The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
NC_021824	Listeria monocytogenes, complete sequence	2943218	108153	115995	2943218		Streptococcus_phage(50.0%)	7	NA	NA
WP_003725407.1|108153_109125_-	DNA-binding protein WhiA	NA	Q7AWZ3	Streptococcus_phage	39.4	5.2e-52
WP_003731212.1|109132_110101_-	YvcK family protein	NA	A1IMD5	Streptococcus_phage	43.6	1.8e-68
WP_003722606.1|110102_110978_-	RNase adapter RapZ	NA	A0A0R8VB27	Thermobifida_phage	29.7	1.9e-08
WP_009927825.1|111085_112816_-	phospho-sugar mutase	NA	A0A1X9I671	Streptococcus_phage	53.1	2.1e-173
WP_009918600.1|112857_113919_-	galactose mutarotase	NA	NA	NA	NA	NA
WP_009918601.1|113935_114919_-	UDP-glucose 4-epimerase GalE	NA	A0A2K9L5H6	Tupanvirus	38.7	3.1e-52
WP_003722610.1|115035_115995_-	thioredoxin-disulfide reductase	NA	G3MA85	Bacillus_virus	53.7	2.0e-88
>prophage 2
NC_021824	Listeria monocytogenes, complete sequence	2943218	628398	634925	2943218	tail	Listeria_phage(33.33%)	10	NA	NA
WP_003728215.1|628398_628851_-	ImmA/IrrE family metallo-endopeptidase	NA	A0A059T7S0	Listeria_phage	47.9	4.0e-31
WP_003721740.1|628856_629192_-	helix-turn-helix transcriptional regulator	NA	A0A2H4JAR9	uncultured_Caudovirales_phage	52.5	4.0e-20
WP_009927883.1|629408_629837_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003731177.1|629848_630265_+	hypothetical protein	NA	A8ASQ1	Listeria_phage	37.9	6.5e-20
WP_003728212.1|630544_630934_+	DUF5072 family protein	NA	NA	NA	NA	NA
WP_003721744.1|630946_631459_+|tail	phage major tail protein, TP901-1 family	tail	A0A097PBF4	Streptococcus_pyogenes_phage	62.7	1.2e-47
WP_003721745.1|631506_631809_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003740367.1|631850_632255_+	hypothetical protein	NA	NA	NA	NA	NA
WP_009928420.1|632241_634110_+	membrane protein	NA	A0A097PAU2	Streptococcus_pyogenes_phage	45.8	4.5e-20
WP_003734720.1|634106_634925_+|tail	phage tail family protein	tail	A0A060AFE1	Staphylococcus_phage	35.0	7.2e-39
>prophage 3
NC_021824	Listeria monocytogenes, complete sequence	2943218	1625214	1632637	2943218		Hokovirus(33.33%)	8	NA	NA
WP_003730941.1|1625214_1625598_+	glycerol-3-phosphate cytidylyltransferase	NA	A0A1V0SGE7	Hokovirus	40.7	1.4e-16
WP_003727002.1|1625619_1626603_+	glycosyltransferase family 2 protein	NA	A0A1V0SAH6	Catovirus	33.8	2.0e-11
WP_023550414.1|1626617_1627631_+	glycosyltransferase	NA	A0A1V0SAH6	Catovirus	31.2	1.8e-10
WP_003721509.1|1627839_1629330_+	nicotinate phosphoribosyltransferase	NA	G3MA18	Bacillus_virus	49.7	9.5e-114
WP_023550416.1|1629341_1630166_+	ammonia-dependent NAD(+) synthetase	NA	G3MA24	Bacillus_virus	52.2	1.3e-67
WP_009929872.1|1630178_1630487_+	antibiotic biosynthesis monooxygenase	NA	NA	NA	NA	NA
WP_009929871.1|1630547_1630952_+	PTS lactose transporter subunit IIBC	NA	NA	NA	NA	NA
WP_023550418.1|1631080_1632637_+	glutamine-hydrolyzing GMP synthase	NA	A0A1V0SH76	Hokovirus	29.2	6.0e-18
>prophage 4
NC_021824	Listeria monocytogenes, complete sequence	2943218	1728523	1830655	2943218	tail,capsid,portal,protease,terminase,integrase,holin,tRNA	Listeria_phage(77.61%)	113	1754272:1754295	1799622:1799645
WP_003721619.1|1728523_1729576_+|tRNA	phenylalanine--tRNA ligase subunit alpha	tRNA	A0A2K9L3A8	Tupanvirus	34.9	1.3e-29
WP_009927922.1|1729575_1731984_+|tRNA	phenylalanine--tRNA ligase subunit beta	tRNA	NA	NA	NA	NA
WP_003721621.1|1732144_1732846_+	ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	35.8	3.0e-33
WP_023550449.1|1732859_1736270_+	FtsX-like permease family protein	NA	NA	NA	NA	NA
WP_003724750.1|1736367_1736820_+	winged helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_003724751.1|1736835_1740036_+	MMPL family transporter	NA	NA	NA	NA	NA
WP_003724752.1|1740139_1740814_+	uracil-DNA glycosylase	NA	A0A172DS90	Canid_alphaherpesvirus	47.7	3.4e-50
WP_012681263.1|1740851_1741778_-	ribonuclease HIII	NA	NA	NA	NA	NA
WP_003740576.1|1741931_1742195_+	cell division protein ZapA	NA	NA	NA	NA	NA
WP_003726937.1|1742194_1742737_+	CvpA family protein	NA	NA	NA	NA	NA
WP_023550452.1|1742828_1744541_+	DNA polymerase/3'-5' exonuclease PolX	NA	A0A2H4UV14	Bodo_saltans_virus	24.5	1.9e-17
WP_003734676.1|1744563_1746921_+	endonuclease MutS2	NA	Q94M10	Lactobacillus_phage	50.4	1.0e-21
WP_003723853.1|1747001_1747313_+	thioredoxin	NA	A0A1X9I9P5	Staphylococcus_phage	39.6	5.4e-19
WP_003726544.1|1747388_1749200_+	excinuclease ABC subunit UvrC	NA	NA	NA	NA	NA
WP_003726934.1|1749380_1750595_+	aspartate kinase	NA	NA	NA	NA	NA
WP_012681265.1|1750650_1751145_-	YslB family protein	NA	NA	NA	NA	NA
WP_003723856.1|1751292_1752093_+	glutamate racemase	NA	NA	NA	NA	NA
WP_003730987.1|1752105_1752852_+	ribonuclease PH	NA	NA	NA	NA	NA
WP_009928777.1|1752854_1753466_+	XTP/dITP diphosphatase	NA	Q66YC8	Euphorbia_ringspot_virus	28.0	8.7e-05
WP_003726034.1|1753502_1754027_+	metallophosphoesterase	NA	NA	NA	NA	NA
1754272:1754295	attL	TGAATGTTTTAGAGATTTTTTTAT	NA	NA	NA	NA
WP_009928775.1|1754312_1755467_-|integrase	site-specific integrase	integrase	A8ATC7	Listeria_phage	99.0	3.9e-216
WP_023550454.1|1755601_1756174_-	hypothetical protein	NA	NA	NA	NA	NA
WP_009928772.1|1756224_1756677_-	ImmA/IrrE family metallo-endopeptidase	NA	A0A059T7S0	Listeria_phage	94.7	4.2e-81
WP_009928771.1|1756693_1757017_-	helix-turn-helix transcriptional regulator	NA	A0A059T6G1	Listeria_phage	72.0	1.7e-36
WP_041198282.1|1757288_1757477_+	helix-turn-helix domain-containing protein	NA	A0A1S7FYV9	Listeria_phage	60.0	2.6e-13
WP_009929535.1|1757997_1758321_+	hypothetical protein	NA	NA	NA	NA	NA
WP_009929536.1|1758335_1758539_+	helix-turn-helix transcriptional regulator	NA	A0A059T5F8	Listeria_phage	100.0	3.1e-28
WP_009929538.1|1758540_1758783_+	hypothetical protein	NA	A8ATD2	Listeria_phage	98.8	7.0e-43
WP_009929539.1|1758785_1758971_+	hypothetical protein	NA	A0A059T7Z3	Listeria_phage	96.7	1.7e-28
WP_009929542.1|1759205_1759358_+	hypothetical protein	NA	A8ATD4	Listeria_phage	100.0	1.5e-19
WP_009929543.1|1759494_1760208_+	SAM-dependent DNA methyltransferase	NA	A8ATD5	Listeria_phage	98.7	2.4e-131
WP_023550460.1|1760218_1761163_+|integrase	site-specific integrase	integrase	A8ATD6	Listeria_phage	97.1	2.1e-175
WP_009928035.1|1761175_1761856_+	hypothetical protein	NA	A8ATD7	Listeria_phage	96.5	1.1e-120
WP_009928033.1|1761852_1762422_+	DUF1642 domain-containing protein	NA	A8ATY9	Listeria_phage	60.7	7.0e-57
WP_009928031.1|1762418_1762943_+	hypothetical protein	NA	A8ASP1	Listeria_phage	53.4	2.0e-34
WP_009928030.1|1762939_1763530_+	pentapeptide repeat-containing protein	NA	M4H0V1	Listeria_phage	84.7	2.0e-38
WP_009928027.1|1763733_1763934_+	hypothetical protein	NA	NA	NA	NA	NA
WP_009928026.1|1763930_1764431_+	hypothetical protein	NA	NA	NA	NA	NA
WP_009928025.1|1764476_1765037_-	hypothetical protein	NA	NA	NA	NA	NA
WP_009928024.1|1765141_1765315_+	hypothetical protein	NA	A0A059T5G3	Listeria_phage	98.2	8.9e-24
WP_009928023.1|1765311_1765695_+	hypothetical protein	NA	Q8W5W2	Listeria_phage	92.1	1.6e-60
WP_009928021.1|1765696_1766176_+	siphovirus Gp157 family protein	NA	A0A059T803	Listeria_phage	77.2	2.6e-57
WP_009928020.1|1766194_1766887_+	AAA family ATPase	NA	A8ATF0	Listeria_phage	94.3	1.9e-120
WP_023550462.1|1766950_1768207_+	DEAD/DEAH box helicase	NA	Q8W5V9	Listeria_phage	95.0	3.3e-232
WP_009928019.1|1768231_1768717_+	DUF669 domain-containing protein	NA	A0A059T5G4	Listeria_phage	100.0	2.9e-88
WP_009928017.1|1768739_1771082_+	DNA primase	NA	A0A059T6A4	Listeria_phage	43.4	5.5e-148
WP_009928016.1|1771377_1771698_+	VRR-NUC domain-containing protein	NA	Q8W5V6	Listeria_phage	99.1	4.0e-54
WP_009928015.1|1771694_1771964_+	hypothetical protein	NA	W0GBM0	Listeria_phage	73.6	6.9e-15
WP_026747296.1|1772074_1772605_+	DUF3310 domain-containing protein	NA	A0A059T7T5	Listeria_phage	76.7	2.8e-76
WP_009928014.1|1772605_1773031_+	DUF722 domain-containing protein	NA	Q8W5V4	Listeria_phage	93.6	2.7e-69
WP_009928013.1|1773260_1774160_+	hypothetical protein	NA	NA	NA	NA	NA
WP_023550466.1|1774420_1774747_+	hypothetical protein	NA	A0A059T5G5	Listeria_phage	95.4	8.6e-52
WP_009928009.1|1774746_1775061_+	HNH endonuclease	NA	A8ATF8	Listeria_phage	99.0	3.8e-57
WP_014929542.1|1775109_1775466_+|terminase	P27 family phage terminase small subunit	terminase	A0A059T7Y1	Listeria_phage	97.0	4.5e-46
WP_023550468.1|1775462_1777106_+|terminase	terminase large subunit	terminase	A0A059T7Q8	Listeria_phage	98.0	0.0e+00
WP_009928006.1|1777115_1777505_-	DUF2513 domain-containing protein	NA	A0A1Q1PVT8	Staphylococcus_phage	39.8	4.8e-17
WP_009928005.1|1777555_1778686_+|portal	phage portal protein	portal	A0A059T6F0	Listeria_phage	95.5	4.6e-209
WP_009928004.1|1778682_1779399_+|protease	Clp protease ClpP	protease	A0A1S5SFF8	Streptococcus_phage	57.4	5.5e-67
WP_023550470.1|1779425_1780577_+|capsid	phage major capsid protein	capsid	A0A059T678	Listeria_phage	99.7	6.3e-214
WP_023550473.1|1780583_1780754_+	hypothetical protein	NA	A0A059T7Y2	Listeria_phage	98.2	1.8e-21
WP_014930914.1|1780763_1781063_+	hypothetical protein	NA	A0A059T7R0	Listeria_phage	100.0	5.3e-48
WP_009929554.1|1781046_1781412_+	hypothetical protein	NA	A0A059T6F2	Listeria_phage	98.3	7.1e-63
WP_009929555.1|1781408_1781810_+	hypothetical protein	NA	A8ATA2	Listeria_phage	94.7	4.9e-65
WP_009929557.1|1781806_1782190_+	hypothetical protein	NA	A0A059T681	Listeria_phage	97.6	9.4e-66
WP_009929558.1|1782210_1782798_+|tail	phage tail protein	tail	A0A059T7Y4	Listeria_phage	99.0	9.9e-107
WP_014930918.1|1782868_1783201_+	hypothetical protein	NA	A0A059T7R2	Listeria_phage	97.3	5.1e-52
WP_023550475.1|1783251_1783413_+	hypothetical protein	NA	A0A059T6F4	Listeria_phage	95.9	1.2e-19
WP_023550477.1|1783416_1788336_+|tail	phage tail tape measure protein	tail	A0A059T5F4	Listeria_phage	94.0	0.0e+00
WP_009928174.1|1788328_1789978_+|tail	phage tail family protein	tail	A0A059T682	Listeria_phage	99.1	0.0e+00
WP_009928176.1|1789990_1792285_+|tail	phage tail protein	tail	A0A059T7Y6	Listeria_phage	99.2	0.0e+00
WP_009928177.1|1792274_1793369_+	hypothetical protein	NA	A0A059T7R4	Listeria_phage	99.2	1.8e-202
WP_009928178.1|1793418_1793862_+	hypothetical protein	NA	A0A059T6F6	Listeria_phage	100.0	6.8e-76
WP_009928179.1|1793840_1794257_+	hypothetical protein	NA	A0A059T5F5	Listeria_phage	99.3	9.3e-43
WP_009928180.1|1794277_1794544_+|holin	phage holin	holin	A0A059T684	Listeria_phage	95.5	3.0e-39
WP_009928181.1|1794543_1795395_+	M15 family metallopeptidase	NA	A0A059T7Y8	Listeria_phage	97.2	2.3e-144
WP_009928182.1|1795472_1795970_-	AP2 domain-containing protein	NA	A8ATW6	Listeria_phage	98.2	3.5e-89
WP_003722518.1|1795994_1796444_-	anti-CRISPR protein AcrIIA1	NA	A8ATW7	Listeria_phage	100.0	2.4e-76
WP_009928183.1|1796449_1796821_-	anti-CRISPR protein AcrIIA2	NA	A0A059T5F6	Listeria_phage	92.7	9.1e-58
WP_009924649.1|1796849_1797083_-	hypothetical protein	NA	A8ATW9	Listeria_phage	48.1	9.2e-08
WP_009928184.1|1797386_1797620_+	hypothetical protein	NA	A8ATX0	Listeria_phage	92.2	7.5e-34
WP_003726037.1|1798500_1798974_+	hypothetical protein	NA	NA	NA	NA	NA
WP_009928186.1|1799079_1799442_+	hypothetical protein	NA	NA	NA	NA	NA
WP_023550479.1|1800110_1804682_+	MucBP domain-containing protein	NA	NA	NA	NA	NA
1799622:1799645	attR	TGAATGTTTTAGAGATTTTTTTAT	NA	NA	NA	NA
WP_003726042.1|1804804_1806163_+	DUF1254 domain-containing protein	NA	NA	NA	NA	NA
WP_003726043.1|1806205_1806799_-	YdeI/OmpD-associated family protein	NA	NA	NA	NA	NA
WP_003726044.1|1806935_1807343_-	glyoxalase/bleomycin resistance/extradiol dioxygenase family protein	NA	NA	NA	NA	NA
WP_003726045.1|1807507_1808107_+	histidine phosphatase family protein	NA	A0A1X9IGJ2	Lactococcus_phage	41.0	1.3e-29
WP_009928848.1|1808138_1808399_-	hypothetical protein	NA	NA	NA	NA	NA
WP_023550481.1|1808522_1809935_+	ATP-dependent RNA helicase DbpA	NA	Q5GF26	Diachasmimorpha_longicaudata_entomopoxvirus	32.0	4.9e-51
WP_003726048.1|1809959_1810223_+	DUF3116 family protein	NA	NA	NA	NA	NA
WP_003727535.1|1810390_1810867_+	8-oxo-dGTP diphosphatase	NA	NA	NA	NA	NA
WP_003726050.1|1810904_1811150_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003726051.1|1811146_1812352_-	MFS transporter	NA	NA	NA	NA	NA
WP_003726052.1|1812556_1813216_+	Crp/Fnr family transcriptional regulator	NA	NA	NA	NA	NA
WP_003726053.1|1813255_1813450_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003726054.1|1813516_1814365_-	YitT family protein	NA	NA	NA	NA	NA
WP_003723553.1|1814694_1814832_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003726055.1|1814982_1815696_+	trehalose operon repressor	NA	NA	NA	NA	NA
WP_014929571.1|1815726_1817373_-	alpha,alpha-phosphotrehalase	NA	NA	NA	NA	NA
WP_003727531.1|1817391_1818876_-	PTS system trehalose-specific EIIBC component	NA	NA	NA	NA	NA
WP_003726723.1|1818993_1819455_+	NUDIX hydrolase	NA	NA	NA	NA	NA
WP_003726717.1|1819493_1819958_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003726718.1|1820146_1821061_+	alpha/beta hydrolase	NA	NA	NA	NA	NA
WP_023550483.1|1821086_1822334_-	glutamate-5-semialdehyde dehydrogenase	NA	A0A1X9I5D4	Streptococcus_phage	51.8	7.2e-107
WP_003726720.1|1822317_1823148_-	glutamate 5-kinase	NA	A0A1X9I5D0	Streptococcus_phage	42.4	3.6e-46
WP_003734523.1|1823294_1824434_-|protease	PrsW family intramembrane metalloprotease	protease	NA	NA	NA	NA
WP_003723563.1|1824513_1824909_-	helix-turn-helix transcriptional regulator	NA	A9D9J6	Lactobacillus_prophage	57.4	1.3e-14
WP_003727524.1|1825059_1825275_+	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_003727523.1|1825398_1825932_+|protease	matrixin family metalloprotease	protease	NA	NA	NA	NA
WP_003731300.1|1825947_1826613_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003727521.1|1826874_1827813_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003723884.1|1827927_1829211_+	trigger factor	NA	NA	NA	NA	NA
WP_003723886.1|1829395_1830655_+|protease	ATP-dependent protease ATP-binding subunit ClpX	protease	G3M9Z9	Bacillus_virus	63.2	1.4e-145
>prophage 5
NC_021824	Listeria monocytogenes, complete sequence	2943218	2371228	2379514	2943218		Synechococcus_phage(33.33%)	8	NA	NA
WP_003726209.1|2371228_2371795_-	phosphoribosylglycinamide formyltransferase	NA	M4QRX9	Synechococcus_phage	36.4	8.3e-26
WP_003726210.1|2371791_2372841_-	phosphoribosylformylglycinamidine cyclo-ligase	NA	Q58MH8	Prochlorococcus_phage	44.4	3.2e-63
WP_003722245.1|2372859_2374287_-	amidophosphoribosyltransferase	NA	A0A0M3SGR2	Mollivirus	34.6	1.1e-53
WP_009918191.1|2374271_2376491_-	phosphoribosylformylglycinamidine synthase subunit PurL	NA	A6N228	Microbacterium_phage	40.8	6.5e-159
WP_003726212.1|2376483_2377167_-	phosphoribosylformylglycinamidine synthase subunit PurQ	NA	NA	NA	NA	NA
WP_003722248.1|2377170_2377416_-	phosphoribosylformylglycinamidine synthase subunit PurS	NA	NA	NA	NA	NA
WP_003726214.1|2377427_2378141_-	phosphoribosylaminoimidazolesuccinocarboxamide synthase	NA	A0A0E3F9V5	Synechococcus_phage	38.3	2.0e-40
WP_003729814.1|2378221_2379514_-	adenylosuccinate lyase	NA	A0A1B3B081	Gordonia_phage	33.0	2.5e-17
