0.0e+00
WP_000232650.1|2746965_2747148_+	hypothetical protein	NA	A0A0M5M1G5	Salmonella_phage	100.0	4.1e-27
WP_001222154.1|2747151_2747385_+	DinI family protein	NA	A0A0M4S6H1	Salmonella_phage	98.7	8.0e-36
WP_020844995.1|2747578_2747788_+	hypothetical protein	NA	Q6K1F0	Salmonella_virus	92.8	6.3e-32
WP_020844996.1|2747921_2748116_+	hypothetical protein	NA	S4TRZ0	Salmonella_phage	84.4	1.4e-20
WP_042917008.1|2748145_2748406_-	hypothetical protein	NA	A0A0M4R4Y4	Salmonella_phage	87.5	1.4e-20
WP_015973893.1|2748635_2749658_-|portal	phage portal protein	portal	Q6K1J0	Salmonella_virus	100.0	6.6e-199
WP_020845000.1|2749654_2750401_-	hypothetical protein	NA	Q6K1I9	Salmonella_virus	96.8	5.6e-139
WP_000156057.1|2750397_2752170_-|terminase	terminase ATPase subunit family protein	terminase	S4TT96	Salmonella_phage	99.8	0.0e+00
WP_020845001.1|2752335_2753190_+|capsid	GPO family capsid scaffolding protein	capsid	Q6K1I7	Salmonella_virus	99.6	2.8e-158
WP_020845002.1|2753266_2754334_+|capsid	phage major capsid protein, P2 family	capsid	S4TUA6	Salmonella_phage	98.0	3.0e-194
WP_000203472.1|2754337_2755087_+|terminase	terminase endonuclease subunit	terminase	Q6K1I5	Salmonella_virus	98.4	1.5e-128
WP_000214255.1|2755180_2755687_+|head	head completion/stabilization protein	head	S4TNY1	Salmonella_phage	100.0	1.3e-91
WP_000870102.1|2755686_2755890_+|tail	tail protein X	tail	S4TTA0	Salmonella_phage	97.0	8.8e-31
WP_000134659.1|2755893_2756190_+|holin	phage holin family protein	holin	S4TP56	Salmonella_phage	100.0	4.4e-47
WP_001144116.1|2756176_2756674_+	glycoside hydrolase family 104 protein	NA	S4TUB1	Salmonella_phage	99.4	1.2e-92
WP_016505037.1|2756670_2757084_+|lysis	LysB family phage lysis regulatory protein	lysis	S4TRW3	Salmonella_phage	98.5	6.4e-44
WP_001394645.1|2757055_2757229_+	hypothetical protein	NA	S4TNY4	Salmonella_phage	98.2	2.8e-25
WP_001169074.1|2757191_2757659_+|tail	phage tail protein	tail	S4TTA5	Salmonella_phage	100.0	1.1e-84
WP_020845003.1|2757651_2758101_+	phage virion morphogenesis protein	NA	S4TP59	Salmonella_phage	98.7	7.1e-73
WP_020845004.1|2758169_2758811_+|plate	phage baseplate assembly protein V	plate	Q6K1H6	Salmonella_virus	97.7	1.0e-112
WP_000127177.1|2758807_2759155_+	GPW/gp25 family protein	NA	A0A0M4RE59	Salmonella_phage	98.3	7.2e-57
WP_020845005.1|2759161_2760070_+|plate	baseplate assembly protein	plate	A0A1J0I2M3	Salmonella_phage	99.7	3.1e-160
WP_015973904.1|2760062_2760593_+|tail	phage tail protein I	tail	Q6K1H3	Salmonella_virus	100.0	4.1e-104
WP_020845007.1|2760603_2762580_+|tail	tail fiber protein	tail	S4TP62	Salmonella_phage	96.4	7.3e-312
WP_020845008.1|2762592_2763141_+|tail	tail fiber assembly protein	tail	S4TUB9	Salmonella_phage	98.9	8.4e-100
WP_001279033.1|2763275_2764463_+|tail	phage tail sheath protein	tail	Q6K1H0	Salmonella_virus	99.5	9.9e-223
WP_001207675.1|2764478_2764997_+|tail	phage major tail tube protein	tail	S4TNZ0	Salmonella_phage	100.0	6.5e-94
WP_001029726.1|2765059_2765395_+|tail	phage tail assembly protein	tail	S4TTB2	Salmonella_phage	100.0	1.4e-52
WP_085984508.1|2765391_2765547_+|tail	GpE family phage tail protein	tail	Q6K1G8	Salmonella_virus	98.0	8.8e-23
WP_020845009.1|2765539_2767981_+|tail	phage tail tape measure protein	tail	S4TP64	Salmonella_phage	85.7	1.0e-306
WP_020845010.1|2767995_2768481_+|tail	phage tail protein	tail	A0A0M4RCP0	Salmonella_phage	98.8	1.8e-85
WP_020845011.1|2768477_2769647_+	phage late control D family protein	NA	A0A0M5M5V5	Salmonella_phage	98.2	1.2e-212
WP_024143382.1|2769722_2769941_+	DNA-binding transcriptional regulator	NA	Q37973	Salmonella_virus	98.6	4.7e-38
WP_000065256.1|2770085_2770433_-	50S ribosomal protein L19	NA	NA	NA	NA	NA
WP_000469808.1|2770474_2771242_-|tRNA	tRNA (guanosine(37)-N1)-methyltransferase TrmD	tRNA	NA	NA	NA	NA
WP_000043339.1|2771286_2771835_-	ribosome maturation factor RimM	NA	NA	NA	NA	NA
2771684:2771699	attR	CTCTGGATAAACCAGG	NA	NA	NA	NA
WP_000256452.1|2771853_2772102_-	30S ribosomal protein S16	NA	NA	NA	NA	NA
WP_000460058.1|2772371_2773733_-	signal recognition particle protein	NA	NA	NA	NA	NA
WP_015702975.1|2773898_2774690_+	inner membrane protein YpjD	NA	NA	NA	NA	NA
WP_138993401.1|2774709_2775996_+	DUF21 domain-containing protein	NA	NA	NA	NA	NA
WP_015702976.1|2776055_2776649_-	nucleotide exchange factor GrpE	NA	NA	NA	NA	NA
WP_020845015.1|2776771_2777650_+	NAD(+) kinase	NA	NA	NA	NA	NA
WP_020845017.1|2777735_2779397_+	DNA repair protein RecN	NA	NA	NA	NA	NA
WP_001203441.1|2779546_2779885_+	outer membrane protein assembly factor BamE	NA	NA	NA	NA	NA
WP_001112989.1|2780051_2780342_-	RnfH family protein	NA	NA	NA	NA	NA
WP_000242606.1|2780331_2780808_-	type II toxin-antitoxin system RatA family toxin	NA	NA	NA	NA	NA
WP_001518569.1|2780957_2781440_+	SsrA-binding protein SmpB	NA	W5RAM5	Staphylococcus_phage	47.4	5.2e-29
WP_020845019.1|2782057_2793529_+	biofilm-associated protein BapA	NA	NA	NA	NA	NA
WP_000533844.1|2793594_2795004_+	TolC family outer membrane protein	NA	NA	NA	NA	NA
WP_020845020.1|2795000_2797181_+	type I secretion system permease/ATPase	NA	F2Y302	Organic_Lake_phycodnavirus	34.0	2.2e-18
WP_077909627.1|2797188_2798352_+	HlyD family type I secretion periplasmic adaptor subunit	NA	NA	NA	NA	NA
WP_024143384.1|2799457_2800420_+	VirK family antimicrobial peptide resistance protein	NA	NA	NA	NA	NA
WP_020845025.1|2801329_2802343_-	HoxN/HupN/NixA family nickel/cobalt transporter	NA	NA	NA	NA	NA
WP_000872350.1|2802475_2803894_-	sensor histidine kinase	NA	NA	NA	NA	NA
WP_001237928.1|2803880_2804555_-	transcriptional regulator TctD	NA	NA	NA	NA	NA
WP_020845027.1|2804709_2805687_+	tripartite tricarboxylate transporter substrate binding protein	NA	NA	NA	NA	NA
WP_001283753.1|2805701_2806133_+	tripartite tricarboxylate transporter TctB family protein	NA	NA	NA	NA	NA
WP_000382026.1|2806143_2807658_+	tripartite tricarboxylate transporter permease	NA	NA	NA	NA	NA
WP_020845028.1|2807989_2808967_+	carbon starvation induced protein CsiD	NA	NA	NA	NA	NA
WP_020845029.1|2808993_2810262_+	L-2-hydroxyglutarate oxidase	NA	NA	NA	NA	NA
WP_020845030.1|2810283_2811732_+	NADP-dependent succinate-semialdehyde dehydrogenase	NA	NA	NA	NA	NA
WP_001095410.1|2811746_2813030_+	4-aminobutyrate--2-oxoglutarate transaminase	NA	A0A1V0SKB7	Klosneuvirus	30.5	6.7e-31
WP_000531293.1|2813142_2814543_+	GABA permease	NA	NA	NA	NA	NA
WP_000502119.1|2815304_2815763_-|transposase	IS200/IS605-like element IS200F family transposase	transposase	I4AZI8	Saccharomonospora_phage	31.5	1.0e-13
>prophage 7
NC_021870	Salmonella bongori N268-08, complete sequence	4683551	3226344	3289679	4683551	capsid,holin,plate,tRNA,head,terminase,portal,integrase,tail	Cronobacter_phage(68.42%)	67	3232666:3232713	3263840:3263887
WP_001264346.1|3226344_3227358_-|tRNA	tRNA (adenosine(37)-N6)-threonylcarbamoyltransferase complex transferase subunit TsaD	tRNA	A0A0R6PI74	Moraxella_phage	58.3	4.5e-107
WP_001144069.1|3227595_3227811_+	30S ribosomal protein S21	NA	NA	NA	NA	NA
WP_000918858.1|3228114_3229860_+	DNA primase	NA	A0A0K1LMQ9	Caulobacter_phage	38.4	4.7e-72
WP_001519776.1|3230009_3231857_+	RNA polymerase sigma factor RpoD	NA	A0A2I7SAT0	Vibrio_phage	33.7	8.4e-35
WP_000237774.1|3232002_3232509_-	G/U mismatch-specific DNA glycosylase	NA	NA	NA	NA	NA
3232666:3232713	attL	CTCATAATCGCTTGGTCGCTGGTTCAAGTCCAGCAGGGGCCACCAAAT	NA	NA	NA	NA
WP_024143411.1|3232821_3233445_+	hypothetical protein	NA	NA	NA	NA	NA
WP_020845287.1|3234094_3235798_-	hypothetical protein	NA	F1BUJ7	Cronobacter_phage	81.4	7.6e-224
WP_000200789.1|3235797_3236343_-	hypothetical protein	NA	F1BUJ9	Cronobacter_phage	72.0	3.2e-59
WP_020845288.1|3236314_3237040_-	hypothetical protein	NA	F1BUK1	Cronobacter_phage	56.4	5.0e-68
WP_000421117.1|3237029_3237557_-|tail	tail fiber assembly protein	tail	A0A0U2QV64	Escherichia_phage	52.6	3.1e-51
WP_020845289.1|3237574_3239602_-|tail	phage tail protein	tail	F1BUK3	Cronobacter_phage	47.5	3.1e-155
WP_020845290.1|3239611_3240199_-|tail	bacteriophage P2-related tail formation protein	tail	F1BUK5	Cronobacter_phage	81.0	6.0e-88
WP_020845291.1|3240191_3241376_-|plate	baseplate J/gp47 family protein	plate	F1BUK6	Cronobacter_phage	78.1	1.5e-178
WP_001002797.1|3241372_3241702_-	DUF2590 family protein	NA	F1BUK8	Cronobacter_phage	72.4	3.8e-39
WP_020845292.1|3241698_3243669_-|tail	phage tail tape measure protein	tail	F1BUK9	Cronobacter_phage	68.6	2.1e-265
WP_000411339.1|3243856_3244114_-|tail	putative phage tail assembly chaperone	tail	A5X9I7	Aeromonas_virus	63.4	3.6e-21
WP_000376375.1|3244260_3244593_-	hypothetical protein	NA	F1BUL2	Cronobacter_phage	71.8	6.7e-36
WP_000175560.1|3244592_3244934_-	M15 family metallopeptidase	NA	F1BUL3	Cronobacter_phage	91.1	2.2e-50
WP_001154425.1|3244930_3245224_-|holin	phage holin family protein	holin	C7BGD7	Burkholderia_phage	46.2	1.3e-14
WP_000166743.1|3245233_3245689_-	DUF2597 family protein	NA	F1BUL4	Cronobacter_phage	72.2	1.5e-57
WP_000220203.1|3245685_3246813_-	DUF2586 family protein	NA	F1BUL5	Cronobacter_phage	83.7	1.9e-175
WP_000560083.1|3246809_3247517_-	hypothetical protein	NA	F1BUL6	Cronobacter_phage	76.9	6.8e-102
WP_000084220.1|3247513_3248020_-|tail	phage tail protein	tail	F1BUL7	Cronobacter_phage	69.8	5.2e-64
WP_001680743.1|3248016_3248469_-|head	head completion/stabilization protein	head	F1BUL8	Cronobacter_phage	82.7	1.6e-64
WP_020845293.1|3248565_3249267_-|terminase	phage terminase endonuclease subunit	terminase	F1BUM0	Cronobacter_phage	66.8	2.7e-87
WP_000550496.1|3249270_3250293_-|capsid	phage major capsid protein, P2 family	capsid	F1BUM2	Cronobacter_phage	81.2	1.1e-158
WP_020845294.1|3250354_3251158_-|capsid	GPO family capsid scaffolding protein	capsid	F1BUM4	Cronobacter_phage	56.0	2.0e-78
WP_020845295.1|3251318_3253094_+|terminase	phage terminase ATPase subunit	terminase	F1BUM5	Cronobacter_phage	83.4	1.5e-291
WP_000038208.1|3253090_3254152_+|portal	phage portal protein	portal	F1BUM7	Cronobacter_phage	77.1	2.3e-162
WP_042917050.1|3254148_3254472_+	ogr/Delta-like zinc finger family protein	NA	F1BUM8	Cronobacter_phage	87.1	2.6e-45
WP_000468061.1|3254622_3255660_+	DUF2806 domain-containing protein	NA	NA	NA	NA	NA
WP_000364822.1|3255831_3256014_-	hypothetical protein	NA	NA	NA	NA	NA
WP_020845297.1|3256133_3258155_-	replication endonuclease	NA	F1BUM9	Cronobacter_phage	74.6	5.5e-298
WP_000279402.1|3258151_3259012_-	Dam family site-specific DNA-(adenine-N6)-methyltransferase	NA	F1BUN1	Cronobacter_phage	83.8	2.4e-133
WP_000057336.1|3259002_3259233_-	DUF2732 family protein	NA	NA	NA	NA	NA
WP_000022785.1|3259300_3259702_-	hypothetical protein	NA	F1BUN2	Cronobacter_phage	66.9	1.4e-48
WP_000996837.1|3259701_3260127_-	hypothetical protein	NA	F1BUN5	Cronobacter_phage	49.6	2.2e-23
WP_020845298.1|3260116_3260344_-	DUF2724 domain-containing protein	NA	NA	NA	NA	NA
WP_000460878.1|3260353_3260857_-	phage regulatory CII family protein	NA	F1BUN6	Cronobacter_phage	72.5	3.5e-60
WP_001247709.1|3260887_3261109_-	hypothetical protein	NA	NA	NA	NA	NA
WP_042917058.1|3261228_3261807_+	phage repressor protein CI	NA	A0A218M4J1	Erwinia_phage	39.5	1.5e-27
WP_020845300.1|3261835_3262729_+	hypothetical protein	NA	NA	NA	NA	NA
WP_020845301.1|3262715_3263753_+|integrase	tyrosine-type recombinase/integrase	integrase	F1BUS9	Erwinia_phage	65.6	7.1e-124
WP_024143416.1|3264004_3264370_-	hypothetical protein	NA	NA	NA	NA	NA
3263840:3263887	attR	CTCATAATCGCTTGGTCGCTGGTTCAAGTCCAGCAGGGGCCACCAAAT	NA	NA	NA	NA
WP_024143417.1|3264579_3264948_+	C40 family peptidase	NA	NA	NA	NA	NA
WP_020845303.1|3264947_3265451_+	YbjP/YqhG family protein	NA	NA	NA	NA	NA
WP_000213737.1|3265761_3266529_-	siderophore-interacting protein	NA	NA	NA	NA	NA
WP_000983440.1|3266757_3267405_+	PadR family transcriptional regulator	NA	NA	NA	NA	NA
WP_000478452.1|3267401_3268967_-	MCP four helix bundle domain-containing protein	NA	A0A2H4J162	uncultured_Caudovirales_phage	33.9	1.0e-12
WP_000094659.1|3269311_3270832_-	PAS domain-containing methyl-accepting chemotaxis protein	NA	A0A1B0V854	Salmonella_phage	39.1	8.4e-33
WP_020845306.1|3271261_3272641_+	putrescine aminotransferase	NA	A0A1V0SKB7	Klosneuvirus	28.8	1.4e-31
WP_020845308.1|3272809_3274828_+	NADPH-dependent 2,4-dienoyl-CoA reductase	NA	NA	NA	NA	NA
WP_020845309.1|3274921_3276058_-	23S rRNA (guanine(1835)-N(2))-methyltransferase RlmG	NA	NA	NA	NA	NA
WP_000202735.1|3276143_3276641_+	M48 family metallopeptidase	NA	NA	NA	NA	NA
WP_024143419.1|3276792_3277485_+	vancomycin high temperature exclusion protein	NA	NA	NA	NA	NA
WP_020845311.1|3277572_3278571_+	Gfo/Idh/MocA family oxidoreductase	NA	NA	NA	NA	NA
WP_001098831.1|3278840_3279809_+	TerC family protein	NA	I7HPH5	Enterobacteria_phage	34.9	7.2e-38
WP_000235302.1|3280062_3281307_+	serine/threonine transporter SstT	NA	NA	NA	NA	NA
WP_020845312.1|3281396_3282884_-	altronate dehydratase	NA	NA	NA	NA	NA
WP_020845313.1|3282898_3284311_-	glucuronate isomerase	NA	NA	NA	NA	NA
WP_001226461.1|3284781_3286080_+	MFS transporter	NA	NA	NA	NA	NA
WP_000406481.1|3286244_3287021_+	transcriptional regulator ExuR	NA	NA	NA	NA	NA
WP_000422141.1|3287369_3288032_+	DedA family protein	NA	NA	NA	NA	NA
WP_000917519.1|3288035_3288419_+	EnvZ/OmpR regulon moderator MzrA	NA	NA	NA	NA	NA
WP_020845315.1|3288562_3288931_+	DUF1090 domain-containing protein	NA	NA	NA	NA	NA
WP_000031219.1|3288972_3289278_+	DUF883 domain-containing protein	NA	NA	NA	NA	NA
WP_000785625.1|3289280_3289679_+|holin	phage holin family protein	holin	NA	NA	NA	NA
>prophage 1
NC_021871	Salmonella bongori N268-08 plasmid RM1, complete sequence	89986	49062	56373	89986	transposase	Salmonella_phage(33.33%)	8	NA	NA
WP_020842520.1|49062_49743_-	DNA methylase	NA	A0A2I7RE86	Vibrio_phage	36.0	4.8e-28
WP_020842521.1|50119_50455_-	hypothetical protein	NA	NA	NA	NA	NA
WP_020842522.1|50451_50919_-	hypothetical protein	NA	NA	NA	NA	NA
WP_020842523.1|51449_51872_+	translesion error-prone DNA polymerase V autoproteolytic subunit	NA	A0A1W6JNS2	Morganella_phage	50.8	8.6e-28
WP_020842525.1|51871_52756_+	translesion error-prone DNA polymerase V subunit UmuC	NA	I6RSM4	Salmonella_phage	46.4	2.2e-94
WP_020842526.1|52837_53812_-	ParB/RepB/Spo0J family partition protein	NA	A0A1B0V750	Salmonella_phage	52.6	4.4e-83
WP_000427674.1|53811_55017_-	AAA family ATPase	NA	A0A077SL49	Escherichia_phage	69.6	1.4e-163
WP_020842527.1|55443_56373_+|transposase	Rpn family recombination-promoting nuclease/putative transposase	transposase	Q2A0A7	Sodalis_phage	54.3	3.5e-74
