The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
NC_021826	Listeria monocytogenes, complete sequence	3094342	137541	194392	3094342	tRNA,protease	Bacillus_virus(16.67%)	56	NA	NA
WP_003727526.1|137541_138681_-|protease	PrsW family intramembrane metalloprotease	protease	NA	NA	NA	NA
WP_003723563.1|138760_139156_-	helix-turn-helix transcriptional regulator	NA	A9D9J6	Lactobacillus_prophage	57.4	1.3e-14
WP_003727524.1|139306_139522_+	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_003727523.1|139645_140179_+|protease	matrixin family metalloprotease	protease	NA	NA	NA	NA
WP_003731300.1|140194_140860_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003727521.1|141121_142060_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003723884.1|142174_143458_+	trigger factor	NA	NA	NA	NA	NA
WP_003723886.1|143642_144902_+|protease	ATP-dependent protease ATP-binding subunit ClpX	protease	G3M9Z9	Bacillus_virus	63.2	1.4e-145
WP_003726393.1|145020_145587_+	type I signal peptidase SipX	NA	NA	NA	NA	NA
WP_003731301.1|145621_146191_+	type I signal peptidase SipY	NA	NA	NA	NA	NA
WP_003727520.1|146292_146835_+	type I signal peptidase SipZ	NA	NA	NA	NA	NA
WP_003726396.1|146844_147708_+	ribosome biogenesis GTPase YlqF	NA	NA	NA	NA	NA
WP_003727519.1|147704_148490_+	ribonuclease HII	NA	G4YAY0	Emiliania_huxleyi_virus	37.6	6.7e-26
WP_003727518.1|148623_149484_+	DNA-protecting protein DprA	NA	NA	NA	NA	NA
WP_003727517.1|149756_151835_+	type I DNA topoisomerase	NA	A0A1V0SB35	Catovirus	37.5	5.4e-107
WP_003731302.1|151897_153202_+|tRNA	FADH(2)-oxidizing methylenetetrahydrofolate--tRNA-(uracil(54)-C(5))- methyltransferase TrmFO	tRNA	NA	NA	NA	NA
WP_003731303.1|153484_154387_+	tyrosine recombinase XerC	NA	A0A142K7N4	Mycobacterium_phage	29.5	1.8e-14
WP_003724001.1|154407_154947_+|protease	ATP-dependent protease subunit HslV	protease	NA	NA	NA	NA
WP_003727514.1|154960_156370_+|protease	ATP-dependent protease ATPase subunit HslU	protease	W6AS21	Erwinia_phage	27.8	7.5e-44
WP_003726695.1|156390_157170_+	GTP-sensing pleiotropic transcriptional regulator CodY	NA	NA	NA	NA	NA
WP_003727513.1|157272_157692_+	acyl-CoA thioesterase	NA	NA	NA	NA	NA
WP_003724130.1|157714_158026_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003726697.1|158028_158901_+	aldose 1-epimerase family protein	NA	NA	NA	NA	NA
WP_003726698.1|158942_159539_-	glycerol-3-phosphate 1-O-acyltransferase PlsY	NA	NA	NA	NA	NA
WP_003731304.1|159696_160104_+	CoA-binding protein	NA	NA	NA	NA	NA
WP_003727510.1|160284_162252_+	DNA topoisomerase IV subunit B	NA	G3M9Z3	Bacillus_virus	42.5	5.1e-123
WP_003727509.1|162248_164708_+	DNA topoisomerase IV subunit A	NA	G3M9Z5	Bacillus_virus	31.8	1.1e-101
WP_003726814.1|164790_165258_+	S-ribosylhomocysteine lyase	NA	NA	NA	NA	NA
WP_003731305.1|165885_167706_+	class 1 internalin InlK	NA	NA	NA	NA	NA
WP_003727507.1|167738_169625_-	peptidoglycan O-acetyltransferase OatA	NA	B5WZU0	Pseudomonas_phage	32.2	3.8e-43
WP_003726657.1|169837_170536_+	glycerophosphodiester phosphodiesterase	NA	A0A0S2MYI4	Enterococcus_phage	31.9	6.4e-12
WP_003723738.1|170768_172445_+	glycerol-3-phosphate dehydrogenase/oxidase	NA	NA	NA	NA	NA
WP_003726658.1|172571_173489_+|tRNA	tRNA (adenosine(37)-N6)-dimethylallyltransferase MiaA	tRNA	NA	NA	NA	NA
WP_003719566.1|173610_173844_+	RNA chaperone Hfq	NA	NA	NA	NA	NA
WP_012681271.1|173954_175178_+	GTPase HflX	NA	NA	NA	NA	NA
WP_003727505.1|175170_176397_+	methionine gamma-lyase family protein	NA	NA	NA	NA	NA
WP_003719570.1|176598_176967_+	MerR family transcriptional regulator	NA	NA	NA	NA	NA
WP_003723435.1|177037_178372_+	type I glutamate--ammonia ligase	NA	A0A1V0SJ53	Klosneuvirus	26.4	2.0e-06
WP_003731338.1|178515_179811_+	arsenic transporter	NA	A0A2H4PQU3	Staphylococcus_phage	62.1	1.3e-146
WP_003726565.1|179844_180369_-	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_003723438.1|180399_181014_-	transcriptional repressor LexA	NA	A0A1B2APZ1	Phage_Wrath	62.1	9.3e-15
WP_003727502.1|181169_181499_+	cell division suppressor protein YneA	NA	NA	NA	NA	NA
WP_003727501.1|181592_181820_+	DUF896 domain-containing protein	NA	NA	NA	NA	NA
WP_003731337.1|181966_183961_+	transketolase	NA	NA	NA	NA	NA
WP_003726667.1|184181_184421_+	YneF family protein	NA	NA	NA	NA	NA
WP_003726668.1|184469_185201_-	class I SAM-dependent methyltransferase	NA	A0A1X9I6N4	Streptococcus_phage	58.0	2.3e-81
WP_003726669.1|185222_185729_-	ParB-like nuclease domain-containing protein	NA	A0A220GKT8	Streptococcus_phage	66.7	1.4e-56
WP_003731336.1|185738_187043_-	DUF3440 domain-containing protein	NA	A0A220GKF8	Streptococcus_phage	52.1	1.2e-133
WP_012681273.1|187032_188238_-	helicase SNF2	NA	L0P6E9	Lactobacillus_phage	46.6	7.0e-91
WP_003727498.1|188215_188590_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003723449.1|188882_189611_+	UMP kinase	NA	NA	NA	NA	NA
WP_003723450.1|189610_190168_+	ribosome recycling factor	NA	NA	NA	NA	NA
WP_003727497.1|190398_191157_+	isoprenyl transferase	NA	R9W0U9	Flavobacterium_phage	42.1	4.4e-22
WP_003727496.1|191170_191959_+	phosphatidate cytidylyltransferase	NA	NA	NA	NA	NA
WP_003731335.1|191973_193116_+	1-deoxy-D-xylulose-5-phosphate reductoisomerase	NA	NA	NA	NA	NA
WP_003726415.1|193129_194392_+|protease	RIP metalloprotease RseP	protease	NA	NA	NA	NA
>prophage 2
NC_021826	Listeria monocytogenes, complete sequence	3094342	555609	603125	3094342	terminase,plate,integrase,head,holin	Listeria_phage(98.63%)	75	555056:555075	603159:603178
555056:555075	attL	ATCCCACAAAAATCCCACAA	NA	NA	NA	NA
WP_003731544.1|555609_555975_+	hypothetical protein	NA	A8ATJ4	Listeria_phage	94.2	6.4e-56
WP_023559354.1|555988_556192_+	hypothetical protein	NA	A8ATJ3	Listeria_phage	95.5	2.6e-30
WP_003731542.1|556219_556441_+	helix-turn-helix transcriptional regulator	NA	A8ATJ2	Listeria_phage	95.9	3.5e-33
WP_003731541.1|556502_557336_-	N-acetylmuramoyl-L-alanine amidase	NA	A0A1S7FZ94	Listeria_phage	43.8	2.5e-47
WP_003731540.1|557338_557593_-|holin	phage holin	holin	A8ATJ0	Listeria_phage	96.4	2.5e-38
WP_023559355.1|557603_557819_-	LysM peptidoglycan-binding domain-containing protein	NA	A8ATI9	Listeria_phage	94.4	6.3e-27
WP_003731538.1|557838_558285_-	hypothetical protein	NA	A8ATI8	Listeria_phage	95.9	1.7e-63
WP_003731537.1|558260_558707_-	hypothetical protein	NA	A8ATI7	Listeria_phage	97.3	9.3e-73
WP_003731536.1|558892_559234_-	hypothetical protein	NA	A8ATI5	Listeria_phage	93.5	1.5e-43
WP_003731535.1|559239_559968_-	hypothetical protein	NA	A8ATI4	Listeria_phage	93.4	2.7e-130
WP_003731534.1|559988_560630_-	hypothetical protein	NA	A8ATI3	Listeria_phage	99.1	4.5e-113
WP_003731533.1|560619_561771_-|plate	baseplate J/gp47 family protein	plate	A8ATI2	Listeria_phage	76.8	5.4e-165
WP_003731532.1|561763_562126_-	DUF2634 domain-containing protein	NA	A8ATI1	Listeria_phage	70.0	2.0e-41
WP_003731531.1|562122_562461_-	hypothetical protein	NA	A8ATI0	Listeria_phage	92.0	8.0e-53
WP_003731530.1|562461_563268_-	hypothetical protein	NA	A8ATH9	Listeria_phage	85.8	3.0e-130
WP_003731529.1|563273_563645_-	hypothetical protein	NA	A8ATH8	Listeria_phage	77.0	5.4e-50
WP_023559357.1|563644_564193_-	LysM peptidoglycan-binding domain-containing protein	NA	A8ATH7	Listeria_phage	84.5	5.4e-83
WP_003731527.1|564198_569235_-	peptidoglycan DD-metalloendopeptidase family protein	NA	A8ATH6	Listeria_phage	75.3	0.0e+00
WP_003731526.1|569236_569449_-	hypothetical protein	NA	A8ATH5	Listeria_phage	100.0	3.7e-32
WP_003731525.1|569411_569768_-	hypothetical protein	NA	A8ATH4	Listeria_phage	100.0	1.4e-60
WP_003731524.1|569820_570219_-	hypothetical protein	NA	A8ATH3	Listeria_phage	100.0	4.7e-68
WP_003731523.1|570235_571231_-	DUF3383 family protein	NA	A8ATH2	Listeria_phage	100.0	1.9e-182
WP_003731522.1|571235_571724_-	hypothetical protein	NA	A8ATH1	Listeria_phage	100.0	3.2e-87
WP_003731521.1|571713_572088_-	hypothetical protein	NA	A8ATH0	Listeria_phage	100.0	4.6e-65
WP_003731520.1|572087_572687_-	hypothetical protein	NA	A8ATG9	Listeria_phage	100.0	2.6e-110
WP_003731519.1|572686_573022_-	DUF4054 domain-containing protein	NA	A8ATG8	Listeria_phage	100.0	2.1e-53
WP_003731518.1|573033_573420_-	hypothetical protein	NA	A8ATG7	Listeria_phage	97.7	1.0e-64
WP_003731517.1|573442_574348_-	DUF2184 domain-containing protein	NA	A8ATG6	Listeria_phage	99.0	2.1e-164
WP_003731516.1|574368_574818_-	hypothetical protein	NA	A8ATG5	Listeria_phage	100.0	9.0e-76
WP_003731515.1|574817_575927_-	DUF2213 domain-containing protein	NA	A8ATG4	Listeria_phage	100.0	6.5e-176
WP_003731514.1|575975_576146_-	hypothetical protein	NA	A8ATG3	Listeria_phage	100.0	1.1e-26
WP_003731513.1|576142_577552_-|head	phage head morphogenesis protein	head	A8ATG2	Listeria_phage	100.0	7.8e-267
WP_003731512.1|577544_578930_-	DUF1073 domain-containing protein	NA	A8ATG1	Listeria_phage	100.0	1.1e-265
WP_003731511.1|578943_580404_-|terminase	phage terminase large subunit	terminase	A8ATG0	Listeria_phage	100.0	4.4e-289
WP_003731510.1|580381_581266_-	hypothetical protein	NA	A8ATF9	Listeria_phage	99.3	6.6e-139
WP_003731509.1|581307_581595_-	hypothetical protein	NA	A0A0S2MYE7	Enterococcus_phage	55.4	9.9e-20
WP_003731508.1|581632_581863_-	hypothetical protein	NA	A8ATN7	Listeria_phage	98.7	3.7e-33
WP_003731507.1|581992_582190_-	hypothetical protein	NA	A8ATN6	Listeria_phage	100.0	5.2e-28
WP_003731506.1|582237_583575_-	ParB N-terminal domain-containing protein	NA	A8ATN5	Listeria_phage	98.9	4.5e-256
WP_003731505.1|583571_583865_-	hypothetical protein	NA	A8ATN4	Listeria_phage	100.0	2.3e-48
WP_003731503.1|584392_585160_-	phage antirepressor KilAC domain-containing protein	NA	A8ATN0	Listeria_phage	100.0	1.6e-141
WP_003731502.1|585172_585595_-	hypothetical protein	NA	A8ATM9	Listeria_phage	100.0	6.3e-71
WP_003731501.1|585675_586236_-	hypothetical protein	NA	A8ATM8	Listeria_phage	96.8	1.8e-102
WP_003731500.1|586247_586499_-	DUF3850 domain-containing protein	NA	A8ATM7	Listeria_phage	95.2	9.9e-40
WP_003731499.1|586495_586648_-	hypothetical protein	NA	A8ATM6	Listeria_phage	100.0	8.1e-21
WP_003731498.1|586848_587184_-	hypothetical protein	NA	A8ATZ5	Listeria_phage	93.1	4.6e-08
WP_003731497.1|587183_587372_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003731496.1|587390_587774_-	preprotein translocase subunit YajC	NA	A8ATZ3	Listeria_phage	88.2	2.4e-53
WP_003731495.1|587877_588093_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003731494.1|588089_588299_-	hypothetical protein	NA	A8ATE0	Listeria_phage	98.6	4.8e-32
WP_003731493.1|588295_588820_-	hypothetical protein	NA	A8ASP1	Listeria_phage	47.8	1.1e-32
WP_003731492.1|588836_590198_-	PcfJ domain-containing protein	NA	A8ATM0	Listeria_phage	96.5	2.5e-254
WP_003731491.1|590194_590617_-	hypothetical protein	NA	A8ATL9	Listeria_phage	100.0	1.2e-53
WP_003731490.1|590628_590805_-	hypothetical protein	NA	A8ATL8	Listeria_phage	100.0	2.0e-23
WP_003731489.1|590764_591145_-	hypothetical protein	NA	A8ATL7	Listeria_phage	100.0	3.1e-69
WP_003731488.1|591185_591806_-	hypothetical protein	NA	A8ATL6	Listeria_phage	100.0	1.1e-108
WP_003731487.1|591826_592264_-	RusA family crossover junction endodeoxyribonuclease	NA	A8ATL5	Listeria_phage	100.0	1.6e-77
WP_003731486.1|592244_592454_-	hypothetical protein	NA	A8ATL4	Listeria_phage	100.0	8.2e-32
WP_003731485.1|592454_592661_-	hypothetical protein	NA	A8ATL3	Listeria_phage	100.0	5.6e-33
WP_003731483.1|592838_593654_-	ATP-binding protein	NA	A8ATL1	Listeria_phage	100.0	4.8e-144
WP_003731482.1|593577_594495_-	DUF4373 domain-containing protein	NA	A8ATL0	Listeria_phage	100.0	2.2e-169
WP_003731481.1|594506_595244_-	MBL fold metallo-hydrolase	NA	A8ATK9	Listeria_phage	100.0	1.7e-135
WP_003731480.1|595203_595989_-	phage recombination protein Bet	NA	A8ATK8	Listeria_phage	100.0	7.9e-144
WP_003731479.1|595989_597933_-	AAA family ATPase	NA	A8ATK7	Listeria_phage	99.8	0.0e+00
WP_003731478.1|597919_598261_-	hypothetical protein	NA	A8ATK6	Listeria_phage	100.0	1.2e-56
WP_003731477.1|598278_598506_-	hypothetical protein	NA	A8ATK5	Listeria_phage	100.0	1.8e-32
WP_003731476.1|598684_598975_-	hypothetical protein	NA	A8ATK4	Listeria_phage	100.0	4.6e-49
WP_049872582.1|599124_599319_-	hypothetical protein	NA	A8ATK3	Listeria_phage	100.0	9.4e-22
WP_003731474.1|599293_599587_-	helix-turn-helix domain-containing protein	NA	A8ATK2	Listeria_phage	100.0	2.3e-48
WP_003731473.1|599601_600126_-	hypothetical protein	NA	A8ATK1	Listeria_phage	100.0	5.5e-93
WP_003731472.1|600202_600388_-	helix-turn-helix transcriptional regulator	NA	A8ATK0	Listeria_phage	100.0	1.2e-29
WP_003731471.1|600548_600977_+	helix-turn-helix transcriptional regulator	NA	A8ATJ9	Listeria_phage	100.0	4.0e-73
WP_003731470.1|600993_601413_+	ImmA/IrrE family metallo-endopeptidase	NA	A8ATJ8	Listeria_phage	100.0	4.0e-78
WP_003731469.1|601460_601853_+	hypothetical protein	NA	A8ATJ7	Listeria_phage	100.0	2.3e-59
WP_003731468.1|601949_603125_+|integrase	site-specific integrase	integrase	A8ATJ6	Listeria_phage	100.0	6.2e-225
603159:603178	attR	ATCCCACAAAAATCCCACAA	NA	NA	NA	NA
>prophage 3
NC_021826	Listeria monocytogenes, complete sequence	3094342	676211	709077	3094342	terminase,tail,head,capsid,protease,holin	Erysipelothrix_phage(66.67%)	38	NA	NA
WP_014929970.1|676211_677126_-	N-acetylmuramoyl-L-alanine amidase	NA	A0A1D8ETE4	Propionibacterium_phage	44.0	3.9e-33
WP_025186379.1|677115_677529_-|holin	phage holin family protein	holin	A0A2K5B2A2	Erysipelothrix_phage	57.0	1.5e-37
WP_003731143.1|677577_677997_-	DUF1617 family protein	NA	A0A1S5RCP5	Lactobacillus_phage	26.5	2.4e-06
WP_003731142.1|677983_678145_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003731141.1|678157_682222_-|tail	phage tail protein	tail	A0A1B1P770	Bacillus_phage	41.8	8.7e-85
WP_003731140.1|682206_682899_-	hypothetical protein	NA	A0A1L2BYA2	Clostridium_phage	29.0	1.7e-20
WP_003731139.1|682914_685476_-	hypothetical protein	NA	A0A2K5B297	Erysipelothrix_phage	74.1	3.9e-83
WP_003731138.1|685543_686188_-	DUF1643 domain-containing protein	NA	NA	NA	NA	NA
WP_003731137.1|686439_686823_-	hypothetical protein	NA	A0A2K5B295	Erysipelothrix_phage	64.2	5.4e-37
WP_003731136.1|686832_687423_-|tail	phage tail protein	tail	A0A2K5B294	Erysipelothrix_phage	72.2	4.1e-76
WP_029645088.1|687424_687733_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003731135.1|687759_688191_-	HK97 gp10 family phage protein	NA	A0A2K5B292	Erysipelothrix_phage	59.4	7.6e-40
WP_003731134.1|688183_688522_-|head,tail	head-tail adaptor protein	head,tail	A0A2K5B291	Erysipelothrix_phage	54.7	1.7e-23
WP_003731133.1|688518_688830_-|head,tail	phage gp6-like head-tail connector protein	head,tail	A0A2K5B290	Erysipelothrix_phage	74.0	2.2e-36
WP_003731132.1|688840_690058_-|capsid	phage major capsid protein	capsid	A0A2I4R671	Erysipelothrix_phage	48.0	1.1e-102
WP_003731131.1|690061_690835_-|protease	Clp protease ClpP	protease	M1PLE5	Streptococcus_phage	55.7	2.0e-62
WP_100066221.1|692139_692400_-	hypothetical protein	NA	NA	NA	NA	NA
WP_088518322.1|692531_694124_-|terminase	terminase large subunit	terminase	A0A2K5B285	Erysipelothrix_phage	84.8	7.2e-269
WP_003731127.1|694184_694409_-	hypothetical protein	NA	A0A2K5B284	Erysipelothrix_phage	48.6	2.0e-15
WP_003731126.1|694398_694596_-	DUF5049 domain-containing protein	NA	NA	NA	NA	NA
WP_003731125.1|694570_694765_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003731124.1|694767_695157_-	DUF4314 domain-containing protein	NA	E4ZFL7	Streptococcus_phage	71.0	3.1e-16
WP_003731123.1|695245_696496_-	site-specific DNA-methyltransferase	NA	A0A2I4R670	Erysipelothrix_phage	62.0	7.4e-144
WP_100066220.1|696485_696863_-	HNH endonuclease	NA	A0A0B5HE03	Vibrio_phage	38.8	4.5e-12
WP_014929977.1|697087_697870_-	S-adenosylmethionine synthetase	NA	NA	NA	NA	NA
WP_031641527.1|697874_698453_-|terminase	terminase	terminase	A0A2K5B277	Erysipelothrix_phage	52.8	1.2e-53
WP_031641526.1|698585_698951_-	HNH endonuclease	NA	A0A2K5B276	Erysipelothrix_phage	56.9	1.4e-31
WP_003731117.1|699118_699547_-	DUF1492 domain-containing protein	NA	A0A2K5B275	Erysipelothrix_phage	45.8	1.5e-27
WP_014929979.1|699543_700896_-	DEAD/DEAH box helicase	NA	A0A2K5B273	Erysipelothrix_phage	69.0	6.8e-159
WP_003731115.1|700895_701180_-	VRR-NUC domain-containing protein	NA	A0A2K5B272	Erysipelothrix_phage	60.2	3.5e-25
WP_003731114.1|701176_701386_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003731113.1|701523_703767_-	primase C-terminal domain-containing protein	NA	A0A1B0RXC5	Streptococcus_phage	49.7	4.8e-210
WP_014929980.1|703759_704104_-	hypothetical protein	NA	A0A2K5B270	Erysipelothrix_phage	51.4	4.1e-28
WP_014929981.1|704096_704867_-	phage antirepressor KilAC domain-containing protein	NA	A0A1Q1PVU2	Staphylococcus_phage	50.8	2.7e-64
WP_003731110.1|705077_707015_-	DNA polymerase	NA	A0A2K5B2B0	Erysipelothrix_phage	68.6	7.7e-265
WP_003731109.1|707075_707618_-	DUF2815 family protein	NA	A0A2K5B2A9	Erysipelothrix_phage	77.2	8.9e-78
WP_003731108.1|707619_708762_-	DUF2800 domain-containing protein	NA	M1Q218	Streptococcus_phage	57.8	1.5e-122
WP_010821424.1|708762_709077_-	hypothetical protein	NA	A0A2K5B2A7	Erysipelothrix_phage	41.5	6.6e-09
>prophage 4
NC_021826	Listeria monocytogenes, complete sequence	3094342	790177	798463	3094342		Prochlorococcus_phage(33.33%)	8	NA	NA
WP_003731569.1|790177_790744_-	phosphoribosylglycinamide formyltransferase	NA	E3SNR5	Prochlorococcus_phage	38.5	2.8e-26
WP_003726210.1|790740_791790_-	phosphoribosylformylglycinamidine cyclo-ligase	NA	Q58MH8	Prochlorococcus_phage	44.4	3.2e-63
WP_003722245.1|791808_793236_-	amidophosphoribosyltransferase	NA	A0A0M3SGR2	Mollivirus	34.6	1.1e-53
WP_003731570.1|793220_795440_-	phosphoribosylformylglycinamidine synthase subunit PurL	NA	A6N228	Microbacterium_phage	40.8	6.5e-159
WP_003726212.1|795432_796116_-	phosphoribosylformylglycinamidine synthase subunit PurQ	NA	NA	NA	NA	NA
WP_003722248.1|796119_796365_-	phosphoribosylformylglycinamidine synthase subunit PurS	NA	NA	NA	NA	NA
WP_003731571.1|796376_797090_-	phosphoribosylaminoimidazolesuccinocarboxamide synthase	NA	A0A0E3F9V5	Synechococcus_phage	38.3	3.9e-41
WP_003729814.1|797170_798463_-	adenylosuccinate lyase	NA	A0A1B3B081	Gordonia_phage	33.0	2.5e-17
>prophage 5
NC_021826	Listeria monocytogenes, complete sequence	3094342	1464878	1507038	3094342	tail,integrase,holin,terminase	Listeria_phage(95.16%)	68	1465415:1465434	1504579:1504598
WP_003725402.1|1464878_1465214_+	hypothetical protein	NA	S5MNN8	Brevibacillus_phage	76.1	2.3e-15
1465415:1465434	attL	TTTGTACTTTATTTGAACTT	NA	NA	NA	NA
WP_003731279.1|1465465_1465669_-	hypothetical protein	NA	A8ATX1	Listeria_phage	100.0	2.7e-32
WP_003731278.1|1465665_1465899_-	hypothetical protein	NA	R4IDW6	Listeria_phage	97.4	3.6e-36
WP_003731277.1|1466200_1466434_+	hypothetical protein	NA	A8ATW9	Listeria_phage	100.0	4.3e-13
WP_003731276.1|1466465_1466717_+	hypothetical protein	NA	A8ATW8	Listeria_phage	100.0	2.0e-40
WP_003731275.1|1466717_1467167_+	anti-CRISPR protein AcrIIA1	NA	A8ATW7	Listeria_phage	98.7	2.0e-75
WP_003731274.1|1467191_1467689_+	AP2 domain-containing protein	NA	A8ATW6	Listeria_phage	95.8	1.9e-87
WP_100066223.1|1467755_1468352_-	hypothetical protein	NA	NA	NA	NA	NA
WP_023559372.1|1468804_1469650_-	M15 family metallopeptidase	NA	A0A059T7Y8	Listeria_phage	95.8	1.5e-140
WP_023559373.1|1469649_1469931_-|holin	holin	holin	A8ASL4	Listeria_phage	93.5	1.0e-40
WP_003722523.1|1469943_1470309_-	hypothetical protein	NA	Q9T1A0	Listeria_phage	100.0	7.4e-12
WP_012951930.1|1470347_1472510_-|tail	phage tail protein	tail	A8ATW1	Listeria_phage	98.8	0.0e+00
WP_003731724.1|1472522_1474091_-|tail	phage tail family protein	tail	A8ATW0	Listeria_phage	99.6	4.7e-305
WP_003731723.1|1474087_1478887_-|tail	phage tail tape measure protein	tail	A8ATV9	Listeria_phage	92.8	0.0e+00
WP_003731722.1|1478891_1479167_-	hypothetical protein	NA	A0A0B5D116	Listeria_phage	95.6	2.6e-41
WP_003731721.1|1479199_1479631_-	hypothetical protein	NA	A8ATV7	Listeria_phage	95.1	5.4e-70
WP_031668717.1|1479681_1479921_-	Ig-like domain-containing protein	NA	A8ASK3	Listeria_phage	88.6	4.0e-30
WP_003723782.1|1479943_1480375_-	Ig domain-containing protein	NA	A0A0B5CYK8	Listeria_phage	82.9	8.1e-58
WP_003723783.1|1480346_1480751_-	hypothetical protein	NA	A8ATV5	Listeria_phage	98.4	2.1e-63
WP_003723784.1|1480747_1481065_-	HK97 gp10 family phage protein	NA	A8ATV4	Listeria_phage	95.2	1.7e-49
WP_003731720.1|1481054_1481420_-	hypothetical protein	NA	A8ATV3	Listeria_phage	95.0	1.6e-62
WP_003731719.1|1481419_1481773_-	hypothetical protein	NA	A8ATV2	Listeria_phage	97.4	9.3e-60
WP_003731718.1|1481773_1481929_-	hypothetical protein	NA	A0A0B5CYK6	Listeria_phage	78.4	2.2e-13
WP_003723787.1|1481942_1482815_-	hypothetical protein	NA	A0A0B5CTX8	Listeria_phage	93.8	2.3e-152
WP_003731717.1|1482837_1483392_-	hypothetical protein	NA	A8ATU9	Listeria_phage	96.2	2.6e-85
WP_003731716.1|1483487_1484531_-	hypothetical protein	NA	A0A0B5D111	Listeria_phage	98.0	6.3e-197
WP_003731715.1|1484535_1486092_-	hypothetical protein	NA	A8ATU7	Listeria_phage	98.6	6.5e-299
WP_043993317.1|1486106_1487453_-|terminase	PBSX family phage terminase large subunit	terminase	A8ATU6	Listeria_phage	97.9	1.8e-260
WP_003731713.1|1487418_1488159_-	hypothetical protein	NA	A0A0B5CTX0	Listeria_phage	98.8	1.6e-133
WP_003731712.1|1488198_1488426_-	hypothetical protein	NA	A0A0B5CTV3	Listeria_phage	100.0	2.5e-34
WP_003731711.1|1488686_1489259_-	sigma-70 family RNA polymerase sigma factor	NA	A0A0B5D145	Listeria_phage	88.4	3.3e-91
WP_003722548.1|1489346_1489502_-	hypothetical protein	NA	A0A0B5D186	Listeria_phage	96.1	3.3e-22
WP_003722549.1|1489520_1489934_-	DUF2481 family protein	NA	A8ASP8	Listeria_phage	43.4	3.5e-18
WP_003731710.1|1489937_1490342_-	DUF1064 domain-containing protein	NA	A8ASP7	Listeria_phage	85.8	3.4e-58
WP_003731709.1|1490286_1490469_-	hypothetical protein	NA	A8ASP6	Listeria_phage	79.4	3.8e-17
WP_023559377.1|1490487_1490970_-	single-stranded DNA-binding protein	NA	A8ATZ7	Listeria_phage	97.5	3.8e-80
WP_003731707.1|1490966_1491227_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003731706.1|1491226_1491409_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003731705.1|1491512_1491785_-	hypothetical protein	NA	A8ATE2	Listeria_phage	100.0	2.0e-46
WP_003731704.1|1491781_1492111_-	hypothetical protein	NA	A8ATE1	Listeria_phage	100.0	1.1e-57
WP_003731703.1|1492111_1492288_-	hypothetical protein	NA	A0A076G7F4	Listeria_phage	87.9	1.9e-21
WP_003731702.1|1492391_1492925_-	pentapeptide repeat-containing protein	NA	A0A060AFJ6	Listeria_phage	85.2	2.2e-44
WP_003731701.1|1492921_1493095_-	hypothetical protein	NA	A0A059T7N2	Listeria_phage	93.0	6.2e-25
WP_003731700.1|1493098_1493497_-	hypothetical protein	NA	R4ICD6	Listeria_phage	98.7	1.7e-38
WP_003731699.1|1493493_1493709_-	hypothetical protein	NA	A0A059T6G5	Listeria_phage	95.8	2.7e-30
WP_003731698.1|1493708_1493987_-	hypothetical protein	NA	NA	NA	NA	NA
WP_010991168.1|1494002_1494149_-	hypothetical protein	NA	A8ATZ0	Listeria_phage	97.9	2.3e-20
WP_023559381.1|1494145_1494523_-	hypothetical protein	NA	NA	NA	NA	NA
WP_023559382.1|1494534_1495059_-	hypothetical protein	NA	A0A059T5F9	Listeria_phage	96.6	6.3e-97
WP_023559383.1|1495069_1495276_-	hypothetical protein	NA	NA	NA	NA	NA
WP_023559384.1|1495272_1495524_-	hypothetical protein	NA	Q8W5X5	Listeria_phage	94.0	4.3e-35
WP_003731806.1|1495520_1496453_-	DnaD domain-containing protein	NA	A8ATY7	Listeria_phage	98.1	1.5e-165
WP_003731807.1|1496472_1497288_-	recombinase RecT	NA	A8ATY6	Listeria_phage	98.5	1.0e-149
WP_003731808.1|1497287_1498247_-	YqaJ viral recombinase family protein	NA	A8ATY5	Listeria_phage	98.4	1.5e-176
WP_003731809.1|1498479_1498668_-	hypothetical protein	NA	A8ATY3	Listeria_phage	100.0	4.5e-29
WP_003731810.1|1498775_1499012_-	DUF771 domain-containing protein	NA	A8ATY2	Listeria_phage	100.0	1.9e-40
WP_015987420.1|1499018_1499543_-	hypothetical protein	NA	A8ATY1	Listeria_phage	100.0	6.3e-89
WP_023559386.1|1499664_1500438_-	phage antirepressor KilAC domain-containing protein	NA	A8ATY0	Listeria_phage	99.6	1.5e-139
WP_003731223.1|1500501_1501044_+	hypothetical protein	NA	A8ATX9	Listeria_phage	100.0	2.8e-95
WP_003731222.1|1501021_1501375_-	hypothetical protein	NA	A8ATX8	Listeria_phage	100.0	9.9e-54
WP_003731221.1|1501371_1501608_-	hypothetical protein	NA	A8ATX7	Listeria_phage	98.7	1.3e-36
WP_003731220.1|1501611_1501863_-	helix-turn-helix transcriptional regulator	NA	A8ATX6	Listeria_phage	100.0	7.6e-40
WP_015987417.1|1502011_1502320_+	helix-turn-helix transcriptional regulator	NA	A8ATX5	Listeria_phage	100.0	9.3e-48
WP_003731218.1|1502351_1502843_+	hypothetical protein	NA	A8ATX4	Listeria_phage	100.0	2.6e-92
WP_003731217.1|1502869_1503379_+	hypothetical protein	NA	A8ATX3	Listeria_phage	100.0	2.6e-87
WP_003731216.1|1503442_1504573_+|integrase	site-specific integrase	integrase	A8ATX2	Listeria_phage	100.0	9.8e-212
WP_003731215.1|1504848_1506285_-	lytic polysaccharide monooxygenase	NA	A0A0K1Y848	Apis_mellifera_filamentous_virus	38.3	1.2e-25
1504579:1504598	attR	TTTGTACTTTATTTGAACTT	NA	NA	NA	NA
WP_003722600.1|1506441_1507038_+	ATP-dependent Clp endopeptidase proteolytic subunit ClpP	NA	A0A223W000	Agrobacterium_phage	57.4	6.6e-58
>prophage 6
NC_021826	Listeria monocytogenes, complete sequence	3094342	1510956	1518798	3094342		Streptococcus_phage(50.0%)	7	NA	NA
WP_003725407.1|1510956_1511928_-	DNA-binding protein WhiA	NA	Q7AWZ3	Streptococcus_phage	39.4	5.2e-52
WP_003731212.1|1511935_1512904_-	YvcK family protein	NA	A1IMD5	Streptococcus_phage	43.6	1.8e-68
WP_003722606.1|1512905_1513781_-	RNase adapter RapZ	NA	A0A0R8VB27	Thermobifida_phage	29.7	1.9e-08
WP_003731211.1|1513888_1515619_-	phospho-sugar mutase	NA	A0A1X9I671	Streptococcus_phage	53.0	2.8e-173
WP_003741152.1|1515660_1516722_-	galactose mutarotase	NA	NA	NA	NA	NA
WP_003731209.1|1516738_1517722_-	UDP-glucose 4-epimerase GalE	NA	A0A2K9L5H6	Tupanvirus	38.1	1.5e-51
WP_003722610.1|1517838_1518798_-	thioredoxin-disulfide reductase	NA	G3MA85	Bacillus_virus	53.7	2.0e-88
>prophage 7
NC_021826	Listeria monocytogenes, complete sequence	3094342	2005995	2047545	3094342	terminase,tail,plate,integrase,portal,capsid,holin	Listeria_phage(88.24%)	63	2007070:2007114	2048533:2048577
WP_003731433.1|2005995_2006952_+	2-hydroxyacid dehydrogenase family protein	NA	M1H502	Paramecium_bursaria_Chlorella_virus	29.3	5.5e-30
2007070:2007114	attL	ACTCTTAATCAGCGGGTCGGGGGTTCGAAACCCTCACAACCCATA	NA	NA	NA	NA
WP_003731434.1|2007217_2008420_-|integrase	site-specific integrase	integrase	A0A059T666	Listeria_phage	96.8	6.1e-220
WP_003731435.1|2008485_2009136_-	hypothetical protein	NA	NA	NA	NA	NA
WP_023559389.1|2009190_2009358_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003731436.1|2009515_2009992_-	XRE family transcriptional regulator	NA	A8ASM2	Listeria_phage	62.0	8.4e-40
WP_003731437.1|2010160_2010364_+	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_003731438.1|2010396_2010627_+	hypothetical protein	NA	A0A059T5E9	Listeria_phage	89.0	1.5e-31
WP_023559390.1|2010628_2010799_+	hypothetical protein	NA	NA	NA	NA	NA
WP_023559391.1|2010858_2011632_+	phage antirepressor KilAC domain-containing protein	NA	A8ATY0	Listeria_phage	96.5	4.6e-136
WP_023559392.1|2011752_2012277_+	hypothetical protein	NA	A8ATY1	Listeria_phage	97.7	3.5e-87
WP_003731816.1|2012283_2012469_+	helix-turn-helix domain-containing protein	NA	A0A059T674	Listeria_phage	100.0	1.1e-27
WP_003731815.1|2012484_2012673_+	hypothetical protein	NA	A0A0B5CU43	Listeria_phage	98.4	1.7e-28
WP_003727754.1|2012890_2013094_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003731814.1|2013090_2013972_+	hypothetical protein	NA	A0A2P1JTZ5	Anoxybacillus_phage	58.6	2.0e-87
WP_014931709.1|2013925_2014735_+	PD-(D/E)XK nuclease-like domain-containing protein	NA	A0A290GJV0	Caldibacillus_phage	54.3	2.7e-78
WP_003731812.1|2014753_2015674_+	hypothetical protein	NA	I1W658	Staphylococcus_phage	39.5	1.1e-16
WP_043993323.1|2015721_2016252_+	hypothetical protein	NA	A0A059T5F9	Listeria_phage	89.8	1.2e-90
WP_003731842.1|2016264_2016432_+	hypothetical protein	NA	A8ASN5	Listeria_phage	80.0	9.2e-18
WP_003731843.1|2016443_2016659_+	hypothetical protein	NA	NA	NA	NA	NA
WP_109922161.1|2016796_2017069_+	pentapeptide repeat-containing protein	NA	NA	NA	NA	NA
WP_023559397.1|2017320_2017479_+	DNA cytosine methyltransferase	NA	NA	NA	NA	NA
WP_003731837.1|2017462_2018071_+	hypothetical protein	NA	A8ATU1	Listeria_phage	49.5	1.4e-55
WP_014601397.1|2018082_2018658_+	DUF1642 domain-containing protein	NA	B6D7L5	Listeria_phage	41.5	1.9e-25
WP_003731819.1|2018654_2018921_+	hypothetical protein	NA	R4IBL5	Listeria_phage	84.9	1.9e-33
WP_003731820.1|2018917_2019106_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003731821.1|2019102_2019504_+	hypothetical protein	NA	A8ATZ6	Listeria_phage	92.5	7.8e-63
WP_003731823.1|2019815_2020043_+	DUF3850 domain-containing protein	NA	A0A059T7N3	Listeria_phage	85.3	2.1e-28
WP_003731824.1|2020054_2020411_+	hypothetical protein	NA	A0A059T801	Listeria_phage	87.0	2.9e-45
WP_003731825.1|2020410_2020893_+	single-stranded DNA-binding protein	NA	A8ATZ7	Listeria_phage	83.1	5.7e-68
WP_003731826.1|2020914_2021097_+	hypothetical protein	NA	A8ASP6	Listeria_phage	77.6	3.0e-14
WP_003731827.1|2021041_2021446_+	DUF1064 domain-containing protein	NA	A8ASP7	Listeria_phage	85.1	3.1e-59
WP_003731726.1|2021449_2021833_+	DUF2481 family protein	NA	A0A0B5CU14	Listeria_phage	96.9	1.3e-62
WP_003731727.1|2021974_2022409_+	hypothetical protein	NA	A8AU03	Listeria_phage	91.0	2.5e-70
WP_003731728.1|2022669_2023380_+	hypothetical protein	NA	Q9T152	Listeria_phage	99.2	7.0e-123
WP_003722545.1|2023463_2024219_+|terminase	terminase small subunit	terminase	V5URT8	Oenococcus_phage	46.1	2.4e-44
WP_023559399.1|2024211_2025522_+|terminase	PBSX family phage terminase large subunit	terminase	A0A286QNX6	Streptococcus_phage	65.6	6.5e-167
WP_003731730.1|2025534_2027304_+|portal	phage portal protein	portal	A8ASJ3	Listeria_phage	91.6	2.0e-264
WP_003731731.1|2027304_2028444_+|capsid	phage minor capsid protein	capsid	A0A059T7W2	Listeria_phage	96.6	4.2e-202
WP_003731732.1|2028522_2029092_+	phage scaffolding protein	NA	A0A0B5CTV7	Listeria_phage	98.4	1.4e-81
WP_003731733.1|2029115_2030015_+|capsid	phage major capsid protein	capsid	A0A0B5CU19	Listeria_phage	98.7	3.8e-166
WP_003731734.1|2030014_2030173_+	hypothetical protein	NA	Q9T1B6	Listeria_phage	94.2	6.7e-18
WP_003731735.1|2030174_2030570_+	hypothetical protein	NA	A8ASJ8	Listeria_phage	99.2	3.3e-66
WP_003731736.1|2030569_2030932_+	hypothetical protein	NA	Q9T1B4	Listeria_phage	95.8	2.7e-62
WP_003727787.1|2030931_2031270_+|capsid	minor capsid protein	capsid	Q9T1B3	Listeria_phage	100.0	2.2e-58
WP_003727788.1|2031269_2031677_+	hypothetical protein	NA	Q9T1B2	Listeria_phage	98.5	9.0e-67
WP_003731737.1|2031679_2032114_+	hypothetical protein	NA	Q9T1B1	Listeria_phage	98.6	6.7e-76
WP_003731738.1|2032043_2032376_+	Ig domain-containing protein	NA	Q9T1B0	Listeria_phage	84.5	1.3e-39
WP_003731739.1|2032427_2032850_+|tail	phage tail assembly chaperone	tail	Q9T1A9	Listeria_phage	98.6	3.4e-69
WP_003731740.1|2032855_2033458_+	bacteriophage Gp15 family protein	NA	A8ASK5	Listeria_phage	98.0	2.0e-107
WP_003731741.1|2033468_2038832_+	tape measure protein	NA	Q9T1A7	Listeria_phage	81.9	0.0e+00
WP_003731742.1|2038833_2039652_+|tail	phage tail family protein	tail	Q9T1A6	Listeria_phage	96.7	2.8e-152
WP_003731743.1|2039660_2040686_+|tail	phage tail protein	tail	Q9T1A5	Listeria_phage	91.8	9.0e-188
WP_003731744.1|2040686_2041715_+	hypothetical protein	NA	Q9T1A4	Listeria_phage	96.2	6.4e-186
WP_003731745.1|2041714_2042788_+|plate	BppU family phage baseplate upper protein	plate	Q9T1A3	Listeria_phage	73.9	5.0e-149
WP_003731746.1|2042799_2043117_+	hypothetical protein	NA	Q9T1A2	Listeria_phage	92.4	1.7e-49
WP_003722524.1|2043121_2043280_+	hypothetical protein	NA	Q9T1A1	Listeria_phage	100.0	6.0e-19
WP_003727799.1|2043307_2043673_+	hypothetical protein	NA	A8ASL3	Listeria_phage	97.9	1.7e-11
WP_023559373.1|2043685_2043967_+|holin	holin	holin	A8ASL4	Listeria_phage	93.5	1.0e-40
WP_023559372.1|2043966_2044812_+	M15 family metallopeptidase	NA	A0A059T7Y8	Listeria_phage	95.8	1.5e-140
WP_100066223.1|2045264_2045861_+	hypothetical protein	NA	NA	NA	NA	NA
WP_023559402.1|2046568_2046964_+	hypothetical protein	NA	NA	NA	NA	NA
WP_023559403.1|2047021_2047255_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003731579.1|2047359_2047545_-	hypothetical protein	NA	A0A059T7Z0	Listeria_phage	91.4	1.4e-19
2048533:2048577	attR	ACTCTTAATCAGCGGGTCGGGGGTTCGAAACCCTCACAACCCATA	NA	NA	NA	NA
>prophage 8
NC_021826	Listeria monocytogenes, complete sequence	3094342	2089712	2096239	3094342	tail	Listeria_phage(33.33%)	10	NA	NA
WP_003728215.1|2089712_2090165_-	ImmA/IrrE family metallo-endopeptidase	NA	A0A059T7S0	Listeria_phage	47.9	4.0e-31
WP_003721740.1|2090170_2090506_-	helix-turn-helix transcriptional regulator	NA	A0A2H4JAR9	uncultured_Caudovirales_phage	52.5	4.0e-20
WP_003731176.1|2090722_2091151_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003731177.1|2091162_2091579_+	hypothetical protein	NA	A8ASQ1	Listeria_phage	37.9	6.5e-20
WP_003728212.1|2091858_2092248_+	DUF5072 family protein	NA	NA	NA	NA	NA
WP_003721744.1|2092260_2092773_+|tail	phage major tail protein, TP901-1 family	tail	A0A097PBF4	Streptococcus_pyogenes_phage	62.7	1.2e-47
WP_003721745.1|2092820_2093123_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003740367.1|2093164_2093569_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003731178.1|2093555_2095424_+	membrane protein	NA	A0A097PAU2	Streptococcus_pyogenes_phage	45.8	3.5e-20
WP_003731179.1|2095420_2096239_+|tail	phage tail family protein	tail	A0A060AFE1	Staphylococcus_phage	35.0	5.5e-39
>prophage 9
NC_021826	Listeria monocytogenes, complete sequence	3094342	3081628	3089050	3094342		Hokovirus(33.33%)	8	NA	NA
WP_003730941.1|3081628_3082012_+	glycerol-3-phosphate cytidylyltransferase	NA	A0A1V0SGE7	Hokovirus	40.7	1.4e-16
WP_003727002.1|3082033_3083017_+	glycosyltransferase family 2 protein	NA	A0A1V0SAH6	Catovirus	33.8	2.0e-11
WP_003727001.1|3083031_3084045_+	glycosyltransferase	NA	A0A1V0SAH6	Catovirus	31.2	1.8e-10
WP_003721509.1|3084253_3085744_+	nicotinate phosphoribosyltransferase	NA	G3MA18	Bacillus_virus	49.7	9.5e-114
WP_003727000.1|3085755_3086580_+	ammonia-dependent NAD(+) synthetase	NA	G3MA24	Bacillus_virus	52.6	9.7e-68
WP_003724634.1|3086592_3086901_+	antibiotic biosynthesis monooxygenase	NA	NA	NA	NA	NA
WP_003724635.1|3086960_3087365_+	PTS sugar transporter subunit IIB	NA	NA	NA	NA	NA
WP_012681222.1|3087493_3089050_+	glutamine-hydrolyzing GMP synthase	NA	A0A1V0SH76	Hokovirus	28.1	2.3e-17
>prophage 1
NC_022045	Listeria monocytogenes plasmid unnamed, complete sequence	148959	7271	57621	148959	protease,transposase	Streptococcus_phage(16.0%)	54	NA	NA
WP_002389568.1|7271_7952_+|transposase	IS6 family transposase	transposase	A0A1X9I6C6	Streptococcus_phage	90.7	2.6e-119
WP_076994969.1|8517_8925_-	hypothetical protein	NA	H2DE57	Erwinia_phage	46.0	1.4e-11
WP_012952173.1|8966_9311_-	TnpV protein	NA	NA	NA	NA	NA
WP_003728485.1|10023_10422_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003728486.1|10595_10931_+	helix-turn-helix transcriptional regulator	NA	A0A139ZPK3	Marinitoga_camini_virus	35.0	2.8e-05
WP_003728487.1|10967_11498_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003728488.1|11611_12376_-	Fic family protein	NA	A0A0G3Y4Q5	Ostreid_herpesvirus	29.4	2.6e-06
WP_003728489.1|12395_12767_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003728490.1|12777_14118_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003728491.1|14110_14551_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003728492.1|14562_14802_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003728493.1|15199_16117_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003731844.1|16119_16509_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003728495.1|16471_16708_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003728496.1|17051_18278_+|transposase	IS21 family transposase	transposase	A0A059NT83	Lactococcus_phage	60.6	4.7e-135
WP_013315180.1|18288_19044_+	ATP-binding protein	NA	A0A059NT77	Lactococcus_phage	63.2	2.4e-81
WP_023553716.1|19135_19723_+|transposase	IS3 family transposase	transposase	U5P429	Shigella_phage	41.7	2.5e-33
WP_003728499.1|19756_20512_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003728500.1|20786_22421_-	primase C-terminal domain-containing protein	NA	NA	NA	NA	NA
WP_003728501.1|23160_24135_+	AAA family ATPase	NA	F0PIG8	Enterococcus_phage	35.0	2.4e-33
WP_003728502.1|24112_24409_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003728503.1|24459_25740_-	Y-family DNA polymerase	NA	O64031	Bacillus_phage	44.9	5.2e-92
WP_003728504.1|25727_26072_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003728505.1|26276_27011_-	AAA family ATPase	NA	NA	NA	NA	NA
WP_013315188.1|27185_28526_-|transposase	IS3 family transposase	transposase	A0A0C5AC89	Paenibacillus_phage	38.6	1.1e-31
WP_003728507.1|28801_30916_-|protease	ATP-dependent Clp protease ATP-binding subunit	protease	K4FB40	Cronobacter_phage	39.1	3.4e-117
WP_003728509.1|31343_31580_-	helix-turn-helix transcriptional regulator	NA	A0A097PBE6	Streptococcus_pyogenes_phage	53.4	6.7e-14
WP_003731679.1|31542_31821_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003728510.1|31940_32168_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003728511.1|32157_32766_-	recombinase family protein	NA	A0A1W5LU24	Ralstonia_phage	42.9	1.0e-21
WP_003728512.1|33053_33794_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003728513.1|33805_35572_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003728514.1|36095_36350_+|transposase	transposase	transposase	Q6J1X3	Lactobacillus_phage	46.4	1.6e-13
WP_115914824.1|36346_37234_+|transposase	IS3 family transposase	transposase	Q6J1X2	Lactobacillus_phage	51.1	7.3e-69
WP_003731678.1|37323_38040_-	AP2 domain-containing protein	NA	O03945	Lactobacillus_phage	31.0	3.8e-20
WP_003728517.1|38055_38778_-	CRISPR-associated protein Cas5	NA	NA	NA	NA	NA
WP_003728518.1|38781_39207_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003731677.1|39207_39456_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003728520.1|39577_40066_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003769263.1|40224_40602_-	DUF3850 domain-containing protein	NA	C9E2N9	Enterococcus_phage	55.1	2.2e-14
WP_003731676.1|40620_41283_-	DUF2786 domain-containing protein	NA	NA	NA	NA	NA
WP_003728462.1|41282_41609_-	hypothetical protein	NA	A0A2K9V3N4	Faecalibacterium_phage	40.8	3.2e-06
WP_003728463.1|41739_41991_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003728464.1|42051_42294_+	AbrB/MazE/SpoVT family DNA-binding domain-containing protein	NA	NA	NA	NA	NA
WP_003728465.1|42287_42629_+	type II toxin-antitoxin system PemK/MazF family toxin	NA	NA	NA	NA	NA
WP_003728466.1|42821_44957_-	cadmium-translocating P-type ATPase	NA	E4ZFI9	Streptococcus_phage	64.5	1.6e-247
WP_003728467.1|44956_45316_-	Cd(II)-sensing metalloregulatory transcriptional repressor CadC	NA	E4ZFI8	Streptococcus_phage	50.0	3.1e-26
WP_003728468.1|45595_46150_+	recombinase family protein	NA	A0A0F7LA37	Escherichia_phage	53.4	7.0e-38
WP_003728469.1|46153_49069_+|transposase	Tn3 family transposase	transposase	A0A1B0V7H9	Salmonella_phage	36.7	1.9e-174
WP_003728471.1|50251_52348_-	copper-translocating P-type ATPase CopB	NA	A0A218MNH6	uncultured_virus	31.0	1.1e-70
WP_003728472.1|52623_53187_+	recombinase family protein	NA	A0A0A7NPV4	Enterobacteria_phage	51.1	2.0e-40
WP_003728473.1|53437_54649_+	SIR2 family protein	NA	NA	NA	NA	NA
WP_003728474.1|54641_56495_+	DUF87 domain-containing protein	NA	NA	NA	NA	NA
WP_043993356.1|56979_57621_+|transposase	IS6 family transposase	transposase	A0A1X9I6C6	Streptococcus_phage	83.6	3.0e-101
>prophage 2
NC_022045	Listeria monocytogenes plasmid unnamed, complete sequence	148959	127423	146283	148959	transposase,integrase	Streptococcus_phage(44.44%)	22	128158:128176	134676:134694
WP_003726384.1|127423_128104_-|transposase	IS6 family transposase	transposase	A0A1X9I6C6	Streptococcus_phage	69.0	1.2e-92
128158:128176	attL	AAAACTTTGCAACAGAACC	NA	NA	NA	NA
WP_023558764.1|128163_128667_+|integrase	tyrosine-type recombinase/integrase	integrase	D2XR58	Bacillus_phage	35.9	6.6e-19
WP_003726382.1|128698_129079_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003726381.1|129311_131429_-	cadmium-translocating P-type ATPase	NA	E4ZFI9	Streptococcus_phage	62.6	5.3e-235
WP_003726380.1|131425_131785_-	winged helix-turn-helix transcriptional regulator	NA	E4ZFI8	Streptococcus_phage	48.2	5.4e-23
WP_003725299.1|132058_132658_-	recombinase family protein	NA	I1ZBD6	Salisaeta_icosahedral_phage	31.8	1.8e-15
WP_003725298.1|132816_134253_+|integrase,transposase	DDE-type integrase/transposase/recombinase	integrase,transposase	A0A2H4JGQ6	uncultured_Caudovirales_phage	24.8	9.4e-18
WP_003725297.1|134245_134749_+	AAA family ATPase	NA	NA	NA	NA	NA
134676:134694	attR	GGTTCTGTTGCAAAGTTTT	NA	NA	NA	NA
WP_002319817.1|134748_135429_+|transposase	IS6-like element ISS1N family transposase	transposase	A0A1X9I6C6	Streptococcus_phage	84.1	2.5e-109
WP_077909053.1|135432_136233_+	TraM recognition domain-containing protein	NA	NA	NA	NA	NA
WP_023559429.1|136251_136476_+	hypothetical protein	NA	NA	NA	NA	NA
WP_023559430.1|136465_138079_+	DUF1738 domain-containing protein	NA	NA	NA	NA	NA
WP_157671086.1|138148_138283_-|transposase	IS3 family transposase	transposase	NA	NA	NA	NA
WP_003725294.1|138929_139469_+	efflux transporter transcriptional regulator BcrA	NA	NA	NA	NA	NA
WP_003725293.1|139480_139798_+	quaternary ammonium compound efflux SMR transporter BcrB	NA	NA	NA	NA	NA
WP_171817284.1|139812_140160_+	quaternary ammonium compound efflux SMR transporter BcrC	NA	NA	NA	NA	NA
WP_003725288.1|141085_141442_+	VOC family protein	NA	NA	NA	NA	NA
WP_003725287.1|141837_142701_+	SDR family oxidoreductase	NA	NA	NA	NA	NA
WP_003725286.1|142940_143450_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003750115.1|143520_143709_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003725285.1|143709_144654_+	AAA family ATPase	NA	A7KV75	Bacillus_phage	36.8	9.2e-46
WP_023559431.1|145347_146283_+|transposase	IS30 family transposase	transposase	Q9MBM9	Staphylococcus_prophage	51.0	7.1e-83
