The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
NC_021820	Salmonella enterica subsp. enterica serovar 4,[5],12:i:- str. 08-1736, complete sequence	4822189	820039	870059	4822189	plate,tRNA,tail	Burkholderia_phage(37.5%)	51	NA	NA
WP_001285165.1|820039_820987_-|tRNA	methionyl-tRNA formyltransferase	tRNA	E3SNR5	Prochlorococcus_phage	35.9	8.4e-07
WP_000114987.1|821002_821512_-	peptide deformylase	NA	E3SLL2	Synechococcus_phage	41.1	6.7e-19
WP_000124529.1|821643_822768_+	DNA-protecting protein DprA	NA	NA	NA	NA	NA
WP_000460663.1|822739_823213_+	DUF494 domain-containing protein	NA	NA	NA	NA	NA
WP_001129708.1|823239_823782_+	DNA topoisomerase	NA	NA	NA	NA	NA
WP_001063609.1|823786_824359_+	L-threonylcarbamoyladenylate synthase type 1 TsaC	NA	A0A291ATS8	Pandoravirus	27.3	9.9e-11
WP_000451193.1|824363_825182_+	shikimate dehydrogenase	NA	NA	NA	NA	NA
WP_001070571.1|825178_825436_+	DUF1488 domain-containing protein	NA	NA	NA	NA	NA
WP_001285640.1|825411_825966_-	gamma carbonic anhydrase family protein	NA	NA	NA	NA	NA
WP_000795911.1|826079_826232_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000973242.1|831968_832406_-	acetyltransferase	NA	NA	NA	NA	NA
WP_001122767.1|832562_833492_+	homoserine O-succinyltransferase	NA	NA	NA	NA	NA
WP_001069372.1|833760_835362_+	malate synthase A	NA	NA	NA	NA	NA
WP_000857881.1|835393_836698_+	isocitrate lyase	NA	NA	NA	NA	NA
WP_001137266.1|836799_838551_+	bifunctional isocitrate dehydrogenase kinase/phosphatase	NA	NA	NA	NA	NA
WP_010989091.1|838514_838922_-	ASCH domain-containing protein	NA	NA	NA	NA	NA
WP_000226434.1|838932_839757_-	glyoxylate bypass operon transcriptional repressor IclR	NA	NA	NA	NA	NA
WP_000095958.1|840060_843744_+	methionine synthase	NA	A0A140XBC7	Dickeya_phage	90.2	1.3e-26
WP_000956811.1|844010_845642_+	Na/Pi cotransporter family protein	NA	NA	NA	NA	NA
WP_000421792.1|845717_846407_-	dipeptidase PepE	NA	NA	NA	NA	NA
WP_001541281.1|846478_846580_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001096724.1|846614_847154_+	DUF2058 domain-containing protein	NA	NA	NA	NA	NA
WP_020843455.1|847200_848070_+	23S rRNA pseudouridine(2604) synthase RluF	NA	NA	NA	NA	NA
WP_001207628.1|848066_848339_-	DUF3811 domain-containing protein	NA	NA	NA	NA	NA
WP_000881652.1|848436_849378_-	ketopantoate/pantoate/pantothenate transporter PanS	NA	NA	NA	NA	NA
WP_000587738.1|849639_850368_-	hypothetical protein	NA	A0A077SLK3	Escherichia_phage	37.3	5.6e-35
WP_010989092.1|850564_850855_-	membrane protein	NA	NA	NA	NA	NA
WP_000084331.1|851103_851559_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001526208.1|851555_852161_-	DUF4376 domain-containing protein	NA	NA	NA	NA	NA
WP_000368196.1|852165_853911_-|tail	tail fiber protein	tail	A0A0M3ULF6	Salmonella_phage	52.2	3.2e-52
WP_000359500.1|853913_854546_-|tail	phage tail protein I	tail	Q6QI98	Burkholderia_phage	56.4	6.6e-24
WP_000951736.1|854538_855654_-|plate	baseplate J/gp47 family protein	plate	Q6QI99	Burkholderia_phage	52.2	1.8e-101
WP_001093501.1|855644_856004_-	GPW/gp25 family protein	NA	Q6QIA0	Burkholderia_phage	64.2	2.8e-35
WP_001095011.1|856167_857715_-	membrane protein	NA	B9UDL6	Salmonella_phage	29.9	1.9e-48
WP_000703632.1|857714_858644_-	glycosyltransferase family 2 protein	NA	S5FKN0	Shigella_phage	83.8	8.8e-150
WP_000593182.1|858640_859003_-	GtrA family protein	NA	I1TED9	Salmonella_phage	70.8	1.2e-43
WP_000679398.1|859330_860053_-|plate	phage baseplate assembly protein V	plate	A0A067ZIM2	Vibrio_phage	41.0	3.3e-11
WP_000818154.1|860062_861106_-	phage late control D family protein	NA	Q6QIA2	Burkholderia_phage	45.1	2.5e-76
WP_001269716.1|861093_861303_-|tail	tail protein X	tail	A4JWL2	Burkholderia_virus	60.3	9.8e-17
WP_000271423.1|861302_862256_-	methyl-accepting chemotaxis protein	NA	A4JWL1	Burkholderia_virus	50.8	2.3e-36
WP_001262500.1|862255_864610_-|tail	phage tail tape measure protein	tail	A4JWL0	Burkholderia_virus	30.6	6.9e-66
WP_001185654.1|864706_864835_-|tail	GpE family phage tail protein	tail	NA	NA	NA	NA
WP_001003642.1|864794_865112_-|tail	phage tail assembly protein	tail	NA	NA	NA	NA
WP_000907494.1|865163_865688_-|tail	phage major tail tube protein	tail	Q6QIA9	Burkholderia_phage	69.5	2.8e-68
WP_000729852.1|865687_867115_-|tail	phage tail sheath family protein	tail	A4JWK5	Burkholderia_virus	70.9	1.1e-194
WP_000875314.1|867104_867302_-	hypothetical protein	NA	Q6QIB1	Burkholderia_phage	52.9	8.6e-07
WP_000449433.1|867298_867754_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000777266.1|867913_868228_-	membrane protein	NA	Q6QIC4	Burkholderia_phage	49.1	6.4e-20
WP_001270440.1|868240_868846_-	lytic transglycosylase domain-containing protein	NA	Q5ZQZ1	Pseudomonas_phage	59.4	1.2e-59
WP_001226442.1|868848_869136_-	membrane protein	NA	Q6QIC8	Burkholderia_phage	49.1	2.3e-16
WP_000615248.1|869711_870059_+	DNA-binding protein	NA	Q6QIE8	Burkholderia_phage	51.5	4.9e-21
>prophage 2
NC_021820	Salmonella enterica subsp. enterica serovar 4,[5],12:i:- str. 08-1736, complete sequence	4822189	2263963	2272695	4822189	transposase,protease	Dickeya_phage(14.29%)	7	NA	NA
WP_001201751.1|2263963_2265082_+	macrolide transporter subunit MacA	NA	A0A140XAI1	Dickeya_phage	38.9	1.4e-08
WP_000125877.1|2265078_2267025_+	macrolide ABC transporter ATP-binding protein/permease MacB	NA	G9BWD6	Planktothrix_phage	43.1	2.0e-39
WP_000447499.1|2267154_2267376_-	cold shock-like protein CspD	NA	A0A2H4N7Y6	Lake_Baikal_phage	64.2	9.3e-18
WP_000520789.1|2267699_2268020_+|protease	ATP-dependent Clp protease adapter ClpS	protease	A0A1B1IT64	uncultured_Mediterranean_phage	45.7	4.5e-13
WP_000934063.1|2268050_2270327_+|protease	ATP-dependent Clp protease ATP-binding subunit ClpA	protease	A0A223W0B1	Agrobacterium_phage	42.3	6.2e-165
WP_000502119.1|2270518_2270977_+|transposase	IS200/IS605-like element IS200F family transposase	transposase	I4AZI8	Saccharomonospora_phage	31.5	1.0e-13
WP_085983316.1|2271439_2272695_-|transposase	IS3-like element ISSen1 family transposase	transposase	Q6H9S3	Enterobacteria_phage	33.9	5.4e-17
>prophage 3
NC_021820	Salmonella enterica subsp. enterica serovar 4,[5],12:i:- str. 08-1736, complete sequence	4822189	2322788	2421597	4822189	protease,terminase,tail,portal,holin,lysis,tRNA	Salmonella_phage(42.86%)	101	NA	NA
WP_001154025.1|2322788_2323592_+|tRNA	tRNA uridine 5-oxyacetic acid(34) methyltransferase CmoM	tRNA	NA	NA	NA	NA
WP_001288828.1|2323584_2324907_+	chromosome partition protein MukF	NA	NA	NA	NA	NA
WP_000060025.1|2324887_2325592_+	chromosome partition protein MukE	NA	NA	NA	NA	NA
WP_000572724.1|2325591_2330058_+	chromosome partition protein MukB	NA	NA	NA	NA	NA
WP_000925872.1|2330402_2332244_+	L,D-transpeptidase	NA	NA	NA	NA	NA
WP_000357052.1|2332503_2333052_+	YcbK family protein	NA	A0A0K1LKR7	Rhodobacter_phage	33.7	1.2e-05
WP_001109471.1|2333079_2333727_+	MBL fold metallo-hydrolase	NA	NA	NA	NA	NA
WP_000462653.1|2333788_2334979_-	aspartate transaminase	NA	NA	NA	NA	NA
WP_000977713.1|2335163_2336255_-	porin OmpF	NA	Q1MVN1	Enterobacteria_phage	51.7	2.2e-99
WP_000117870.1|2336861_2338262_-|tRNA	asparagine--tRNA ligase	tRNA	A0A167RLM0	Powai_lake_megavirus	35.1	4.5e-81
WP_000762342.1|2338462_2338924_-	Lrp/AsnC family transcriptional regulator	NA	NA	NA	NA	NA
WP_000544849.1|2339240_2340455_+	diaminopropionate ammonia-lyase	NA	NA	NA	NA	NA
WP_000893207.1|2340699_2342136_+	sodium:alanine symporter family protein	NA	NA	NA	NA	NA
WP_000191399.1|2342213_2343416_-	nicotinate phosphoribosyltransferase	NA	NA	NA	NA	NA
WP_001262306.1|2343610_2344903_-	DUF3596 domain-containing protein	NA	S4TSP2	Salmonella_phage	99.8	1.0e-252
WP_000065276.1|2344947_2345196_-	excisionase family protein	NA	S4TND0	Salmonella_phage	100.0	4.7e-42
WP_001237031.1|2345236_2345476_-	DUF4060 family protein	NA	S4TR31	Salmonella_phage	100.0	2.0e-37
WP_001539618.1|2345518_2346676_-	recombinase RecT	NA	S4TTE8	Salmonella_phage	100.0	1.6e-217
WP_000017133.1|2346638_2349524_-	PD-(D/E)XK nuclease-like domain-containing protein	NA	S4TNL0	Salmonella_phage	97.3	0.0e+00
WP_001668146.1|2349650_2349950_-	hypothetical protein	NA	S4TSN6	Salmonella_phage	84.5	8.1e-49
WP_000917564.1|2349971_2350130_-	hypothetical protein	NA	H6WRX3	Salmonella_phage	98.1	1.2e-22
WP_014344008.1|2350122_2350383_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001038966.1|2350432_2350843_-	helix-turn-helix domain-containing protein	NA	A0A1B5FPF4	Escherichia_phage	42.4	8.1e-07
WP_000370145.1|2350962_2351202_+	helix-turn-helix domain-containing protein	NA	H6WRX5	Salmonella_phage	47.2	8.3e-12
WP_001574095.1|2351167_2351542_+	hypothetical protein	NA	S4TTD7	Salmonella_phage	99.2	3.9e-64
WP_000062941.1|2351626_2352610_+	replication protein	NA	H6WRX7	Salmonella_phage	100.0	1.9e-163
WP_000800013.1|2352612_2353362_+	ATP-binding protein	NA	S4TNF5	Salmonella_phage	99.2	1.1e-137
WP_000113629.1|2353372_2353720_+	DUF977 family protein	NA	H6WRX9	Salmonella_phage	89.6	5.4e-52
WP_000065108.1|2353716_2354028_+	ead/Ea22-like family protein	NA	A0A220NQV2	Salmonella_phage	97.2	7.2e-32
WP_014343823.1|2354105_2354396_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001217665.1|2354687_2354921_+	DinI family protein	NA	H6WRY5	Salmonella_phage	98.7	2.1e-36
WP_000807548.1|2355032_2355254_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000929805.1|2355336_2355939_+	DUF1367 family protein	NA	S4TTI0	Salmonella_phage	98.5	8.3e-109
WP_001096552.1|2356147_2356759_+	recombination protein NinG	NA	A0A0M4RU10	Salmonella_phage	91.6	6.9e-79
WP_001617856.1|2356755_2356902_+	YlcG family protein	NA	A0A0M5M7B2	Salmonella_phage	97.9	4.3e-19
WP_001047631.1|2356891_2357689_+	antitermination protein	NA	A0A0M4S661	Salmonella_phage	99.6	2.3e-151
WP_010989004.1|2357755_2358073_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001534733.1|2358246_2358372_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000798705.1|2358507_2358957_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001141973.1|2359317_2360004_-|protease	type III secretion system effector protease GtgA	protease	Q9MBM0	Phage_Gifsy-2	100.0	2.1e-132
WP_001574216.1|2360279_2360609_+|holin	phage holin, lambda family	holin	A0A0M3ULK9	Salmonella_phage	100.0	5.8e-56
WP_000984586.1|2360592_2361045_+	lysozyme	NA	A0A0M4R365	Salmonella_phage	97.3	2.3e-79
WP_001541990.1|2361062_2361542_+|lysis	lysis protein	lysis	Q56118	Enterobacteria_phage	77.0	1.4e-55
WP_000371784.1|2361749_2362283_+	DUF1441 family protein	NA	A0A291AWV8	Escherichia_phage	48.1	1.0e-33
WP_000989241.1|2362239_2364378_+|terminase	phage terminase large subunit family protein	terminase	A5LH27	Enterobacteria_phage	72.6	3.4e-290
WP_000196190.1|2364374_2364581_+	hypothetical protein	NA	A0A1W6JT66	Pseudomonas_phage	53.3	2.9e-05
WP_001009207.1|2364577_2366125_+|portal	phage portal protein	portal	A0A291AWU2	Escherichia_phage	64.3	2.8e-177
WP_010989008.1|2366048_2368130_+|protease	Clp protease ClpP	protease	A0A291AWT6	Escherichia_phage	69.5	4.8e-265
WP_001107908.1|2368220_2368544_+	DUF2190 family protein	NA	K7PLV6	Enterobacteria_phage	61.3	7.7e-29
WP_000774239.1|2368536_2368836_+	ATP-binding protein	NA	K7PH43	Enterobacteria_phage	45.1	4.5e-15
WP_000453194.1|2368816_2369383_+|tail	phage tail protein	tail	Q9G063	Phage_Gifsy-2	97.8	9.5e-14
WP_000196702.1|2369379_2369781_+|tail	tail protein	tail	K7PHM6	Enterobacterial_phage	60.9	1.5e-42
WP_000132756.1|2369792_2370542_+|tail	phage tail protein	tail	A0A291AWU6	Escherichia_phage	68.6	3.7e-90
WP_000478859.1|2370587_2370986_+|tail	phage minor tail protein G	tail	K7PLV8	Enterobacteria_phage	56.8	8.6e-30
WP_010989009.1|2370982_2371312_+|tail	phage tail assembly protein T	tail	A5LH37	Enterobacteria_phage	50.9	5.0e-23
WP_010989010.1|2371391_2374379_+|tail	phage tail tape measure protein	tail	A0A291AWX1	Escherichia_phage	62.1	8.2e-266
WP_000978296.1|2374375_2374708_+|tail	phage tail protein	tail	A5LH39	Enterobacteria_phage	61.5	3.3e-35
WP_000725267.1|2374806_2375304_+	Ail/Lom family outer membrane beta-barrel protein	NA	A0A1B0VBR9	Salmonella_phage	36.6	1.4e-16
WP_000877926.1|2375420_2375954_-	superoxide dismutase [Cu-Zn]	NA	Q9MC02	Salmonella_phage	54.0	1.8e-46
WP_001152415.1|2376043_2376739_+|tail	phage minor tail protein L	tail	A0A0K2FJ01	Enterobacteria_phage	66.7	1.3e-89
WP_000606351.1|2376748_2377486_+|tail	phage tail protein	tail	A0A0P0ZE89	Stx2-converting_phage	76.1	1.6e-114
WP_000246065.1|2377383_2378088_+|tail	tail assembly protein	tail	A5LH42	Enterobacteria_phage	62.6	9.2e-67
WP_001541993.1|2380634_2381510_+	DUF1983 domain-containing protein	NA	K7PKJ2	Enterobacteria_phage	77.1	1.1e-48
WP_000178849.1|2381548_2381791_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001144679.1|2381844_2384283_+|tail	prophage tail fiber N-terminal domain-containing protein	tail	A0A0K2FIZ6	Escherichia_phage	63.4	2.9e-91
WP_000143167.1|2384282_2384864_+|tail	tail fiber assembly protein	tail	A0A0M4RTP2	Salmonella_phage	89.5	1.7e-95
WP_001526469.1|2385339_2386308_+	SPI-2 type III secretion system effector SseI	NA	Q9MBL9	Phage_Gifsy-2	100.0	7.1e-195
WP_000334547.1|2386955_2387582_-	SOS response-associated peptidase	NA	A0A2H4J5W2	uncultured_Caudovirales_phage	63.2	1.4e-66
WP_010989011.1|2387650_2387950_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001525490.1|2387934_2388621_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000497441.1|2388891_2389083_-	DinI-like family protein	NA	S4TNM0	Salmonella_phage	95.2	6.2e-26
WP_000193784.1|2389509_2392122_+	aminopeptidase N	NA	A0A0P0IY26	Acinetobacter_phage	22.6	6.3e-20
WP_000291723.1|2392329_2393340_+	quinone-dependent dihydroorotate dehydrogenase	NA	NA	NA	NA	NA
WP_001220671.1|2393505_2394048_+	cell division protein ZapC	NA	NA	NA	NA	NA
WP_000224069.1|2394044_2395154_-	MOSC domain-containing protein	NA	NA	NA	NA	NA
WP_001086485.1|2395252_2397361_+	bifunctional 23S rRNA (guanine(2069)-N(7))-methyltransferase RlmK/23S rRNA (guanine(2445)-N(2))-methyltransferase RlmL	NA	NA	NA	NA	NA
WP_000053044.1|2397373_2399281_+	ABC transporter ATP-binding protein	NA	A0A2K9L3Z8	Tupanvirus	29.8	2.4e-53
WP_000333152.1|2399295_2400549_+	membrane integrity-associated transporter subunit PqiA	NA	NA	NA	NA	NA
WP_000433414.1|2400553_2402194_+	intermembrane transport protein PqiB	NA	NA	NA	NA	NA
WP_020843466.1|2402190_2402754_+	membrane integrity-associated transporter subunit PqiC	NA	NA	NA	NA	NA
WP_001537784.1|2403009_2403177_+	ribosome modulation factor	NA	NA	NA	NA	NA
WP_000227928.1|2403276_2403795_-	bifunctional 3-hydroxydecanoyl-ACP dehydratase/trans-2-decenoyl-ACP isomerase	NA	NA	NA	NA	NA
WP_000156453.1|2403863_2405624_-|protease	Lon protease family protein	protease	NA	NA	NA	NA
WP_000877172.1|2405809_2406262_+	macrodomain Ter protein MatP	NA	NA	NA	NA	NA
WP_001674965.1|2406333_2407386_-	porin OmpA	NA	NA	NA	NA	NA
WP_000288732.1|2407742_2408252_-	cell division inhibitor SulA	NA	NA	NA	NA	NA
WP_001202375.1|2408468_2409074_+	TfoX/Sxy family DNA transformation protein	NA	NA	NA	NA	NA
WP_000950880.1|2409060_2411214_-	TIGR01666 family membrane protein	NA	NA	NA	NA	NA
WP_001261222.1|2411232_2411679_-	YccF domain-containing protein	NA	NA	NA	NA	NA
WP_000420505.1|2411802_2413857_+	DNA helicase IV	NA	A7KV33	Bacillus_phage	27.6	8.5e-20
WP_000424187.1|2413892_2414351_-	methylglyoxal synthase	NA	NA	NA	NA	NA
WP_000847719.1|2414445_2415108_-	DUF2057 family protein	NA	NA	NA	NA	NA
WP_001537782.1|2415281_2415695_+	CoA-binding protein	NA	NA	NA	NA	NA
WP_000561983.1|2415739_2416057_-	heat shock protein HspQ	NA	NA	NA	NA	NA
WP_000140480.1|2416114_2417326_-	23S rRNA (cytosine(1962)-C(5))-methyltransferase RlmI	NA	NA	NA	NA	NA
WP_000859419.1|2417540_2418089_+	YbhB/YbcL family Raf kinase inhibitor-like protein	NA	NA	NA	NA	NA
WP_020843467.1|2418114_2418894_+	AraC family transcriptional regulator	NA	NA	NA	NA	NA
WP_000072884.1|2418942_2419224_+	acylphosphatase	NA	NA	NA	NA	NA
WP_000904446.1|2419220_2419550_-	sulfurtransferase TusE	NA	NA	NA	NA	NA
WP_000374050.1|2419636_2420296_-|protease	FtsH protease modulator YccA	protease	A0A2H4JFM9	uncultured_Caudovirales_phage	51.9	2.3e-43
WP_000938191.1|2420916_2421597_-|protease	type III secretion system effector protease PipA	protease	Q9MBM0	Phage_Gifsy-2	70.6	8.3e-81
>prophage 4
NC_021820	Salmonella enterica subsp. enterica serovar 4,[5],12:i:- str. 08-1736, complete sequence	4822189	3211518	3218327	4822189	integrase,tail	Salmonella_phage(33.33%)	11	3206381:3206403	3216096:3216118
3206381:3206403	attL	AAAAAGAGACCGAATACGATTCC	NA	NA	NA	NA
WP_000275418.1|3211518_3212400_-|tail	tail fiber assembly protein	tail	A0A0M4RTP2	Salmonella_phage	76.0	2.2e-65
WP_001521334.1|3212872_3213061_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000789530.1|3213125_3213293_+	lytic enzyme	NA	NA	NA	NA	NA
WP_001050882.1|3213549_3214083_-	DUF2514 domain-containing protein	NA	A0A291LBG9	Klebsiella_phage	48.3	1.4e-11
WP_001013467.1|3214136_3214367_-	hypothetical protein	NA	Q8HA86	Salmonella_phage	93.7	6.1e-28
WP_010989030.1|3214556_3215051_+	hypothetical protein	NA	A0A0U2I1R6	Escherichia_phage	68.9	8.2e-22
WP_001520095.1|3215110_3215965_+|integrase	tyrosine-type recombinase/integrase	integrase	A0A2H4IYC8	uncultured_Caudovirales_phage	50.9	3.6e-73
WP_000722368.1|3216338_3216692_-	YebY family protein	NA	NA	NA	NA	NA
3216096:3216118	attR	AAAAAGAGACCGAATACGATTCC	NA	NA	NA	NA
WP_000979702.1|3216708_3217584_-	copper homeostasis membrane protein CopD	NA	NA	NA	NA	NA
WP_000168393.1|3217584_3217959_-	CopC domain-containing protein YobA	NA	NA	NA	NA	NA
WP_000856224.1|3218096_3218327_+	DNA polymerase III subunit theta	NA	H9C187	Pectobacterium_phage	60.3	2.9e-14
>prophage 5
NC_021820	Salmonella enterica subsp. enterica serovar 4,[5],12:i:- str. 08-1736, complete sequence	4822189	3292666	3372010	4822189	transposase,protease,terminase,lysis,capsid,plate,portal,tail,head,holin,integrase	Salmonella_phage(86.36%)	102	3299204:3299219	3373633:3373648
WP_000502119.1|3292666_3293125_-|transposase	IS200/IS605-like element IS200F family transposase	transposase	I4AZI8	Saccharomonospora_phage	31.5	1.0e-13
WP_000659236.1|3293305_3294511_-	lysine-N-methylase	NA	NA	NA	NA	NA
WP_000079805.1|3294589_3296077_-	FliC/FljB family flagellin	NA	NA	NA	NA	NA
WP_000146802.1|3296333_3297737_+	flagellar filament capping protein FliD	NA	NA	NA	NA	NA
WP_000287764.1|3297751_3298159_+	flagellar export chaperone FliS	NA	NA	NA	NA	NA
WP_000204899.1|3298158_3298527_+	flagella biosynthesis regulatory protein FliT	NA	NA	NA	NA	NA
WP_000795487.1|3298598_3300083_+	alpha-amylase	NA	NA	NA	NA	NA
3299204:3299219	attL	TGAAAATATCGATTTT	NA	NA	NA	NA
WP_000754695.1|3300122_3300548_-	lipoprotein	NA	NA	NA	NA	NA
WP_001535233.1|3300733_3301939_+	selenium metabolism membrane protein YedE/FdhT	NA	NA	NA	NA	NA
WP_000790504.1|3301935_3302169_+	sulfurtransferase-like selenium metabolism protein YedF	NA	NA	NA	NA	NA
WP_000639596.1|3302433_3302820_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000719036.1|3302939_3303254_-	flagellar hook-basal body complex protein FliE	NA	NA	NA	NA	NA
WP_001276834.1|3303470_3305153_+	flagellar M-ring protein FliF	NA	NA	NA	NA	NA
WP_000067735.1|3305145_3306141_+	flagellar motor switch protein FliG	NA	NA	NA	NA	NA
WP_000064163.1|3306133_3306841_+	flagellar assembly protein FliH	NA	NA	NA	NA	NA
WP_000213257.1|3306840_3308211_+	flagellum-specific ATP synthase FliI	NA	NA	NA	NA	NA
WP_000046981.1|3308232_3308676_+	flagella biosynthesis chaperone FliJ	NA	NA	NA	NA	NA
WP_000631669.1|3308672_3309890_+	flagellar hook length control protein FliK	NA	NA	NA	NA	NA
WP_000132169.1|3309994_3310462_+	flagellar basal body-associated protein FliL	NA	NA	NA	NA	NA
WP_000502811.1|3310466_3311471_+	flagellar motor switch protein FliM	NA	NA	NA	NA	NA
WP_001282115.1|3311467_3311881_+	flagellar motor switch protein FliN	NA	NA	NA	NA	NA
WP_000978276.1|3311880_3312258_+	flagellar type III secretion system protein FliO	NA	NA	NA	NA	NA
WP_001253410.1|3312257_3312995_+	flagellar type III secretion system pore protein FliP	NA	NA	NA	NA	NA
WP_000187355.1|3313004_3313274_+	flagellar biosynthesis protein FliQ	NA	NA	NA	NA	NA
WP_000616953.1|3313282_3314077_+	flagellar type III secretion system protein FliR	NA	NA	NA	NA	NA
WP_000103974.1|3314358_3314982_+	transcriptional regulator RcsA	NA	NA	NA	NA	NA
WP_000867218.1|3315020_3315215_-	protein DsrB	NA	NA	NA	NA	NA
WP_000844798.1|3315343_3315571_+	YodD family peroxide/acid resistance protein	NA	NA	NA	NA	NA
WP_000948794.1|3315880_3316696_+	mannosyl-3-phosphoglycerate phosphatase-related protein	NA	NA	NA	NA	NA
WP_001119821.1|3316674_3318387_-	cellulose biosynthesis regulator YedQ	NA	A0A127AWB9	Bacillus_phage	37.4	1.2e-19
WP_000232161.1|3318551_3318737_-	YodC family protein	NA	NA	NA	NA	NA
WP_085983315.1|3318813_3319731_-	DUF808 domain-containing protein	NA	NA	NA	NA	NA
WP_001212264.1|3319900_3320821_+	drug/metabolite exporter YedA	NA	NA	NA	NA	NA
WP_000785978.1|3320809_3321280_-	very short patch repair endonuclease	NA	E5E3X5	Burkholderia_phage	46.9	1.2e-30
WP_001157322.1|3321260_3322691_-	DNA cytosine methyltransferase	NA	E5E3X6	Burkholderia_phage	57.4	1.0e-104
WP_000377041.1|3322764_3323460_-	phosphohydrolase	NA	A0A1D6Y7U0	Golden_Marseillevirus	27.1	2.8e-07
WP_000107430.1|3323551_3323851_-	membrane protein	NA	NA	NA	NA	NA
WP_001080680.1|3324500_3325697_+	porin OmpS1	NA	Q1MVN1	Enterobacteria_phage	56.1	1.8e-110
WP_024131109.1|3325957_3326146_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000208509.1|3326156_3326369_-	cold-shock protein	NA	A0A1W6JNX5	Morganella_phage	70.0	3.9e-21
WP_000457662.1|3326823_3328092_-	Y-family DNA polymerase	NA	I6RSM4	Salmonella_phage	92.2	4.2e-227
WP_000394196.1|3328094_3328514_-	translesion error-prone DNA polymerase V autoproteolytic subunit	NA	A0A1W6JNS2	Morganella_phage	60.5	8.5e-36
WP_000500831.1|3328640_3328802_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001526483.1|3329432_3329654_-	helix-turn-helix domain-containing protein	NA	Q8HAB1	Salmonella_phage	100.0	1.2e-36
WP_000492926.1|3329866_3330874_+	type III secretion system effector arginine glycosyltransferase	NA	Q8HAB2	Salmonella_phage	100.0	7.9e-197
WP_015701331.1|3331158_3331758_-|tail	tail fiber assembly protein	tail	Q8HAB3	Salmonella_phage	100.0	5.9e-107
WP_000554737.1|3331727_3333290_-	hypothetical protein	NA	Q8HAB4	Salmonella_phage	100.0	2.6e-287
WP_001207832.1|3333276_3333864_-	DUF2313 domain-containing protein	NA	A0A192Y5V3	Salmonella_phage	100.0	2.9e-114
WP_014343855.1|3333866_3334388_-|plate	baseplate J/gp47 family protein	plate	Q8HAB6	Salmonella_phage	100.0	2.9e-94
WP_014343856.1|3334422_3334968_-|plate	baseplate J/gp47 family protein	plate	Q8HAB7	Salmonella_phage	100.0	9.2e-99
WP_000605050.1|3334939_3335353_-	phage GP46 family protein	NA	Q8HAB8	Salmonella_phage	100.0	1.1e-75
WP_001273649.1|3335357_3335891_-|plate	phage baseplate assembly protein	plate	Q8HAB9	Salmonella_phage	100.0	1.4e-96
WP_001066635.1|3335890_3336949_-	hypothetical protein	NA	Q8HAC0	Salmonella_phage	99.7	6.6e-202
WP_000863818.1|3336945_3338286_-	DNA circularization N-terminal domain-containing protein	NA	A0A192Y5U9	Salmonella_phage	99.6	5.7e-251
WP_000785385.1|3338319_3340248_-|tail	phage tail tape measure protein	tail	Q8HAC2	Salmonella_phage	99.8	0.0e+00
WP_000588852.1|3340332_3340659_-|tail	phage tail assembly protein	tail	Q8HAC3	Salmonella_phage	99.1	2.3e-52
WP_000515952.1|3340655_3341012_-|tail	phage tail tube protein	tail	A0A192Y8K0	Salmonella_phage	100.0	2.6e-62
WP_001007991.1|3341011_3342508_-|tail	phage tail sheath subtilisin-like domain-containing protein	tail	Q8HAC5	Salmonella_phage	100.0	2.7e-278
WP_000497739.1|3342497_3342662_-	DUF2635 domain-containing protein	NA	Q8HAC6	Salmonella_phage	100.0	1.0e-24
WP_000779218.1|3342665_3343226_-	hypothetical protein	NA	Q8HAC7	Salmonella_phage	100.0	3.0e-105
WP_001135697.1|3343222_3343735_-	hypothetical protein	NA	Q8HAC8	Salmonella_phage	100.0	4.6e-92
WP_000702408.1|3343706_3344111_-|head	phage head closure protein	head	Q8HAC9	Salmonella_phage	100.0	1.4e-72
WP_000927378.1|3344107_3344431_-|head,tail	phage gp6-like head-tail connector protein	head,tail	A0A192Y8J4	Salmonella_phage	100.0	6.3e-55
WP_000601353.1|3344433_3344634_-	hypothetical protein	NA	Q8HAD1	Salmonella_phage	100.0	1.4e-28
WP_000257528.1|3344684_3345890_-|capsid	phage major capsid protein	capsid	Q8HAD2	Salmonella_phage	100.0	1.6e-223
WP_001193639.1|3345904_3346555_-|head,protease	HK97 family phage prohead protease	head,protease	Q8HAD3	Salmonella_phage	100.0	1.5e-119
WP_000466254.1|3346532_3347774_-|portal	phage portal protein	portal	Q8HAD4	Salmonella_phage	99.8	2.0e-242
WP_000605609.1|3347773_3347956_-	hypothetical protein	NA	Q8HAD5	Salmonella_phage	100.0	1.0e-25
WP_000088182.1|3347967_3349701_-|terminase	terminase large subunit	terminase	Q8HAD6	Salmonella_phage	100.0	0.0e+00
WP_000929191.1|3349697_3350192_-|terminase	phage terminase small subunit P27 family	terminase	Q8HAD7	Salmonella_phage	100.0	4.6e-89
WP_001135225.1|3350317_3350668_-	HNH endonuclease	NA	Q8HA82	Salmonella_phage	100.0	2.5e-65
WP_001292890.1|3350728_3351031_-	hypothetical protein	NA	Q8HA83	Salmonella_phage	100.0	3.6e-52
WP_000877027.1|3351250_3351670_-	KilA-N domain-containing protein	NA	Q8HA84	Salmonella_phage	100.0	4.8e-71
WP_001050825.1|3351882_3352368_-|lysis	lysis protein	lysis	Q8HA85	Salmonella_phage	100.0	5.9e-81
WP_001005901.1|3352364_3352979_-	glycoside hydrolase family 19 protein	NA	Q8HA86	Salmonella_phage	100.0	9.3e-116
WP_001527046.1|3352981_3353326_-|holin	phage holin, lambda family	holin	Q8HA87	Salmonella_phage	100.0	5.3e-44
WP_014343859.1|3353487_3353922_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001527054.1|3353851_3354109_-	hypothetical protein	NA	Q8HA88	Salmonella_phage	100.0	5.2e-44
WP_000188927.1|3354241_3354865_-	hypothetical protein	NA	Q8HA89	Salmonella_phage	100.0	9.1e-119
WP_001202278.1|3354875_3355865_-	DUF968 domain-containing protein	NA	A0A1C9IHZ5	Salmonella_phage	97.6	9.2e-190
WP_001061457.1|3355872_3356733_-	KilA-N domain-containing protein	NA	Q8HA92	Salmonella_phage	100.0	2.9e-163
WP_001241579.1|3356749_3357139_-	RusA family crossover junction endodeoxyribonuclease	NA	Q8HA93	Salmonella_phage	100.0	3.7e-70
WP_000066908.1|3357135_3358029_-	phage N-6-adenine-methyltransferase	NA	Q8HA94	Salmonella_phage	100.0	7.6e-175
WP_001684745.1|3358028_3358511_-	PerC family transcriptional regulator	NA	Q8HA95	Salmonella_phage	100.0	1.1e-87
WP_000061500.1|3358512_3359331_-	helix-turn-helix domain-containing protein	NA	Q8HA96	Salmonella_phage	100.0	2.8e-136
WP_000620702.1|3359327_3359552_-	hypothetical protein	NA	A0A1C9II64	Salmonella_phage	100.0	3.3e-39
WP_001087402.1|3359548_3360706_-	Rha family phage regulatory protein	NA	Q8HA97	Salmonella_phage	100.0	4.2e-218
WP_000509731.1|3360702_3361257_-	hypothetical protein	NA	A0A1C9II13	Salmonella_phage	100.0	6.9e-102
WP_001191666.1|3361285_3361510_-	helix-turn-helix transcriptional regulator	NA	A0A1C9IHV8	Salmonella_phage	100.0	1.9e-34
WP_001020636.1|3361607_3362303_+	helix-turn-helix transcriptional regulator	NA	Q8HAA0	Salmonella_phage	100.0	3.2e-128
WP_000997190.1|3363117_3363489_+	hypothetical protein	NA	Q8HAA1	Salmonella_phage	100.0	1.1e-63
WP_000080415.1|3363546_3364374_+	DUF2303 family protein	NA	Q8HAA2	Salmonella_phage	100.0	7.5e-153
WP_000008351.1|3364510_3365050_+	hypothetical protein	NA	A0A192Y8M4	Salmonella_phage	100.0	2.6e-98
WP_000764235.1|3365120_3365351_+	hypothetical protein	NA	Q8HAA4	Salmonella_phage	100.0	2.0e-34
WP_000071070.1|3365347_3365863_+	DUF262 domain-containing protein	NA	Q8HAA5	Salmonella_phage	100.0	7.4e-98
WP_000065095.1|3365859_3366477_+	ead/Ea22-like family protein	NA	Q8HAA6	Salmonella_phage	100.0	2.6e-113
WP_000208068.1|3366473_3367307_+	hypothetical protein	NA	Q8HAA7	Salmonella_phage	100.0	4.7e-163
WP_001061334.1|3367310_3367880_+	3'-5' exoribonuclease	NA	A0A192Y6E0	Salmonella_phage	100.0	7.1e-110
WP_001527041.1|3367919_3368147_+	DUF4224 domain-containing protein	NA	Q8HAA9	Salmonella_phage	100.0	3.2e-37
WP_000532847.1|3368148_3369138_+|integrase	tyrosine-type recombinase/integrase	integrase	A0A192Y7M7	Salmonella_phage	100.0	8.6e-196
WP_000598920.1|3369429_3370227_+	DgsA anti-repressor MtfA	NA	NA	NA	NA	NA
WP_001219015.1|3371536_3372010_+	peptidase	NA	A0A0F6TJ61	Escherichia_coli_O157_typing_phage	77.6	7.1e-39
3373633:3373648	attR	TGAAAATATCGATTTT	NA	NA	NA	NA
>prophage 6
NC_021820	Salmonella enterica subsp. enterica serovar 4,[5],12:i:- str. 08-1736, complete sequence	4822189	3458004	3468510	4822189		Enterobacteria_phage(37.5%)	10	NA	NA
WP_000126349.1|3458004_3459318_-	lipopolysaccharide biosynthesis protein RfbH	NA	H8ZJ36	Ostreococcus_tauri_virus	35.1	7.0e-52
WP_000565905.1|3459344_3460424_-	CDP-glucose 4,6-dehydratase	NA	A0A222YY99	Synechococcus_phage	24.1	6.6e-16
WP_000648784.1|3460428_3461202_-	glucose-1-phosphate cytidylyltransferase	NA	NA	NA	NA	NA
WP_000018226.1|3461198_3462191_-	CDP-6-deoxy-delta-3,4-glucoseen reductase	NA	NA	NA	NA	NA
WP_000973708.1|3462196_3462748_-	dTDP-4-dehydrorhamnose 3,5-epimerase	NA	I7HJC4	Enterobacteria_phage	58.0	2.2e-52
WP_000857529.1|3462748_3463627_-	glucose-1-phosphate thymidylyltransferase RfbA	NA	I7I009	Enterobacteria_phage	65.5	9.3e-109
WP_001023662.1|3463674_3464574_-	dTDP-4-dehydrorhamnose reductase	NA	A0A291LA50	Escherichia_phage	36.3	1.4e-30
WP_000697840.1|3464573_3465659_-	dTDP-glucose 4,6-dehydratase	NA	I7HTA3	Enterobacteria_phage	53.9	1.2e-102
WP_000981469.1|3466035_3466929_-	GalU regulator GalF	NA	A0A127AW70	Bacillus_phage	42.2	4.8e-44
WP_001111841.1|3467106_3468510_-	colanic acid biosynthesis protein WcaM	NA	A0A291LBB9	Klebsiella_phage	27.1	3.1e-21
>prophage 7
NC_021820	Salmonella enterica subsp. enterica serovar 4,[5],12:i:- str. 08-1736, complete sequence	4822189	3536817	3545988	4822189	tRNA	Enterobacteria_phage(66.67%)	10	NA	NA
WP_000195332.1|3536817_3538851_+|tRNA	methionine--tRNA ligase	tRNA	A0A1V0SDF2	Indivirus	27.6	1.0e-54
WP_000703137.1|3539091_3539550_+	YehR family lipoprotein	NA	Q9EYF5	Enterobacteria_phage	72.5	8.4e-53
WP_001197952.1|3539721_3540252_+	YehR family lipoprotein	NA	NA	NA	NA	NA
WP_000950413.1|3540308_3540776_-	DUF1456 family protein	NA	Q9EYF4	Enterobacteria_phage	90.3	3.9e-74
WP_000598637.1|3540822_3541542_-	two-component system response regulator BtsR	NA	NA	NA	NA	NA
WP_000272845.1|3541538_3543224_-	sensor histidine kinase	NA	Q9EYF3	Enterobacteria_phage	91.1	6.2e-279
WP_001240418.1|3543446_3544178_+	HTH-type transcriptional regulator MlrA	NA	Q9EYF2	Enterobacteria_phage	87.9	4.5e-101
WP_001261696.1|3544237_3544345_+	protein YohO	NA	NA	NA	NA	NA
WP_000824855.1|3544325_3545057_-	ABC transporter permease	NA	NA	NA	NA	NA
WP_000569166.1|3545040_3545988_-	ABC transporter ATP-binding protein	NA	G3M9Y6	Bacillus_virus	31.2	1.7e-23
>prophage 8
NC_021820	Salmonella enterica subsp. enterica serovar 4,[5],12:i:- str. 08-1736, complete sequence	4822189	3565395	3631790	4822189	lysis,holin,tail	Salmonella_phage(28.57%)	60	NA	NA
WP_000989296.1|3565395_3566091_+|lysis	CidB/LrgB family autolysis modulator	lysis	NA	NA	NA	NA
WP_000553526.1|3566244_3567129_+	cytidine deaminase	NA	NA	NA	NA	NA
WP_000920081.1|3567305_3568025_+	outer membrane permeability protein SanA	NA	NA	NA	NA	NA
WP_000605187.1|3568021_3568267_+	DUF2542 family protein	NA	NA	NA	NA	NA
WP_001136409.1|3568471_3569713_+	NAD(P)-dependent oxidoreductase	NA	NA	NA	NA	NA
WP_000956095.1|3569706_3570942_+	NAD-dependent dihydropyrimidine dehydrogenase subunit PreA	NA	NA	NA	NA	NA
WP_001275101.1|3571016_3572027_-	galactose/methyl galactoside ABC transporter permease MglC	NA	NA	NA	NA	NA
WP_000535907.1|3572042_3573563_-	galactose/methyl galactoside ABC transporter ATP-binding protein MglA	NA	F2Y2R6	Organic_Lake_phycodnavirus	31.9	1.0e-09
WP_001036943.1|3573696_3574695_-	galactose/glucose ABC transporter substrate-binding protein MglB	NA	NA	NA	NA	NA
WP_000628631.1|3575193_3576216_-	HTH-type transcriptional regulator GalS	NA	NA	NA	NA	NA
WP_001526153.1|3576365_3577508_-	DUF418 family protein	NA	NA	NA	NA	NA
WP_001139611.1|3577522_3578191_-	GTP cyclohydrolase I FolE	NA	M1Q6X8	Cellulophaga_phage	56.3	4.1e-56
WP_000425488.1|3578520_3579378_+	S-formylglutathione hydrolase	NA	NA	NA	NA	NA
WP_000876817.1|3579366_3579756_-	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_000443208.1|3579760_3581128_-	L-serine ammonia-lyase	NA	NA	NA	NA	NA
WP_000022915.1|3581344_3582232_+	phosphoserine phosphatase SerB	NA	NA	NA	NA	NA
WP_000023807.1|3582264_3583587_+	MFS transporter	NA	NA	NA	NA	NA
WP_000488255.1|3583630_3585622_-	catecholate siderophore receptor CirA	NA	A0A0P0I887	Acinetobacter_phage	37.9	6.7e-14
WP_000535000.1|3585966_3587436_-	lysine-specific permease	NA	NA	NA	NA	NA
WP_000548308.1|3587625_3588489_-	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_000137961.1|3588609_3589659_+	YeiH family protein	NA	NA	NA	NA	NA
WP_000873909.1|3589737_3590595_+	deoxyribonuclease IV	NA	A0A1V0SBL9	Catovirus	28.5	2.2e-22
WP_000854414.1|3590659_3592348_-	PTS fructose transporter subunit IIBC	NA	NA	NA	NA	NA
WP_000091249.1|3592364_3593303_-	1-phosphofructokinase	NA	NA	NA	NA	NA
WP_000487287.1|3593302_3594433_-	fused PTS fructose transporter subunit IIA/HPr protein	NA	NA	NA	NA	NA
WP_000551937.1|3594801_3595983_+	sugar efflux transporter SetB	NA	NA	NA	NA	NA
WP_001213882.1|3596047_3596713_-	membrane protein	NA	NA	NA	NA	NA
WP_001519564.1|3596714_3596837_-	membrane protein	NA	NA	NA	NA	NA
WP_010989043.1|3597224_3597479_-	YkgJ family cysteine cluster protein	NA	NA	NA	NA	NA
WP_001136822.1|3597802_3598375_+	elongation factor P-like protein YeiP	NA	NA	NA	NA	NA
WP_000169350.1|3598587_3599574_+	GTP-binding protein	NA	NA	NA	NA	NA
WP_000178095.1|3599603_3600323_+	phosphatase PAP2 family protein	NA	NA	NA	NA	NA
WP_000241015.1|3600736_3601309_+	bifunctional murein DD-endopeptidase/murein LD-carboxypeptidase	NA	A0A1V0DZX6	Clostridioides_phage	38.9	8.1e-13
WP_000957746.1|3601634_3603191_+	cyclic di-GMP phosphodiesterase	NA	NA	NA	NA	NA
WP_000561748.1|3603297_3605103_+	ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_000501623.1|3605112_3606207_+	microcin C ABC transporter permease YejB	NA	NA	NA	NA	NA
WP_001137764.1|3606206_3607232_+	ABC transporter permease	NA	NA	NA	NA	NA
WP_000203622.1|3607233_3608823_+	microcin C ABC transporter ATP-binding protein YejF	NA	G9BWD6	Planktothrix_phage	32.5	8.5e-20
WP_001094639.1|3608826_3609171_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000213347.1|3609561_3610752_-	Bcr/CflA family multidrug efflux MFS transporter	NA	S4TR35	Salmonella_phage	22.2	2.4e-19
WP_001234836.1|3610779_3611475_-	16S rRNA pseudouridine(516) synthase RsuA	NA	NA	NA	NA	NA
WP_000578121.1|3611626_3613387_+	DEAD/DEAH box helicase	NA	M4Q3N1	Vibrio_phage	41.6	1.9e-100
WP_000494192.1|3613511_3613796_+	50S ribosomal protein L25	NA	NA	NA	NA	NA
WP_000033440.1|3613904_3614525_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000050806.1|3614552_3615560_-	nucleoid-associated protein YejK	NA	A0A1V0E8C0	Vibrio_phage	48.3	4.5e-83
WP_001135904.1|3615739_3615967_+	YejL family protein	NA	NA	NA	NA	NA
WP_000256150.1|3615998_3617759_+	cardiolipin transport protein PbgA	NA	NA	NA	NA	NA
WP_000806401.1|3618039_3618543_-	LexA family transcriptional regulator	NA	Q1MVE7	Enterobacteria_phage	71.3	9.5e-50
WP_020843597.1|3618570_3618861_+	DinI family protein	NA	S4TND2	Salmonella_phage	83.3	4.7e-25
WP_000639473.1|3619208_3621038_+	acyltransferase	NA	C6ZR20	Salmonella_phage	29.6	3.0e-61
WP_000022213.1|3621091_3621535_-|tail	tail fiber assembly protein	tail	A0A0F7LDZ0	Escherichia_phage	43.9	1.4e-28
WP_001215679.1|3621912_3622440_-|tail	tail fiber assembly protein	tail	A0A1S6KZZ1	Salmonella_phage	31.3	3.1e-11
WP_000554739.1|3622442_3623684_-	hypothetical protein	NA	Q8HAB4	Salmonella_phage	95.3	1.0e-52
WP_001120499.1|3624276_3624606_-|holin	phage holin, lambda family	holin	Q8SBE1	Shigella_phage	94.6	3.9e-36
WP_001526364.1|3624902_3626234_+	AAA family ATPase	NA	R9TRQ8	Vibrio_phage	28.5	2.1e-19
WP_010989045.1|3626262_3626631_-	antitermination protein Q	NA	A5LH77	Enterobacteria_phage	81.7	7.4e-52
WP_014344510.1|3626645_3627635_-	DUF968 domain-containing protein	NA	A0A1C9IHZ5	Salmonella_phage	97.3	2.4e-190
WP_001115840.1|3627963_3630330_-	SPI-2 type III secretion system effector E3 ubiquitin transferase SspH2	NA	Q9MBL9	Phage_Gifsy-2	88.7	2.9e-72
WP_001113462.1|3630498_3630702_-|tail	tail protein	tail	NA	NA	NA	NA
WP_000624225.1|3630998_3631790_-|tail	tail fiber protein	tail	Q1MVL8	Enterobacteria_phage	31.6	1.7e-48
>prophage 9
NC_021820	Salmonella enterica subsp. enterica serovar 4,[5],12:i:- str. 08-1736, complete sequence	4822189	3970673	4077843	4822189	transposase,protease,terminase,lysis,capsid,portal,tail,head,holin,integrase,tRNA	Salmonella_phage(40.62%)	111	3995218:3995234	4085747:4085763
WP_000940032.1|3970673_3971405_-|tRNA	tRNA (cytosine(32)/uridine(32)-2'-O)-methyltransferase TrmJ	tRNA	NA	NA	NA	NA
WP_000553467.1|3971523_3972327_+	inositol-1-monophosphatase	NA	NA	NA	NA	NA
WP_000174944.1|3972471_3973350_+	alpha/beta hydrolase	NA	A0A1C9C5K3	Heterosigma_akashiwo_virus	24.7	3.5e-15
WP_000985204.1|3973531_3974575_+	anaerobic sulfite reductase subunit A	NA	NA	NA	NA	NA
WP_000017587.1|3974578_3975397_+	anaerobic sulfite reductase subunit B	NA	NA	NA	NA	NA
WP_000020685.1|3975407_3976421_+	sulfite reductase subunit C	NA	NA	NA	NA	NA
WP_000111027.1|3976421_3977408_-	nickel/cobalt transporter	NA	NA	NA	NA	NA
WP_000805728.1|3977398_3978037_-	DUF1007 family protein	NA	NA	NA	NA	NA
WP_000982961.1|3978162_3979440_+	stationary phase inducible protein CsiE	NA	NA	NA	NA	NA
WP_001173729.1|3979434_3980574_-	3-phenylpropionate MFS transporter	NA	NA	NA	NA	NA
WP_000919178.1|3980769_3982023_-	serine hydroxymethyltransferase	NA	A0A240F3L3	Aeromonas_phage	53.0	1.3e-100
WP_000883146.1|3982347_3983538_+	NO-inducible flavohemoprotein	NA	NA	NA	NA	NA
WP_001187150.1|3983719_3985264_+	lysine decarboxylation/transport transcriptional activator CadC	NA	NA	NA	NA	NA
WP_000100008.1|3985624_3986956_+	cadaverine/lysine antiporter	NA	NA	NA	NA	NA
WP_001100652.1|3987038_3989183_+	lysine decarboxylase CadA	NA	NA	NA	NA	NA
WP_000856793.1|3989238_3990699_+	dipeptide permease DtpD	NA	A0A0P0IY73	Acinetobacter_phage	28.8	1.7e-46
WP_000717694.1|3990747_3991086_-	nitrogen regulatory protein P-II	NA	NA	NA	NA	NA
WP_000625591.1|3991162_3992500_-	two-component system response regulator GlrR	NA	W8CYM9	Bacillus_phage	29.2	1.8e-10
WP_001054236.1|3992496_3993261_-	two-component system QseEF-associated lipoprotein QseG	NA	NA	NA	NA	NA
WP_001670672.1|3993262_3994693_-	two component system sensor histidine kinase QseE/GlrK	NA	W8CYF6	Bacillus_phage	26.1	2.0e-15
3995218:3995234	attL	CGCCTTATCCGGCCTAC	NA	NA	NA	NA
WP_000970045.1|3995342_3999230_-	phosphoribosylformylglycinamidine synthase	NA	A9YX36	Burkholderia_phage	57.6	1.4e-127
WP_001747289.1|3999251_3999485_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000734248.1|3999485_4001030_+	membrane-bound lytic murein transglycosylase MltF	NA	NA	NA	NA	NA
WP_001134566.1|4001080_4001632_-|tRNA	tRNA adenosine(34) deaminase TadA	tRNA	NA	NA	NA	NA
WP_000253558.1|4001656_4002292_-	phosphatidylglycerophosphatase C	NA	NA	NA	NA	NA
WP_000361663.1|4002295_4003657_-	PTS transporter subunit EIIC	NA	NA	NA	NA	NA
WP_001048530.1|4003667_4004561_-	N-acetylmuramic acid 6-phosphate etherase	NA	NA	NA	NA	NA
WP_000995703.1|4004676_4005525_+	MurR/RpiR family transcriptional regulator	NA	NA	NA	NA	NA
WP_000684022.1|4005563_4006481_-	oxidoreductase	NA	NA	NA	NA	NA
WP_001276370.1|4006502_4007699_-	OFA family MFS transporter	NA	NA	NA	NA	NA
WP_001022463.1|4007814_4008741_+	LysR family transcriptional regulator	NA	A0A2P0ZL89	Lactobacillus_phage	24.4	3.0e-09
WP_001196290.1|4008778_4009039_+	YfhL family 4Fe-4S dicluster ferredoxin	NA	A0A1B1IWY9	uncultured_Mediterranean_phage	52.3	1.4e-17
WP_000986043.1|4009150_4009531_-	holo-ACP synthase	NA	NA	NA	NA	NA
WP_000818972.1|4009530_4010262_-	pyridoxine 5'-phosphate synthase	NA	NA	NA	NA	NA
WP_000399380.1|4010273_4011002_-	DNA repair protein RecO	NA	NA	NA	NA	NA
WP_000102232.1|4011013_4011919_-	GTPase Era	NA	NA	NA	NA	NA
WP_001068341.1|4011915_4012596_-	ribonuclease III	NA	A0A2K9L5P0	Tupanvirus	31.8	7.4e-21
WP_000002559.1|4012869_4013844_-	signal peptidase I	NA	NA	NA	NA	NA
WP_000790154.1|4013860_4015660_-	elongation factor 4	NA	E4ZFJ7	Streptococcus_phage	24.9	7.2e-23
WP_010989047.1|4016064_4017558_+	type III secretion effector GogB	NA	Q9MBM1	Phage_Gifsy-1	100.0	3.4e-260
WP_001542312.1|4018012_4018150_+	hypothetical protein	NA	NA	NA	NA	NA
WP_015589559.1|4018862_4019027_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_001738443.1|4019734_4019947_-	helix-turn-helix domain-containing protein	NA	S4TTF2	Salmonella_phage	90.6	3.8e-08
WP_010989049.1|4020053_4020281_+	PagK-like protein	NA	NA	NA	NA	NA
WP_000143154.1|4020377_4020956_-|tail	tail fiber assembly protein	tail	A0A0M4RTP2	Salmonella_phage	88.9	3.6e-93
WP_000593433.1|4020945_4021770_-	macro domain-containing protein	NA	A0A0M4QWS3	Salmonella_phage	92.0	1.2e-145
WP_001144691.1|4021766_4024139_-|tail	prophage tail fiber N-terminal domain-containing protein	tail	A0A0K2FIZ6	Escherichia_phage	65.6	1.1e-90
WP_000178853.1|4024192_4024435_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001526393.1|4024473_4027836_-	host specificity protein J	NA	K7PKJ2	Enterobacteria_phage	79.6	0.0e+00
WP_000246126.1|4027897_4028545_-|tail	tail assembly protein	tail	A5LH42	Enterobacteria_phage	77.7	2.1e-89
WP_000662739.1|4028442_4029180_-|tail	phage tail protein	tail	K7PLW1	Enterobacteria_phage	85.0	5.2e-129
WP_001152689.1|4029186_4029885_-|tail	phage minor tail protein L	tail	A0A1B5FP81	Escherichia_phage	76.3	5.5e-104
WP_000447369.1|4029894_4030224_-|tail	phage tail protein	tail	A5LH39	Enterobacteria_phage	70.4	1.3e-42
WP_000372072.1|4030226_4033322_-|tail	phage tail tape measure protein	tail	A0A291AWX1	Escherichia_phage	62.3	6.1e-280
WP_010989052.1|4033293_4033632_-|tail	phage tail assembly protein T	tail	A5LH37	Enterobacteria_phage	62.4	1.3e-31
WP_000479607.1|4033628_4034024_-|tail	phage minor tail protein G	tail	A5LH36	Enterobacteria_phage	56.5	2.3e-30
WP_000971954.1|4034074_4034821_-	Ig-like domain-containing protein	NA	A0A291AWU6	Escherichia_phage	76.9	1.9e-99
WP_000033885.1|4034828_4035230_-|tail	tail protein	tail	Q9G0F3	Phage_Gifsy-1	100.0	8.1e-52
WP_000817263.1|4035338_4036469_+|transposase	IS200/IS605 family element transposase accessory protein TnpB	transposase	Q9G0F2	Phage_Gifsy-1	100.0	9.2e-218
WP_000677089.1|4036517_4037096_-|tail	phage tail protein	tail	A5LH33	Enterobacteria_phage	80.2	3.7e-82
WP_000083294.1|4037123_4037507_-|head,tail	head-tail joining protein	head,tail	A0A0K2FJB7	Enterobacteria_phage	55.6	9.2e-29
WP_000201486.1|4037517_4037877_-	DNA-packaging protein FI	NA	NA	NA	NA	NA
WP_000522566.1|4037934_4038963_-|capsid	major capsid protein	capsid	C6ZCY2	Enterobacteria_phage	61.1	1.7e-114
WP_000011260.1|4039017_4039365_-|head	head decoration protein	head	A0A2R9YJN3	Escherichia_phage	52.7	9.2e-20
WP_001189503.1|4039377_4040874_-	S49 family peptidase	NA	A0A0K2FI53	Enterobacteria_phage	52.2	8.1e-97
WP_000831821.1|4040863_4042444_-|portal	phage portal protein	portal	K7P6U7	Enterobacteria_phage	62.8	9.6e-189
WP_000201415.1|4042440_4042644_-	gpW family protein	NA	K7PM10	Enterobacteria_phage	73.8	1.9e-17
WP_000623091.1|4042627_4044559_-|terminase	phage terminase large subunit family protein	terminase	A0A0K2FJ14	Enterobacteria_phage	65.7	6.3e-259
WP_001102153.1|4044530_4045076_-|terminase	terminase small subunit	terminase	A0A0U2S671	Escherichia_phage	80.6	1.5e-56
WP_000669690.1|4045362_4045764_+	pre-peptidase C-terminal domain-containing protein	NA	NA	NA	NA	NA
WP_001533543.1|4045999_4046452_-|lysis	lysis protein	lysis	A0A0M4RD57	Salmonella_phage	92.7	2.9e-66
WP_000984581.1|4046469_4046922_-	lysozyme	NA	A0A0M4R365	Salmonella_phage	97.3	5.1e-79
WP_001574216.1|4046905_4047235_-|holin	phage holin, lambda family	holin	A0A0M3ULK9	Salmonella_phage	100.0	5.8e-56
WP_001110783.1|4047510_4048197_+|protease	type III secretion system effector protease GogA	protease	Q9MBM2	Phage_Gifsy-1	100.0	9.4e-133
WP_000657897.1|4048411_4048600_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000211410.1|4049106_4049670_-	ORF6N domain-containing protein	NA	A0A0P0ZC44	Stx2-converting_phage	92.2	7.6e-56
WP_001097241.1|4049942_4050620_-	antitermination protein	NA	I6PDF8	Cronobacter_phage	54.0	7.7e-63
WP_000801757.1|4050616_4050757_-	YlcG family protein	NA	A0A0M5M7B2	Salmonella_phage	78.9	7.2e-08
WP_001096550.1|4050753_4051365_-	recombination protein NinG	NA	A0A0M4RU10	Salmonella_phage	99.0	1.2e-91
WP_000929791.1|4051573_4052176_-	DUF1367 family protein	NA	S4TTI0	Salmonella_phage	99.0	2.8e-109
WP_014343878.1|4052210_4052459_-	hypothetical protein	NA	A0A0U2C0C8	Salmonella_phage	100.0	1.6e-42
WP_001217669.1|4052575_4052809_-	DinI family protein	NA	H6WRY5	Salmonella_phage	100.0	5.6e-37
WP_000704096.1|4053078_4054071_+	peptidase M85	NA	NA	NA	NA	NA
WP_000065102.1|4054097_4054616_-	ead/Ea22-like family protein	NA	S4TNP2	Salmonella_phage	89.8	1.4e-40
WP_000113618.1|4054612_4054960_-	DUF977 family protein	NA	H6WRX9	Salmonella_phage	96.5	2.7e-56
WP_000800012.1|4054970_4055720_-	ATP-binding protein	NA	S4TNF5	Salmonella_phage	100.0	4.3e-139
WP_001527034.1|4055722_4056811_-	replication protein	NA	H6WRX7	Salmonella_phage	88.5	1.4e-154
WP_010835408.1|4056895_4057270_-	hypothetical protein	NA	S4TTD7	Salmonella_phage	98.4	1.9e-63
WP_001274939.1|4057229_4057472_-	helix-turn-helix domain-containing protein	NA	A0A0M4QX15	Salmonella_phage	67.9	5.6e-24
WP_014344514.1|4057544_4057958_+	helix-turn-helix domain-containing protein	NA	A0A0M4R5D1	Salmonella_phage	78.0	1.5e-45
WP_000106861.1|4058100_4059210_+	AAA family ATPase	NA	E7C9Q8	Salmonella_phage	58.4	1.6e-118
WP_000917561.1|4059690_4059849_+	hypothetical protein	NA	H6WRX3	Salmonella_phage	96.2	2.6e-22
WP_014344515.1|4059870_4060221_+	hypothetical protein	NA	S4TSN6	Salmonella_phage	94.0	2.7e-59
WP_000017130.1|4060347_4063275_+	PD-(D/E)XK nuclease-like domain-containing protein	NA	H6WRX1	Salmonella_phage	95.7	0.0e+00
WP_077905217.1|4063237_4064395_+	recombinase RecT	NA	S4TTE8	Salmonella_phage	99.5	1.8e-216
WP_001237032.1|4064437_4064677_+	DUF4060 family protein	NA	H6WRW9	Salmonella_phage	97.5	2.2e-36
WP_014344516.1|4064717_4065002_+	excisionase Xis	NA	H6WRW8	Salmonella_phage	87.2	1.1e-42
WP_001007935.1|4064979_4066209_-|integrase	site-specific integrase	integrase	H6WRW7	Salmonella_phage	94.1	6.4e-233
WP_000589087.1|4066706_4067186_-	SoxR-reducing system protein RseC	NA	NA	NA	NA	NA
WP_000812017.1|4067182_4068139_-	sigma-E factor regulatory protein RseB	NA	NA	NA	NA	NA
WP_001168374.1|4068138_4068789_-	anti-sigma-E factor RseA	NA	NA	NA	NA	NA
WP_000003307.1|4068820_4069396_-	RNA polymerase sigma factor RpoE	NA	NA	NA	NA	NA
WP_014344135.1|4069392_4069557_-	rpoE leader peptide RseD	NA	NA	NA	NA	NA
WP_000989177.1|4069820_4071443_+	L-aspartate oxidase	NA	NA	NA	NA	NA
WP_000083343.1|4071427_4072165_-|tRNA	tRNA(1)(Val) (adenine(37)-N(6))-methyltransferase TrmN	tRNA	NA	NA	NA	NA
WP_000219174.1|4072295_4073630_+	ATP-dependent RNA helicase SrmB	NA	A0A1B1IS59	uncultured_Mediterranean_phage	29.7	1.6e-43
WP_001526875.1|4073647_4074547_-	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_000188414.1|4074649_4075237_+	cysteine/O-acetylserine transporter	NA	NA	NA	NA	NA
WP_000627811.1|4075298_4075682_-	autonomous glycyl radical cofactor GrcA	NA	Q7Y524	Enterobacteria_phage	74.0	6.1e-33
WP_000179978.1|4076000_4076690_+	uracil-DNA glycosylase	NA	A0A172DS90	Canid_alphaherpesvirus	49.5	4.6e-55
WP_000997368.1|4076805_4077843_-|tRNA	tRNA/rRNA methyltransferase	tRNA	NA	NA	NA	NA
4085747:4085763	attR	GTAGGCCGGATAAGGCG	NA	NA	NA	NA
>prophage 10
NC_021820	Salmonella enterica subsp. enterica serovar 4,[5],12:i:- str. 08-1736, complete sequence	4822189	4100951	4135621	4822189	terminase,lysis,capsid,plate,portal,tail,head,holin,integrase	Salmonella_phage(44.44%)	49	4099380:4099393	4108517:4108530
4099380:4099393	attL	CATCAGCAACGCGC	NA	NA	NA	NA
WP_001168062.1|4100951_4102022_-	3-deoxy-7-phosphoheptulonate synthase AroF	NA	A0A0F6R6T6	Escherichia_coli_O157_typing_phage	51.8	2.4e-90
WP_001212379.1|4102461_4102980_+	YfiR family protein	NA	NA	NA	NA	NA
WP_001030985.1|4102972_4104193_+	diguanylate cyclase DgcN	NA	A0A2K8I9Y5	Pseudomonas_phage	36.2	5.8e-08
WP_020843688.1|4104445_4105495_-|integrase	site-specific integrase	integrase	A0A0M4S6G4	Salmonella_phage	91.7	1.5e-190
WP_020843689.1|4105518_4105857_-	DUF2511 domain-containing protein	NA	NA	NA	NA	NA
WP_020843690.1|4105866_4106712_-	phage repressor protein CI	NA	Q6K1G0	Salmonella_virus	73.0	1.4e-114
WP_001278192.1|4106825_4107179_+	hypothetical protein	NA	Q6K1F9	Salmonella_virus	100.0	2.3e-58
WP_001550177.1|4107229_4107739_+	phage regulatory CII family protein	NA	Q6K1F8	Salmonella_virus	99.4	5.6e-90
WP_020843693.1|4107746_4107974_+	DUF2724 domain-containing protein	NA	A0A0M4RTI3	Salmonella_phage	90.7	1.2e-33
WP_001550179.1|4107960_4108161_+	hypothetical protein	NA	A0A0M5M7U3	Salmonella_phage	92.4	3.7e-29
WP_020843697.1|4108227_4108461_+	DUF2732 domain-containing protein	NA	Q6K1F6	Salmonella_virus	77.9	1.1e-24
WP_020843699.1|4108460_4108682_+	TraR/DksA family transcriptional regulator	NA	A0A0M4S5Q7	Salmonella_phage	95.9	4.6e-33
4108517:4108530	attR	CATCAGCAACGCGC	NA	NA	NA	NA
WP_001550182.1|4108682_4109072_+	hypothetical protein	NA	NA	NA	NA	NA
WP_020843701.1|4109068_4109341_+	DUF5405 family protein	NA	A0A218M4I8	Erwinia_phage	76.7	6.7e-34
WP_020843702.1|4109337_4109619_+	DUF3850 domain-containing protein	NA	A0A0P0I3U9	Klebsiella_phage	52.6	2.0e-12
WP_020843704.1|4109609_4111844_+	replication endonuclease	NA	A0A218M4H2	Erwinia_phage	92.3	0.0e+00
WP_000232650.1|4111957_4112140_+	hypothetical protein	NA	A0A0M5M1G5	Salmonella_phage	100.0	4.1e-27
WP_001222154.1|4112143_4112377_+	DinI family protein	NA	A0A0M4S6H1	Salmonella_phage	98.7	8.0e-36
WP_153260300.1|4112581_4112755_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001161211.1|4112855_4113797_-	hypothetical protein	NA	Q2P9W7	Enterobacteria_phage	90.4	2.2e-164
WP_000718722.1|4114009_4114210_-	hypothetical protein	NA	A0A0M5M1G4	Salmonella_phage	78.1	7.4e-06
WP_000044287.1|4114230_4115253_-|portal	phage portal protein	portal	Q6K1J0	Salmonella_virus	99.1	1.2e-197
WP_001526236.1|4115249_4115996_-	hypothetical protein	NA	Q6K1I9	Salmonella_virus	96.4	3.3e-139
WP_001526238.1|4115992_4117765_-|terminase	terminase ATPase subunit family protein	terminase	S4TT96	Salmonella_phage	99.7	0.0e+00
WP_020843719.1|4117930_4118785_+|capsid	capsid scaffolding protein	capsid	A0A0M3UL81	Salmonella_phage	99.6	2.2e-147
WP_001247243.1|4118861_4119929_+|capsid	phage major capsid protein, P2 family	capsid	A0A0M4R4W2	Salmonella_phage	99.7	1.2e-198
WP_001526222.1|4119932_4120682_+|terminase	terminase endonuclease subunit	terminase	Q6K1I5	Salmonella_virus	96.0	2.1e-125
WP_001526229.1|4120775_4121282_+|head	head completion/stabilization protein	head	S4TNY1	Salmonella_phage	97.0	8.0e-89
WP_001526249.1|4121281_4121485_+|tail	tail protein X	tail	A0A0M3ULF4	Salmonella_phage	97.0	4.0e-31
WP_001526257.1|4121488_4121785_+|holin	phage holin family protein	holin	O80308	Escherichia_phage	96.9	2.4e-45
WP_001526232.1|4121771_4122269_+	glycoside hydrolase family 104 protein	NA	S4TUB1	Salmonella_phage	98.2	7.6e-92
WP_001526264.1|4122265_4122679_+|lysis	LysB family phage lysis regulatory protein	lysis	S4TRW3	Salmonella_phage	97.8	6.4e-44
WP_001384078.1|4122650_4122824_+	hypothetical protein	NA	O80311	Escherichia_phage	98.2	6.2e-25
WP_001526262.1|4122786_4123254_+|tail	phage tail protein	tail	A0A218M4K6	Erwinia_phage	98.1	1.0e-82
WP_001526242.1|4123246_4123696_+	phage virion morphogenesis protein	NA	O80313	Escherichia_phage	95.3	4.3e-70
WP_001526223.1|4123764_4124406_+|plate	phage baseplate assembly protein V	plate	Q6K1H6	Salmonella_virus	96.2	2.5e-111
WP_000127174.1|4124402_4124750_+	GPW/gp25 family protein	NA	A0A0M4RE59	Salmonella_phage	94.8	2.0e-54
WP_001526251.1|4124756_4125665_+|plate	baseplate assembly protein	plate	Q6K1H4	Salmonella_virus	96.7	1.2e-156
WP_001000068.1|4125657_4126188_+|tail	phage tail protein I	tail	S4TTA8	Salmonella_phage	100.0	9.2e-104
WP_001526230.1|4126198_4128301_+|tail	tail fiber protein	tail	Q6K1H2	Salmonella_virus	76.0	1.5e-234
WP_001526246.1|4128312_4128822_+|tail	tail fiber assembly protein	tail	S4TUB9	Salmonella_phage	82.8	2.1e-76
WP_020843727.1|4128956_4130144_+|tail	phage tail sheath protein	tail	Q6K1H0	Salmonella_virus	99.7	2.0e-223
WP_001207675.1|4130159_4130678_+|tail	phage major tail tube protein	tail	S4TNZ0	Salmonella_phage	100.0	6.5e-94
WP_020843728.1|4130740_4131076_+|tail	phage tail assembly protein	tail	S4TTB2	Salmonella_phage	99.1	4.0e-52
WP_085984508.1|4131072_4131228_+|tail	GpE family phage tail protein	tail	Q6K1G8	Salmonella_virus	98.0	8.8e-23
WP_020843729.1|4131220_4133662_+|tail	phage tail tape measure protein	tail	S4TP64	Salmonella_phage	90.4	0.0e+00
WP_001525765.1|4133675_4134161_+|tail	phage tail protein	tail	Q6K1G5	Salmonella_virus	93.1	5.0e-80
WP_020843730.1|4134157_4135327_+	phage late control D family protein	NA	Q6K1G4	Salmonella_virus	96.1	4.0e-208
WP_000972010.1|4135402_4135621_+	DNA-binding transcriptional regulator	NA	Q37973	Salmonella_virus	100.0	1.2e-38
>prophage 11
NC_021820	Salmonella enterica subsp. enterica serovar 4,[5],12:i:- str. 08-1736, complete sequence	4822189	4167028	4177014	4822189	tail	Salmonella_phage(33.33%)	7	NA	NA
WP_001526346.1|4167028_4167700_+	SOS response-associated peptidase	NA	A0A2H4J5W2	uncultured_Caudovirales_phage	61.3	2.8e-81
WP_001526350.1|4168398_4168806_+|tail	tail fiber assembly protein	tail	A0A1B0V844	Salmonella_phage	87.4	3.0e-62
WP_001526361.1|4168809_4169328_-|tail	tail fiber assembly protein	tail	A0A0U2QV64	Escherichia_phage	52.0	3.9e-46
WP_061873490.1|4169342_4170578_-	hypothetical protein	NA	A0A1B0VFW4	Salmonella_phage	66.4	3.2e-147
WP_000190912.1|4170901_4171474_-	flagellar phase variation DNA invertase Hin	NA	A0A0A7NPV4	Enterobacteria_phage	72.6	8.8e-68
WP_001221110.1|4172164_4173280_+	salmochelin biosynthesis C-glycosyltransferase IroB	NA	NA	NA	NA	NA
WP_001111809.1|4173360_4177014_+	ABC transporter ATP-binding protein	NA	W8CYL7	Bacillus_phage	28.6	7.9e-45
