The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
NC_021810	Salmonella enterica subsp. enterica serovar Heidelberg str. 41578, complete sequence	4793479	885443	899082	4793479	integrase	Enterobacteria_phage(80.0%)	14	885261:885282	896533:896554
885261:885282	attL	GACTCCTGTGATCTTCCGCCAA	NA	NA	NA	NA
WP_001218979.1|885443_886613_+|integrase	tyrosine-type recombinase/integrase	integrase	Q7M297	Enterobacteria_phage	88.1	1.7e-198
WP_000119815.1|886632_888492_+	DEAD/DEAH box helicase family protein	NA	A0A097BY72	Enterococcus_phage	22.4	1.8e-13
WP_000186475.1|888488_888914_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000446136.1|889241_889814_-	Polarity suppression protein	NA	Q7M2A1	Enterobacteria_phage	96.2	1.9e-94
WP_021038238.1|889887_890388_-	ogr/Delta-like zinc finger family protein	NA	NA	NA	NA	NA
WP_001283037.1|890384_891119_-	hypothetical protein	NA	Q7M2A2	Enterobacteria_phage	99.2	2.7e-130
WP_001149160.1|891670_891937_+	AlpA family transcriptional regulator	NA	Q7M299	Enterobacteria_phage	100.0	4.9e-45
WP_000980222.1|891933_892524_+	host cell division inhibitor Icd-like protein	NA	Q7M2A7	Enterobacteria_phage	90.3	4.1e-60
WP_001244665.1|892516_892804_+	hypothetical protein	NA	Q7M2A0	Enterobacteria_phage	97.9	8.6e-48
WP_000459302.1|892796_893252_+	hypothetical protein	NA	Q7M298	Enterobacteria_phage	99.1	1.6e-64
WP_000856729.1|893387_893708_+	DUF5375 domain-containing protein	NA	NA	NA	NA	NA
WP_000783667.1|893722_896056_+	toprim domain-containing protein	NA	Q7M2A8	Enterobacteria_phage	99.1	0.0e+00
WP_000120776.1|896869_897214_-	hypothetical protein	NA	NA	NA	NA	NA
896533:896554	attR	GACTCCTGTGATCTTCCGCCAA	NA	NA	NA	NA
WP_001541628.1|897891_899082_+	AAA family ATPase	NA	C7BGE8	Burkholderia_phage	34.3	1.2e-10
>prophage 2
NC_021810	Salmonella enterica subsp. enterica serovar Heidelberg str. 41578, complete sequence	4793479	1175953	1270474	4793479	terminase,head,portal,tail,lysis,tRNA,integrase,holin,capsid,plate,protease	Escherichia_phage(43.48%)	107	1209172:1209218	1240571:1240617
WP_000560969.1|1175953_1176391_+|tRNA	D-tyrosyl-tRNA(Tyr) deacylase	tRNA	NA	NA	NA	NA
WP_001518251.1|1176435_1177377_+	fatty acid biosynthesis protein FabY	NA	NA	NA	NA	NA
WP_001259012.1|1177391_1177838_-	type II toxin-antitoxin system HigA family antitoxin	NA	NA	NA	NA	NA
WP_000558163.1|1177834_1178146_-	type II toxin-antitoxin system HigB family toxin	NA	NA	NA	NA	NA
WP_001127705.1|1178231_1179161_-	alpha/beta hydrolase	NA	NA	NA	NA	NA
WP_001159635.1|1179378_1179690_+	cytotoxic translational repressor of toxin-antitoxin stability system	NA	NA	NA	NA	NA
WP_000362050.1|1179690_1179981_+	DNA-binding transcriptional regulator	NA	NA	NA	NA	NA
WP_000027730.1|1180027_1180957_-	formate dehydrogenase accessory protein FdhE	NA	NA	NA	NA	NA
WP_000829025.1|1180953_1181589_-	formate dehydrogenase cytochrome b556 subunit	NA	NA	NA	NA	NA
WP_000331361.1|1181585_1182488_-	formate dehydrogenase subunit beta	NA	NA	NA	NA	NA
WP_077248424.1|1182500_1185551_-	formate dehydrogenase-N subunit alpha	NA	A0A077SK27	Escherichia_phage	24.1	4.6e-06
WP_001059747.1|1185745_1186582_+	formate dehydrogenase accessory sulfurtransferase FdhD	NA	NA	NA	NA	NA
WP_000710973.1|1186849_1187881_-	YiiG family protein	NA	NA	NA	NA	NA
WP_000828043.1|1188063_1189164_+	DUF3829 domain-containing protein	NA	NA	NA	NA	NA
WP_000527676.1|1189507_1189831_-	AzlD domain-containing protein	NA	NA	NA	NA	NA
WP_000683586.1|1189830_1190490_-	AzlC family ABC transporter permease	NA	NA	NA	NA	NA
WP_010989088.1|1190572_1191139_+	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_000619477.1|1191227_1191542_-	L-rhamnose mutarotase	NA	NA	NA	NA	NA
WP_000009250.1|1191538_1192687_-	lactaldehyde reductase	NA	NA	NA	NA	NA
WP_001179685.1|1192813_1193641_-	rhamnulose-1-phosphate aldolase	NA	NA	NA	NA	NA
WP_000211472.1|1193783_1195043_-	L-rhamnose isomerase	NA	NA	NA	NA	NA
WP_000143957.1|1195039_1196509_-	rhamnulokinase	NA	NA	NA	NA	NA
WP_000217117.1|1196796_1197633_+	HTH-type transcriptional activator RhaS	NA	NA	NA	NA	NA
WP_000013291.1|1197785_1198634_+	HTH-type transcriptional activator RhaR	NA	NA	NA	NA	NA
WP_000063541.1|1198630_1199665_-	L-rhamnose/proton symporter RhaT	NA	NA	NA	NA	NA
WP_000378721.1|1200283_1200967_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000566800.1|1201125_1202433_-	TRAP transporter large permease	NA	NA	NA	NA	NA
WP_001091413.1|1202425_1202941_-	TRAP transporter small permease	NA	NA	NA	NA	NA
WP_000812816.1|1202959_1203943_-	TRAP transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_000122632.1|1204271_1204892_+	superoxide dismutase [Mn]	NA	Q56AR7	Bacillus_thuringiensis_phage	58.9	2.4e-63
WP_000559229.1|1204961_1205651_+	6-N-hydroxylaminopurine resistance protein	NA	NA	NA	NA	NA
WP_000133442.1|1205662_1206058_+	nuclear transport factor 2 family protein	NA	NA	NA	NA	NA
WP_000338671.1|1206178_1206382_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000580402.1|1206429_1207803_-	envelope stress sensor histidine kinase CpxA	NA	W8CYF6	Bacillus_phage	25.6	7.2e-15
WP_001033731.1|1207799_1208498_-	envelope stress response regulator transcription factor CpxR	NA	Q6XM27	Feldmannia_irregularis_virus	30.3	5.3e-06
WP_001233463.1|1208648_1209149_+	cell-envelope stress modulator CpxP	NA	NA	NA	NA	NA
1209172:1209218	attL	GACACCATCCCTGTCTTCCCCCACATGATGTGGGGGTTTTTTTTATC	NA	NA	NA	NA
WP_000985246.1|1209334_1210315_-|integrase	tyrosine-type recombinase/integrase	integrase	S4TP66	Salmonella_phage	100.0	4.7e-186
WP_000777029.1|1210384_1210678_-	helix-turn-helix domain-containing protein	NA	Q1JS37	Enterobacteria_phage	100.0	2.7e-49
WP_001308179.1|1210814_1211087_+	hypothetical protein	NA	Q1JS36	Enterobacteria_phage	100.0	1.4e-47
WP_001005164.1|1211089_1211260_+	hypothetical protein	NA	S4TNZ7	Salmonella_phage	98.2	1.8e-24
WP_000217677.1|1211256_1211757_+	hypothetical protein	NA	A0A0F7LBQ6	Escherichia_phage	100.0	4.5e-92
WP_000288879.1|1211820_1212045_+	DUF2732 family protein	NA	S4TP68	Salmonella_phage	98.6	2.3e-32
WP_001277964.1|1212044_1212347_+	DUF5405 family protein	NA	U5N0U2	Enterobacteria_phage	97.0	2.5e-45
WP_001113272.1|1212346_1212571_+	TraR/DksA family transcriptional regulator	NA	A0A0F7LDG9	Escherichia_phage	97.3	8.5e-35
WP_000027666.1|1212567_1212843_+	DUF5405 family protein	NA	U5N3W1	Enterobacteria_phage	97.8	1.6e-43
WP_000216280.1|1212832_1215121_+	replication endonuclease	NA	Q858T4	Yersinia_virus	97.0	0.0e+00
WP_000423601.1|1215351_1217559_-	AAA family ATPase	NA	NA	NA	NA	NA
WP_000038172.1|1217989_1219024_-|portal	phage portal protein	portal	A0A0F7LDI7	Escherichia_phage	99.7	1.2e-200
WP_000156860.1|1219023_1220796_-|terminase	terminase ATPase subunit family protein	terminase	A0A0F7LCK3	Escherichia_phage	99.5	0.0e+00
WP_001085976.1|1220969_1221824_+|capsid	GPO family capsid scaffolding protein	capsid	Q94MI4	Enterobacteria_phage	96.5	9.0e-133
WP_001248559.1|1221882_1222956_+|capsid	phage major capsid protein, P2 family	capsid	Q94MD1	Enterobacteria_phage	100.0	5.1e-202
WP_001682330.1|1222959_1223703_+|terminase	terminase endonuclease subunit	terminase	U5N091	Enterobacteria_phage	97.2	3.3e-123
WP_000988633.1|1223802_1224312_+|head	head completion/stabilization protein	head	U5N0S3	Enterobacteria_phage	100.0	1.1e-90
WP_000846399.1|1224311_1224515_+|tail	tail protein X	tail	U5N3E7	Enterobacteria_phage	100.0	4.0e-31
WP_000123124.1|1224518_1224800_+|holin	phage holin family protein	holin	A0A0F7LDF8	Escherichia_phage	100.0	3.7e-43
WP_001144101.1|1224799_1225297_+	glycoside hydrolase family 104 protein	NA	A0A0F7LBS0	Escherichia_phage	100.0	3.1e-93
WP_000736607.1|1225311_1225737_+	hypothetical protein	NA	U5N096	Enterobacteria_phage	95.7	2.8e-58
WP_000040673.1|1225724_1226150_+|lysis	LysB family phage lysis regulatory protein	lysis	U5N3W5	Enterobacteria_phage	96.5	4.7e-66
WP_000917156.1|1226257_1226725_+|tail	phage tail protein	tail	A0A0F7LA33	Escherichia_phage	98.7	8.7e-82
WP_001001780.1|1226717_1227170_+	phage virion morphogenesis protein	NA	A0A0F7LBV9	Escherichia_phage	100.0	6.3e-77
WP_001093737.1|1227236_1227872_+|plate	phage baseplate assembly protein V	plate	U5N3F0	Enterobacteria_phage	99.1	9.0e-114
WP_000127163.1|1227868_1228216_+	GPW/gp25 family protein	NA	A0A0F7L9X3	Escherichia_phage	100.0	1.7e-58
WP_001121478.1|1228220_1229129_+|plate	baseplate assembly protein	plate	Q858V6	Yersinia_virus	100.0	8.8e-163
WP_001285338.1|1229121_1229733_+|tail	phage tail protein I	tail	A0A0F7LA36	Escherichia_phage	99.5	6.4e-117
WP_000216976.1|1229729_1230707_+|tail	phage tail protein	tail	A0A0F7LBW5	Escherichia_phage	88.6	1.7e-143
WP_031612487.1|1231018_1231732_+	SPI-1 type III secretion system guanine nucleotide exchange factor SopE	NA	NA	NA	NA	NA
WP_000006335.1|1231928_1232336_-|tail	tail fiber assembly protein	tail	A0A1B0V844	Salmonella_phage	84.2	1.8e-59
WP_000022046.1|1232342_1233005_-	hypothetical protein	NA	A0A1B0V7G4	Salmonella_phage	73.7	9.3e-37
WP_000905102.1|1233203_1233797_+	recombinase family protein	NA	A0A0F7LA37	Escherichia_phage	97.0	1.3e-103
WP_001286720.1|1233856_1235047_+|tail	phage tail sheath protein	tail	A0A0F7LBW9	Escherichia_phage	99.5	4.8e-225
WP_001251408.1|1235059_1235578_+|tail	phage major tail tube protein	tail	A0A0F7LDZ1	Escherichia_phage	100.0	1.4e-93
WP_001031306.1|1235634_1235910_+|tail	phage tail assembly protein	tail	A0A0F7LDQ8	Escherichia_phage	98.9	2.2e-40
WP_000785970.1|1235942_1236062_+|tail	GpE family phage tail protein	tail	A0A0F7LCR6	Escherichia_phage	100.0	1.0e-15
WP_000069914.1|1236054_1238502_+|tail	phage tail tape measure protein	tail	M1T2S3	Escherichia_phage	97.1	0.0e+00
WP_000978885.1|1238516_1238996_+|tail	phage tail protein	tail	O64315	Escherichia_phage	99.4	1.5e-84
WP_000882949.1|1238995_1240159_+	phage late control D family protein	NA	U5N3V4	Enterobacteria_phage	99.2	7.0e-205
WP_000468308.1|1240240_1240459_+	prophage transcriptional regulator OgrK	NA	A0A0F7LDQ9	Escherichia_phage	100.0	4.7e-38
WP_001077320.1|1240695_1241598_+	CDF family cation-efflux transporter FieF	NA	NA	NA	NA	NA
1240571:1240617	attR	GACACCATCCCTGTCTTCCCCCACATGATGTGGGGGTTTTTTTTATC	NA	NA	NA	NA
WP_000758717.1|1242947_1243937_+	sulfate ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_000750754.1|1244037_1244793_+	CDP-diacylglycerol diphosphatase	NA	NA	NA	NA	NA
WP_000777317.1|1245057_1246392_+	MFS transporter	NA	NA	NA	NA	NA
WP_000646499.1|1246402_1247362_+	aminoimidazole riboside kinase	NA	NA	NA	NA	NA
WP_000557888.1|1247371_1248412_+	ADP-ribosylglycohydrolase family protein	NA	NA	NA	NA	NA
WP_001528882.1|1248474_1249197_+	GntR family transcriptional regulator	NA	NA	NA	NA	NA
WP_000060997.1|1249294_1249459_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001173080.1|1249695_1250046_-	cupin domain-containing protein	NA	NA	NA	NA	NA
WP_000113085.1|1250059_1251652_-	autoinducer-2 kinase	NA	NA	NA	NA	NA
WP_001283048.1|1251739_1252699_-	transcriptional regulator LsrR	NA	NA	NA	NA	NA
WP_001167250.1|1252954_1254490_+	autoinducer 2 ABC transporter ATP-binding protein LsrA	NA	A0A2H4PQG7	Staphylococcus_phage	30.0	6.3e-20
WP_000911134.1|1254483_1255527_+	autoinducer 2 ABC transporter permease LsrC	NA	NA	NA	NA	NA
WP_000981826.1|1255523_1256525_+	autoinducer 2 ABC transporter permease LsrD	NA	NA	NA	NA	NA
WP_000090737.1|1256553_1257576_+	autoinducer 2 ABC transporter substrate-binding protein LsrB	NA	NA	NA	NA	NA
WP_000774146.1|1257604_1258480_+	3-hydroxy-5-phosphonooxypentane-2,4-dione thiolase	NA	NA	NA	NA	NA
WP_001543603.1|1258562_1258853_+	(4S)-4-hydroxy-5-phosphonooxypentane-2,3-dione isomerase	NA	NA	NA	NA	NA
WP_001088046.1|1258862_1259627_+	epimerase	NA	NA	NA	NA	NA
WP_001216339.1|1259718_1260486_-	triose-phosphate isomerase	NA	NA	NA	NA	NA
WP_000802242.1|1260598_1261195_-	YiiQ family protein	NA	NA	NA	NA	NA
WP_000155237.1|1261295_1261724_+	DUF805 domain-containing protein	NA	NA	NA	NA	NA
WP_000796303.1|1261829_1262576_-	ferredoxin--NADP(+) reductase	NA	NA	NA	NA	NA
WP_001250617.1|1262672_1263683_-	class II fructose-bisphosphatase	NA	NA	NA	NA	NA
WP_000136809.1|1263794_1265303_-	glycerol kinase GlpK	NA	NA	NA	NA	NA
WP_000084287.1|1265323_1266169_-	aquaporin	NA	M1HWZ0	Paramecium_bursaria_Chlorella_virus	28.6	2.6e-15
WP_000051370.1|1266567_1266807_+	septal ring assembly protein ZapB	NA	NA	NA	NA	NA
WP_000872918.1|1267028_1267514_-	ribonuclease E activity regulator RraA	NA	NA	NA	NA	NA
WP_000139639.1|1267606_1268536_-	1,4-dihydroxy-2-naphthoate polyprenyltransferase	NA	NA	NA	NA	NA
WP_001293360.1|1268602_1269934_-	HslU--HslV peptidase ATPase subunit	NA	W6AS21	Erwinia_phage	28.3	2.4e-44
WP_000208240.1|1269943_1270474_-|protease	ATP-dependent protease subunit HslV	protease	NA	NA	NA	NA
>prophage 3
NC_021810	Salmonella enterica subsp. enterica serovar Heidelberg str. 41578, complete sequence	4793479	1378460	1399357	4793479	tail,plate	Burkholderia_phage(45.0%)	26	NA	NA
WP_000587739.1|1378460_1379102_-	hypothetical protein	NA	A0A077SLK3	Escherichia_phage	37.9	4.6e-33
WP_024132246.1|1379680_1380097_-	serine acetyltransferase	NA	NA	NA	NA	NA
WP_000084336.1|1380477_1380933_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001151758.1|1380929_1381544_-	DUF4376 domain-containing protein	NA	NA	NA	NA	NA
WP_000368193.1|1381550_1383209_-|tail	phage tail protein	tail	A0A0M3ULF6	Salmonella_phage	52.7	1.8e-52
WP_000359509.1|1383211_1383844_-|tail	phage tail protein I	tail	Q6QI98	Burkholderia_phage	56.4	8.6e-24
WP_000951734.1|1383836_1384952_-|plate	baseplate J/gp47 family protein	plate	Q6QI99	Burkholderia_phage	52.2	3.1e-101
WP_001093501.1|1384942_1385302_-	GPW/gp25 family protein	NA	Q6QIA0	Burkholderia_phage	64.2	2.8e-35
WP_000632053.1|1385465_1387013_-	hypothetical protein	NA	B9UDL6	Salmonella_phage	29.9	3.8e-49
WP_000703633.1|1387012_1387942_-	glycosyltransferase family 2 protein	NA	S5FKN0	Shigella_phage	84.1	1.4e-150
WP_000593182.1|1387938_1388301_-	GtrA family protein	NA	I1TED9	Salmonella_phage	70.8	1.2e-43
WP_000679398.1|1388628_1389351_-|plate	phage baseplate assembly protein V	plate	A0A067ZIM2	Vibrio_phage	41.0	3.3e-11
WP_000818154.1|1389360_1390404_-	phage late control D family protein	NA	Q6QIA2	Burkholderia_phage	45.1	2.5e-76
WP_001269716.1|1390391_1390601_-|tail	tail protein X	tail	A4JWL2	Burkholderia_virus	60.3	9.8e-17
WP_000271420.1|1390600_1391554_-|tail	phage tail protein	tail	A4JWL1	Burkholderia_virus	50.8	2.3e-36
WP_001262499.1|1391553_1393908_-|tail	phage tail tape measure protein	tail	A4JWL0	Burkholderia_virus	30.6	9.0e-66
WP_001185654.1|1394004_1394133_-|tail	GpE family phage tail protein	tail	NA	NA	NA	NA
WP_001003642.1|1394092_1394410_-|tail	phage tail assembly protein	tail	NA	NA	NA	NA
WP_000907497.1|1394461_1394986_-|tail	phage major tail tube protein	tail	Q6QIA9	Burkholderia_phage	69.0	2.3e-67
WP_000729852.1|1394985_1396413_-|tail	phage tail sheath family protein	tail	A4JWK5	Burkholderia_virus	70.9	1.1e-194
WP_000875314.1|1396402_1396600_-	hypothetical protein	NA	Q6QIB1	Burkholderia_phage	52.9	8.6e-07
WP_000449433.1|1396596_1397052_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000777266.1|1397211_1397526_-	membrane protein	NA	Q6QIC4	Burkholderia_phage	49.1	6.4e-20
WP_001270441.1|1397538_1398144_-	lytic transglycosylase domain-containing protein	NA	Q5ZQZ1	Pseudomonas_phage	59.9	2.5e-60
WP_001226442.1|1398146_1398434_-	membrane protein	NA	Q6QIC8	Burkholderia_phage	49.1	2.3e-16
WP_000615248.1|1399009_1399357_+	DNA-binding protein	NA	Q6QIE8	Burkholderia_phage	51.5	4.9e-21
>prophage 4
NC_021810	Salmonella enterica subsp. enterica serovar Heidelberg str. 41578, complete sequence	4793479	2165856	2209451	4793479	terminase,portal,lysis,coat,integrase,protease	Enterobacteria_phage(44.44%)	64	2169702:2169747	2208967:2209012
WP_001043660.1|2165856_2166909_-	phosphoporin PhoE	NA	Q1MVN1	Enterobacteria_phage	58.5	2.2e-112
WP_001285275.1|2167190_2168294_+	glutamate 5-kinase	NA	A0A1X9I5D0	Streptococcus_phage	39.8	6.9e-61
WP_000893221.1|2168305_2169556_+	glutamate-5-semialdehyde dehydrogenase	NA	A0A1X9I5D4	Streptococcus_phage	48.2	2.1e-98
2169702:2169747	attL	ATTCGTAATGCGAAGGTCGTAGGTTCGACTCCTATTATCGGCACCA	NA	NA	NA	NA
WP_000051900.1|2169761_2170925_-|integrase	site-specific integrase	integrase	A0A075B8E2	Enterobacteria_phage	99.7	2.4e-229
WP_000016640.1|2171154_2171790_-	hypothetical protein	NA	A0A075B8I7	Enterobacteria_phage	99.5	1.3e-120
WP_001277769.1|2171890_2172070_-	Eag protein	NA	A0A075B8F7	Enterobacteria_phage	98.3	1.6e-28
WP_000208013.1|2172166_2172853_-	DUF550 domain-containing protein	NA	S4TSR6	Salmonella_phage	53.2	4.3e-53
WP_000224223.1|2172863_2173127_-	hypothetical protein	NA	A0A2P0P958	Salmonella_phage	72.4	2.0e-30
WP_001289978.1|2173128_2173614_-	ead/Ea22-like family protein	NA	A5VWB3	Enterobacteria_phage	86.1	1.3e-43
WP_000812182.1|2173610_2174237_-	hypothetical protein	NA	A5VWB1	Enterobacteria_phage	71.2	7.1e-71
WP_001682200.1|2174233_2174398_-	DUF2737 family protein	NA	A0A2I6PID4	Escherichia_phage	98.1	1.6e-22
WP_001111313.1|2174408_2174705_-	DUF2856 family protein	NA	Q76H42	Enterobacteria_phage	90.8	3.9e-43
WP_000031375.1|2175035_2175653_-	ERF family protein	NA	A0A0N7CFJ3	Salmonella_phage	100.0	3.3e-105
WP_001163402.1|2175649_2175793_-	hypothetical protein	NA	A0A075B8I9	Enterobacteria_phage	100.0	3.2e-19
WP_000158027.1|2175782_2175971_-	DUF5444 family protein	NA	A0A075B8F9	Enterobacteria_phage	100.0	1.4e-30
WP_000582314.1|2175951_2176110_-|protease	protease FtsH-inhibitory lysogeny factor CIII	protease	A0A075B8H4	Enterobacteria_phage	100.0	4.0e-23
WP_000776964.1|2176195_2176507_-	superinfection exclusion protein	NA	A0A075B8E5	Enterobacteria_phage	100.0	1.1e-48
WP_001737461.1|2176654_2176858_-	DUF551 domain-containing protein	NA	A0A0N7CAQ5	Salmonella_phage	100.0	1.7e-34
WP_000651935.1|2176857_2177094_-	hypothetical protein	NA	A0A075B8J0	Enterobacteria_phage	100.0	4.3e-37
WP_000213983.1|2177130_2177325_-	hypothetical protein	NA	A0A075B8G0	Enterobacteria_phage	100.0	2.5e-30
WP_001682202.1|2177539_2178118_+	super-infection exclusion protein B	NA	A0A075B8E6	Enterobacteria_phage	100.0	8.8e-92
WP_000216175.1|2178138_2178441_-	hypothetical protein	NA	B8K1E6	Salmonella_phage	98.0	1.1e-48
WP_001095984.1|2178794_2179445_-	LexA family transcriptional regulator	NA	B1B6L9	Salmonella_phage	100.0	5.4e-122
WP_000276884.1|2179525_2179711_+	Cro/Cl family transcriptional regulator	NA	Q5G8T3	Enterobacteria_phage	100.0	5.4e-27
WP_000424167.1|2179817_2180096_+	transcriptional regulator	NA	Q5G8T2	Enterobacteria_phage	100.0	2.5e-44
WP_001125981.1|2180130_2180277_+	DUF2740 family protein	NA	A0A075B8K7	Enterobacteria_phage	100.0	1.5e-19
WP_000067075.1|2180269_2181085_+	replication protein	NA	A0A075B8J2	Enterobacteria_phage	100.0	9.4e-148
WP_001248406.1|2181081_2182458_+	DNA helicase	NA	A0A075B8G2	Enterobacteria_phage	100.0	3.3e-254
WP_000736921.1|2182531_2182969_+	recombination protein NinB	NA	A8CGE3	Salmonella_phage	100.0	1.3e-79
WP_000679702.1|2182965_2183139_+	hypothetical protein	NA	C6ZR56	Salmonella_phage	100.0	5.2e-32
WP_000113772.1|2183105_2183282_+	NinE family protein	NA	I6RSQ2	Salmonella_phage	100.0	4.6e-28
WP_001531428.1|2183284_2183617_+	DUF2591 domain-containing protein	NA	A0A075B8G3	Enterobacteria_phage	100.0	3.5e-61
WP_000950959.1|2183609_2183786_+	protein ninF	NA	I6S668	Salmonella_phage	100.0	2.5e-26
WP_001129733.1|2183778_2184390_+	recombination protein NinG	NA	A0A075B8E9	Enterobacteria_phage	100.0	1.3e-98
WP_000036317.1|2184386_2184611_+	hypothetical protein	NA	Q5G8R9	Enterobacteria_phage	100.0	2.2e-38
WP_000149925.1|2184607_2184811_+	protein ninH	NA	A0A075B8J4	Enterobacteria_phage	100.0	7.2e-33
WP_000219131.1|2184791_2184971_+	hypothetical protein	NA	A0A1U8QR34	Salmonella_phage	100.0	1.4e-24
WP_001235453.1|2184967_2185591_+	antitermination protein	NA	A0A075B8H9	Enterobacteria_phage	100.0	2.3e-114
WP_000286100.1|2186029_2186233_+	hypothetical protein	NA	I6R0S9	Salmonella_phage	100.0	1.1e-33
WP_000074137.1|2186210_2186708_+	lysozyme	NA	A0A1R3Y5W5	Salmonella_virus	97.0	6.0e-89
WP_001531485.1|2186796_2187234_+|lysis	lysis protein	lysis	O80289	Bacteriophage	99.3	9.1e-73
WP_001177703.1|2187446_2188133_+	Rha family transcriptional regulator	NA	A0A192Y918	Salmonella_phage	99.6	4.7e-124
WP_000807785.1|2188435_2188678_+	DUF2560 family protein	NA	A0A0M4R322	Salmonella_phage	100.0	7.5e-37
WP_001278047.1|2188679_2188859_+	hypothetical protein	NA	Q9AZ02	Salmonella_phage	91.5	3.0e-22
WP_000729925.1|2188882_2189371_+	hypothetical protein	NA	O80290	Bacteriophage	100.0	2.9e-88
WP_000417849.1|2189348_2190848_+|terminase	terminase	terminase	A0A192Y824	Salmonella_phage	99.8	1.4e-306
WP_000774656.1|2190847_2193025_+|portal	portal protein	portal	A0A2H4FNE2	Salmonella_phage	99.9	0.0e+00
WP_000433852.1|2193038_2193950_+	scaffold protein	NA	A0A192Y6T4	Salmonella_phage	100.0	4.9e-161
WP_001196938.1|2193949_2195242_+|coat	coat protein	coat	A0A192Y6V4	Salmonella_phage	100.0	3.2e-243
WP_000684729.1|2195280_2195490_+	hypothetical protein	NA	A0A192Y697	Salmonella_phage	100.0	1.3e-32
WP_001166098.1|2195473_2195974_+	packaged DNA stabilization protein p27	NA	I1TEJ0	Salmonella_phage	99.4	5.5e-90
WP_001122424.1|2195933_2197352_+	packaged DNA stabilization protein gp10	NA	A0A075B8I2	Enterobacteria_phage	100.0	7.6e-278
WP_000774927.1|2197355_2198057_+	hypothetical protein	NA	A0A192Y6T9	Salmonella_phage	100.0	8.8e-78
WP_000627697.1|2198056_2198512_+	DUF2824 family protein	NA	A0A192Y6V9	Salmonella_phage	100.0	5.2e-87
WP_000964902.1|2198514_2199207_+	hypothetical protein	NA	G5DA80	Enterobacteria_phage	98.7	1.2e-108
WP_000246945.1|2199216_2200512_+	phage DNA ejection protein	NA	Q716G3	Shigella_phage	84.5	2.1e-181
WP_001029838.1|2200511_2202509_+	hypothetical protein	NA	Q716G2	Shigella_phage	94.9	0.0e+00
WP_000749288.1|2202599_2203085_-	hypothetical protein	NA	NA	NA	NA	NA
WP_023602519.1|2203487_2203775_-	Arc family DNA-binding protein	NA	A0A088CPT2	Enterobacteria_phage	67.8	1.9e-26
WP_000129930.1|2203877_2205881_+	endorhamnosidase	NA	A0A2H4FWI0	Salmonella_phage	99.9	0.0e+00
WP_000671495.1|2205939_2207397_-	glucosyltransferase domain-containing protein	NA	A0A192Y7W8	Salmonella_phage	100.0	4.5e-241
WP_000703640.1|2207386_2208319_-	glycosyltransferase family 2 protein	NA	A0A192Y8W7	Salmonella_phage	100.0	5.5e-176
WP_000915528.1|2208315_2208678_-	GtrA family protein	NA	A0A192Y6N5	Salmonella_phage	100.0	5.0e-61
WP_001683918.1|2209175_2209451_+	DUF4102 domain-containing protein	NA	Q7M297	Enterobacteria_phage	64.1	1.9e-23
2208967:2209012	attR	ATTCGTAATGCGAAGGTCGTAGGTTCGACTCCTATTATCGGCACCA	NA	NA	NA	NA
>prophage 5
NC_021810	Salmonella enterica subsp. enterica serovar Heidelberg str. 41578, complete sequence	4793479	2813676	2821699	4793479	protease,transposase	Dickeya_phage(14.29%)	8	NA	NA
WP_001201751.1|2813676_2814795_+	macrolide transporter subunit MacA	NA	A0A140XAI1	Dickeya_phage	38.9	1.4e-08
WP_000125890.1|2814791_2816738_+	macrolide ABC transporter ATP-binding protein/permease MacB	NA	G9BWD6	Planktothrix_phage	42.3	9.1e-40
WP_000447499.1|2816867_2817089_-	cold shock-like protein CspD	NA	A0A2H4N7Y6	Lake_Baikal_phage	64.2	9.3e-18
WP_000520789.1|2817412_2817733_+|protease	ATP-dependent Clp protease adapter ClpS	protease	A0A1B1IT64	uncultured_Mediterranean_phage	45.7	4.5e-13
WP_000934063.1|2817763_2820040_+|protease	ATP-dependent Clp protease ATP-binding subunit ClpA	protease	A0A223W0B1	Agrobacterium_phage	42.3	6.2e-165
WP_000502119.1|2820230_2820689_+|transposase	IS200/IS605-like element IS200F family transposase	transposase	I4AZI8	Saccharomonospora_phage	31.5	1.0e-13
WP_001117984.1|2820962_2821160_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001531374.1|2821321_2821699_-	hypothetical protein	NA	A0A077KET4	Ralstonia_phage	40.2	1.7e-19
>prophage 6
NC_021810	Salmonella enterica subsp. enterica serovar Heidelberg str. 41578, complete sequence	4793479	2872307	2970266	4793479	terminase,portal,tail,transposase,lysis,tRNA,protease	Salmonella_phage(44.83%)	104	NA	NA
WP_001154025.1|2872307_2873111_+|tRNA	tRNA uridine 5-oxyacetic acid(34) methyltransferase CmoM	tRNA	NA	NA	NA	NA
WP_001288828.1|2873103_2874426_+	chromosome partition protein MukF	NA	NA	NA	NA	NA
WP_000060025.1|2874406_2875111_+	chromosome partition protein MukE	NA	NA	NA	NA	NA
WP_000572752.1|2875110_2879577_+	chromosome partition protein MukB	NA	NA	NA	NA	NA
WP_000925883.1|2879921_2881742_+	L,D-transpeptidase	NA	NA	NA	NA	NA
WP_000357052.1|2882001_2882550_+	YcbK family protein	NA	A0A0K1LKR7	Rhodobacter_phage	33.7	1.2e-05
WP_001109471.1|2882577_2883225_+	MBL fold metallo-hydrolase	NA	NA	NA	NA	NA
WP_000462653.1|2883286_2884477_-	aspartate transaminase	NA	NA	NA	NA	NA
WP_000977713.1|2884661_2885753_-	porin OmpF	NA	Q1MVN1	Enterobacteria_phage	51.7	2.2e-99
WP_000117870.1|2886359_2887760_-|tRNA	asparagine--tRNA ligase	tRNA	A0A167RLM0	Powai_lake_megavirus	35.1	4.5e-81
WP_000762342.1|2887960_2888422_-	Lrp/AsnC family transcriptional regulator	NA	NA	NA	NA	NA
WP_000544849.1|2888738_2889953_+	diaminopropionate ammonia-lyase	NA	NA	NA	NA	NA
WP_000893206.1|2890197_2891631_+	sodium:alanine symporter family protein	NA	NA	NA	NA	NA
WP_000191413.1|2891711_2892914_-	nicotinate phosphoribosyltransferase	NA	NA	NA	NA	NA
WP_001262307.1|2893108_2894401_-	DUF3596 domain-containing protein	NA	S4TSP2	Salmonella_phage	100.0	3.4e-253
WP_000065276.1|2894445_2894694_-	excisionase family protein	NA	S4TND0	Salmonella_phage	100.0	4.7e-42
WP_001682304.1|2894734_2894974_-	DUF4060 family protein	NA	S4TR31	Salmonella_phage	98.7	3.3e-37
WP_000189634.1|2894979_2895849_-	Dam family site-specific DNA-(adenine-N6)-methyltransferase	NA	A0A1C9II58	Salmonella_phage	86.3	7.2e-146
WP_000187054.1|2895845_2896526_-	YqaJ viral recombinase family protein	NA	A0A0M3ULE0	Salmonella_phage	97.8	3.3e-130
WP_000100830.1|2896522_2897308_-	phage recombination protein Bet	NA	A0A0M4RD39	Salmonella_phage	98.8	2.4e-148
WP_000995352.1|2897313_2897610_-	host-nuclease inhibitor protein Gam	NA	A0A0M5M5Z9	Salmonella_phage	100.0	1.1e-48
WP_000186242.1|2897700_2897901_-	cell division protein FtsZ	NA	G8C7T2	Escherichia_phage	48.4	2.4e-12
WP_000373338.1|2898188_2898395_+	hypothetical protein	NA	K7P7I0	Enterobacteria_phage	67.6	1.6e-16
WP_000091280.1|2898421_2898856_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000439725.1|2898857_2899283_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001230956.1|2899325_2899721_-	helix-turn-helix domain-containing protein	NA	K7PM35	Enterobacteria_phage	72.5	3.5e-47
WP_000992434.1|2899825_2900062_+	helix-turn-helix domain-containing protein	NA	A0A0M4QX15	Salmonella_phage	73.1	9.0e-27
WP_015675517.1|2900027_2900402_+	hypothetical protein	NA	S4TTD7	Salmonella_phage	99.2	1.9e-63
WP_000024046.1|2900493_2901399_+	replication protein	NA	A0A0M5M7Y1	Salmonella_phage	99.7	9.1e-176
WP_000788826.1|2901395_2902097_+	hypothetical protein	NA	A0A0M3ULE2	Salmonella_phage	99.1	1.9e-128
WP_023602525.1|2902141_2902543_+	ParB/RepB/Spo0J family partition protein	NA	S4TTI6	Salmonella_phage	98.5	5.4e-72
WP_000215887.1|2902539_2903073_+	hypothetical protein	NA	A0A192Y7N1	Salmonella_phage	89.8	8.1e-92
WP_000224239.1|2903074_2903332_+	hypothetical protein	NA	A0A192Y5W0	Salmonella_phage	95.3	4.5e-40
WP_000208143.1|2903342_2903744_+	hypothetical protein	NA	I6R0R2	Salmonella_phage	82.0	1.2e-18
WP_000877758.1|2903851_2904496_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001217669.1|2904726_2904960_+	DinI family protein	NA	H6WRY5	Salmonella_phage	100.0	5.6e-37
WP_014343878.1|2905076_2905325_+	hypothetical protein	NA	A0A0U2C0C8	Salmonella_phage	100.0	1.6e-42
WP_000929790.1|2905359_2905962_+	DUF1367 family protein	NA	S4TTI0	Salmonella_phage	99.5	7.5e-110
WP_001096547.1|2906170_2906782_+	recombination protein NinG	NA	A0A0M4RU10	Salmonella_phage	99.5	4.2e-92
WP_001617856.1|2906778_2906925_+	YlcG family protein	NA	A0A0M5M7B2	Salmonella_phage	97.9	4.3e-19
WP_001047631.1|2906914_2907712_+	antitermination protein	NA	A0A0M4S661	Salmonella_phage	99.6	2.3e-151
WP_000508329.1|2907878_2908097_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000658038.1|2908377_2908566_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001682303.1|2908768_2909071_+	alpha/beta hydrolase	NA	NA	NA	NA	NA
WP_000301013.1|2909048_2909588_+	lysozyme	NA	K7PLY1	Enterobacteria_phage	72.4	2.2e-76
WP_001080030.1|2909895_2910390_+|lysis	lysis protein	lysis	Q56118	Enterobacteria_phage	77.3	2.2e-59
WP_000371784.1|2910600_2911134_+	DUF1441 family protein	NA	A0A291AWV8	Escherichia_phage	48.1	1.0e-33
WP_000989238.1|2911090_2913229_+|terminase	phage terminase large subunit family protein	terminase	A5LH27	Enterobacteria_phage	72.6	6.9e-291
WP_000196190.1|2913225_2913432_+	hypothetical protein	NA	A0A1W6JT66	Pseudomonas_phage	53.3	2.9e-05
WP_001009205.1|2913428_2914976_+|portal	phage portal protein	portal	A0A291AWU2	Escherichia_phage	63.8	1.1e-176
WP_077906133.1|2914899_2916978_+|protease	Clp protease ClpP	protease	A0A291AWT6	Escherichia_phage	69.3	2.4e-264
WP_001107908.1|2917068_2917392_+	DUF2190 family protein	NA	K7PLV6	Enterobacteria_phage	61.3	7.7e-29
WP_000774239.1|2917384_2917684_+	ATP-binding protein	NA	K7PH43	Enterobacteria_phage	45.1	4.5e-15
WP_000453192.1|2917664_2918231_+|tail	phage tail protein	tail	Q9G063	Phage_Gifsy-2	95.7	2.1e-13
WP_000196703.1|2918227_2918629_+|tail	tail protein	tail	K7PHM6	Enterobacterial_phage	60.9	2.0e-42
WP_000132755.1|2918640_2919390_+|tail	phage tail protein	tail	A0A291AWU6	Escherichia_phage	68.6	3.7e-90
WP_000478858.1|2919435_2919834_+|tail	phage minor tail protein G	tail	K7PLV8	Enterobacteria_phage	56.8	8.6e-30
WP_010989009.1|2919830_2920160_+|tail	phage tail assembly protein T	tail	A5LH37	Enterobacteria_phage	50.9	5.0e-23
WP_065305406.1|2920239_2923227_+|tail	phage tail tape measure protein	tail	A0A291AWX1	Escherichia_phage	62.0	2.5e-262
WP_000978295.1|2923223_2923556_+|tail	phage tail protein	tail	A5LH39	Enterobacteria_phage	61.5	2.6e-35
WP_000410972.1|2923654_2924179_+	outer membrane beta-barrel protein	NA	A0A1B0VBR9	Salmonella_phage	35.3	1.8e-19
WP_000877926.1|2924268_2924802_-	superoxide dismutase [Cu-Zn]	NA	Q9MC02	Salmonella_phage	54.0	1.8e-46
WP_001152416.1|2924891_2925587_+|tail	phage minor tail protein L	tail	A0A0K2FJ01	Enterobacteria_phage	66.7	1.0e-89
WP_000606356.1|2925596_2926334_+|tail	phage tail protein	tail	A0A0P0ZE89	Stx2-converting_phage	75.6	5.2e-113
WP_020867839.1|2926231_2926936_+|tail	tail assembly protein	tail	A5LH42	Enterobacteria_phage	62.6	2.0e-66
WP_077906512.1|2929482_2930358_+	DUF1983 domain-containing protein	NA	K7PKJ2	Enterobacteria_phage	78.8	2.6e-50
WP_000178849.1|2930396_2930639_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001532020.1|2930692_2933068_+|tail	prophage tail fiber N-terminal domain-containing protein	tail	A0A0K2FIZ6	Escherichia_phage	64.9	1.9e-87
WP_031618324.1|2933568_2933889_+	hypothetical protein	NA	A0A0M4QWS3	Salmonella_phage	79.2	4.9e-44
WP_000143158.1|2933878_2934460_+|tail	tail fiber assembly protein	tail	A0A0M4RTP2	Salmonella_phage	87.4	1.8e-92
WP_000161705.1|2934656_2935379_-	SPI-1 type III secretion system guanine nucleotide exchange factor SopE	NA	NA	NA	NA	NA
WP_000388788.1|2935591_2935810_+	helix-turn-helix domain-containing protein	NA	S4TTF2	Salmonella_phage	89.7	1.7e-24
WP_000343758.1|2936029_2937250_+|transposase	ISL3 family transposase	transposase	NA	NA	NA	NA
WP_071531551.1|2937246_2937744_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000193784.1|2938178_2940791_+	aminopeptidase N	NA	A0A0P0IY26	Acinetobacter_phage	22.6	6.3e-20
WP_000291723.1|2940998_2942009_+	quinone-dependent dihydroorotate dehydrogenase	NA	NA	NA	NA	NA
WP_001220671.1|2942174_2942717_+	cell division protein ZapC	NA	NA	NA	NA	NA
WP_000224069.1|2942713_2943823_-	MOSC domain-containing protein	NA	NA	NA	NA	NA
WP_001086485.1|2943921_2946030_+	bifunctional 23S rRNA (guanine(2069)-N(7))-methyltransferase RlmK/23S rRNA (guanine(2445)-N(2))-methyltransferase RlmL	NA	NA	NA	NA	NA
WP_000053044.1|2946042_2947950_+	ABC transporter ATP-binding protein	NA	A0A2K9L3Z8	Tupanvirus	29.8	2.4e-53
WP_000333152.1|2947964_2949218_+	membrane integrity-associated transporter subunit PqiA	NA	NA	NA	NA	NA
WP_000433414.1|2949222_2950863_+	intermembrane transport protein PqiB	NA	NA	NA	NA	NA
WP_000759136.1|2950859_2951423_+	membrane integrity-associated transporter subunit PqiC	NA	NA	NA	NA	NA
WP_001537784.1|2951678_2951846_+	ribosome modulation factor	NA	NA	NA	NA	NA
WP_000227928.1|2951945_2952464_-	bifunctional 3-hydroxydecanoyl-ACP dehydratase/trans-2-decenoyl-ACP isomerase	NA	NA	NA	NA	NA
WP_000156454.1|2952532_2954293_-|protease	Lon protease family protein	protease	NA	NA	NA	NA
WP_000877172.1|2954478_2954931_+	macrodomain Ter protein MatP	NA	NA	NA	NA	NA
WP_001674965.1|2955002_2956055_-	porin OmpA	NA	NA	NA	NA	NA
WP_000288732.1|2956411_2956921_-	cell division inhibitor SulA	NA	NA	NA	NA	NA
WP_001202375.1|2957137_2957743_+	TfoX/Sxy family DNA transformation protein	NA	NA	NA	NA	NA
WP_000950880.1|2957729_2959883_-	TIGR01666 family membrane protein	NA	NA	NA	NA	NA
WP_001261222.1|2959901_2960348_-	YccF domain-containing protein	NA	NA	NA	NA	NA
WP_000420505.1|2960471_2962526_+	DNA helicase IV	NA	A7KV33	Bacillus_phage	27.6	8.5e-20
WP_000424187.1|2962561_2963020_-	methylglyoxal synthase	NA	NA	NA	NA	NA
WP_000847716.1|2963114_2963777_-	DUF2057 family protein	NA	NA	NA	NA	NA
WP_001537782.1|2963950_2964364_+	CoA-binding protein	NA	NA	NA	NA	NA
WP_000561983.1|2964408_2964726_-	heat shock protein HspQ	NA	NA	NA	NA	NA
WP_000140480.1|2964783_2965995_-	23S rRNA (cytosine(1962)-C(5))-methyltransferase RlmI	NA	NA	NA	NA	NA
WP_000859416.1|2966209_2966758_+	YbhB/YbcL family Raf kinase inhibitor-like protein	NA	NA	NA	NA	NA
WP_000548082.1|2966783_2967563_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_000072884.1|2967611_2967893_+	acylphosphatase	NA	NA	NA	NA	NA
WP_000904446.1|2967889_2968219_-	sulfurtransferase TusE	NA	NA	NA	NA	NA
WP_000374046.1|2968305_2968965_-|protease	FtsH protease modulator YccA	protease	A0A2H4JFM9	uncultured_Caudovirales_phage	52.4	2.7e-44
WP_000938191.1|2969585_2970266_-|protease	type III secretion system effector protease PipA	protease	Q9MBM0	Phage_Gifsy-2	70.6	8.3e-81
>prophage 7
NC_021810	Salmonella enterica subsp. enterica serovar Heidelberg str. 41578, complete sequence	4793479	3869396	3876648	4793479		Morganella_phage(33.33%)	8	NA	NA
WP_001157304.1|3869396_3870827_-	DNA cytosine methyltransferase	NA	E5E3X6	Burkholderia_phage	57.4	7.8e-105
WP_000377037.1|3870900_3871596_-	phosphohydrolase	NA	A0A1D6Y7U0	Golden_Marseillevirus	27.1	1.6e-07
WP_000107434.1|3871675_3871987_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001080662.1|3872637_3873834_+	porin OmpS1	NA	Q1MVN1	Enterobacteria_phage	56.1	5.1e-110
WP_024131109.1|3874091_3874280_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000208509.1|3874290_3874503_-	cold-shock protein	NA	A0A1W6JNX5	Morganella_phage	70.0	3.9e-21
WP_000457664.1|3874957_3876226_-	Y-family DNA polymerase	NA	I6RSM4	Salmonella_phage	92.2	1.2e-226
WP_000394197.1|3876228_3876648_-	translesion error-prone DNA polymerase V autoproteolytic subunit	NA	A0A1W6JNS2	Morganella_phage	60.5	8.5e-36
>prophage 8
NC_021810	Salmonella enterica subsp. enterica serovar Heidelberg str. 41578, complete sequence	4793479	3965992	3976498	4793479		Enterobacteria_phage(37.5%)	10	NA	NA
WP_000126349.1|3965992_3967306_-	lipopolysaccharide biosynthesis protein RfbH	NA	H8ZJ36	Ostreococcus_tauri_virus	35.1	7.0e-52
WP_000565905.1|3967332_3968412_-	CDP-glucose 4,6-dehydratase	NA	A0A222YY99	Synechococcus_phage	24.1	6.6e-16
WP_000648784.1|3968416_3969190_-	glucose-1-phosphate cytidylyltransferase	NA	NA	NA	NA	NA
WP_000018226.1|3969186_3970179_-	CDP-6-deoxy-delta-3,4-glucoseen reductase	NA	NA	NA	NA	NA
WP_000973708.1|3970184_3970736_-	dTDP-4-dehydrorhamnose 3,5-epimerase	NA	I7HJC4	Enterobacteria_phage	58.0	2.2e-52
WP_000857529.1|3970736_3971615_-	glucose-1-phosphate thymidylyltransferase RfbA	NA	I7I009	Enterobacteria_phage	65.5	9.3e-109
WP_001023662.1|3971662_3972562_-	dTDP-4-dehydrorhamnose reductase	NA	A0A291LA50	Escherichia_phage	36.3	1.4e-30
WP_000697840.1|3972561_3973647_-	dTDP-glucose 4,6-dehydratase	NA	I7HTA3	Enterobacteria_phage	53.9	1.2e-102
WP_000981469.1|3974023_3974917_-	GalU regulator GalF	NA	A0A127AW70	Bacillus_phage	42.2	4.8e-44
WP_001111845.1|3975094_3976498_-	colanic acid biosynthesis protein WcaM	NA	A0A291LBB9	Klebsiella_phage	26.5	6.8e-21
>prophage 9
NC_021810	Salmonella enterica subsp. enterica serovar Heidelberg str. 41578, complete sequence	4793479	4044774	4053945	4793479	tRNA	Enterobacteria_phage(66.67%)	10	NA	NA
WP_000195330.1|4044774_4046808_+|tRNA	methionine--tRNA ligase	tRNA	A0A1V0SDF2	Indivirus	27.6	1.0e-54
WP_000703137.1|4047048_4047507_+	YehR family lipoprotein	NA	Q9EYF5	Enterobacteria_phage	72.5	8.4e-53
WP_001197951.1|4047678_4048209_+	YehR family lipoprotein	NA	NA	NA	NA	NA
WP_000950413.1|4048265_4048733_-	DUF1456 family protein	NA	Q9EYF4	Enterobacteria_phage	90.3	3.9e-74
WP_000598637.1|4048779_4049499_-	two-component system response regulator BtsR	NA	NA	NA	NA	NA
WP_000272850.1|4049495_4051181_-	sensor histidine kinase	NA	Q9EYF3	Enterobacteria_phage	91.3	4.8e-279
WP_001240417.1|4051403_4052135_+	HTH-type transcriptional regulator MlrA	NA	Q9EYF2	Enterobacteria_phage	87.9	4.5e-101
WP_001261696.1|4052194_4052302_+	protein YohO	NA	NA	NA	NA	NA
WP_000824857.1|4052282_4053014_-	ABC transporter permease	NA	NA	NA	NA	NA
WP_000569165.1|4052997_4053945_-	ABC transporter ATP-binding protein	NA	F2Y1V5	Organic_Lake_phycodnavirus	27.8	3.7e-10
>prophage 10
NC_021810	Salmonella enterica subsp. enterica serovar Heidelberg str. 41578, complete sequence	4793479	4073352	4141872	4793479	lysis,tail,transposase,holin	Salmonella_phage(31.82%)	63	NA	NA
WP_000989295.1|4073352_4074048_+|lysis	CidB/LrgB family autolysis modulator	lysis	NA	NA	NA	NA
WP_000553526.1|4074201_4075086_+	cytidine deaminase	NA	NA	NA	NA	NA
WP_000920081.1|4075262_4075982_+	outer membrane permeability protein SanA	NA	NA	NA	NA	NA
WP_000605187.1|4075978_4076224_+	DUF2542 family protein	NA	NA	NA	NA	NA
WP_001136394.1|4076428_4077670_+	NAD(P)-dependent oxidoreductase	NA	NA	NA	NA	NA
WP_000956097.1|4077663_4078899_+	NAD-dependent dihydropyrimidine dehydrogenase subunit PreA	NA	NA	NA	NA	NA
WP_001275101.1|4078973_4079984_-	galactose/methyl galactoside ABC transporter permease MglC	NA	NA	NA	NA	NA
WP_000535907.1|4079999_4081520_-	galactose/methyl galactoside ABC transporter ATP-binding protein MglA	NA	F2Y2R6	Organic_Lake_phycodnavirus	31.9	1.0e-09
WP_001036943.1|4081653_4082652_-	galactose/glucose ABC transporter substrate-binding protein MglB	NA	NA	NA	NA	NA
WP_000628631.1|4083150_4084173_-	HTH-type transcriptional regulator GalS	NA	NA	NA	NA	NA
WP_001520237.1|4084322_4085465_-	DUF418 family protein	NA	NA	NA	NA	NA
WP_001139611.1|4085479_4086148_-	GTP cyclohydrolase I FolE	NA	M1Q6X8	Cellulophaga_phage	56.3	4.1e-56
WP_000425488.1|4086477_4087335_+	S-formylglutathione hydrolase	NA	NA	NA	NA	NA
WP_000876817.1|4087323_4087713_-	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_001531764.1|4087717_4089085_-	L-serine ammonia-lyase	NA	NA	NA	NA	NA
WP_000022912.1|4089301_4090189_+	phosphoserine phosphatase SerB	NA	NA	NA	NA	NA
WP_000023807.1|4090221_4091544_+	MFS transporter	NA	NA	NA	NA	NA
WP_000488244.1|4091587_4093579_-	catecholate siderophore receptor CirA	NA	A0A0P0I887	Acinetobacter_phage	37.9	6.7e-14
WP_000535000.1|4093924_4095394_-	lysine-specific permease	NA	NA	NA	NA	NA
WP_000548316.1|4095583_4096447_-	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_000137966.1|4096567_4097617_+	YeiH family protein	NA	NA	NA	NA	NA
WP_000873906.1|4097695_4098553_+	deoxyribonuclease IV	NA	A0A1V0SBL9	Catovirus	28.5	1.3e-22
WP_000854395.1|4098617_4100306_-	PTS fructose transporter subunit IIBC	NA	NA	NA	NA	NA
WP_000091249.1|4100322_4101261_-	1-phosphofructokinase	NA	NA	NA	NA	NA
WP_000487287.1|4101260_4102391_-	fused PTS fructose transporter subunit IIA/HPr protein	NA	NA	NA	NA	NA
WP_000551937.1|4102758_4103940_+	sugar efflux transporter SetB	NA	NA	NA	NA	NA
WP_001213897.1|4104003_4104669_-	membrane protein	NA	NA	NA	NA	NA
WP_001519564.1|4104670_4104793_-	membrane protein	NA	NA	NA	NA	NA
WP_001523448.1|4105180_4105435_-	YkgJ family cysteine cluster protein	NA	NA	NA	NA	NA
WP_001136822.1|4105758_4106331_+	elongation factor P-like protein YeiP	NA	NA	NA	NA	NA
WP_000169346.1|4106543_4107530_+	GTP-binding protein	NA	NA	NA	NA	NA
WP_000178095.1|4107559_4108279_+	phosphatase PAP2 family protein	NA	NA	NA	NA	NA
WP_000241015.1|4108692_4109265_+	bifunctional murein DD-endopeptidase/murein LD-carboxypeptidase	NA	A0A1V0DZX6	Clostridioides_phage	38.9	8.1e-13
WP_000957755.1|4109590_4111147_+	cyclic di-GMP phosphodiesterase	NA	NA	NA	NA	NA
WP_000561742.1|4111253_4113059_+	ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_000501626.1|4113068_4114163_+	microcin C ABC transporter permease YejB	NA	NA	NA	NA	NA
WP_001137747.1|4114162_4115188_+	ABC transporter permease	NA	NA	NA	NA	NA
WP_000222013.1|4115189_4116779_+	microcin C ABC transporter ATP-binding protein YejF	NA	G9BWD6	Planktothrix_phage	32.1	7.2e-19
WP_001094639.1|4116782_4117127_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000213347.1|4117517_4118708_-	Bcr/CflA family multidrug efflux MFS transporter	NA	S4TR35	Salmonella_phage	22.2	2.4e-19
WP_001234834.1|4118735_4119431_-	16S rRNA pseudouridine(516) synthase RsuA	NA	NA	NA	NA	NA
WP_000578130.1|4119582_4121343_+	DEAD/DEAH box helicase	NA	M4Q3N1	Vibrio_phage	41.8	1.4e-100
WP_000494192.1|4121467_4121752_+	50S ribosomal protein L25	NA	NA	NA	NA	NA
WP_000033443.1|4121860_4122481_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000050806.1|4122508_4123516_-	nucleoid-associated protein YejK	NA	A0A1V0E8C0	Vibrio_phage	48.3	4.5e-83
WP_001135904.1|4123695_4123923_+	YejL family protein	NA	NA	NA	NA	NA
WP_000256150.1|4123954_4125715_+	cardiolipin transport protein PbgA	NA	NA	NA	NA	NA
WP_000806401.1|4125995_4126499_-	LexA family transcriptional regulator	NA	Q1MVE7	Enterobacteria_phage	71.3	9.5e-50
WP_000884778.1|4126526_4126817_+	DinI family protein	NA	S4TND2	Salmonella_phage	83.3	4.7e-25
WP_000639473.1|4127164_4128994_+	acyltransferase	NA	C6ZR20	Salmonella_phage	29.6	3.0e-61
WP_000022213.1|4129047_4129491_-|tail	tail fiber assembly protein	tail	A0A0F7LDZ0	Escherichia_phage	43.9	1.4e-28
WP_001215679.1|4129868_4130396_-|tail	tail fiber assembly protein	tail	A0A1S6KZZ1	Salmonella_phage	31.3	3.1e-11
WP_000554739.1|4130398_4131640_-	hypothetical protein	NA	Q8HAB4	Salmonella_phage	95.3	1.0e-52
WP_001120499.1|4132232_4132562_-|holin	phage holin, lambda family	holin	Q8SBE1	Shigella_phage	94.6	3.9e-36
WP_000894638.1|4132858_4134190_+	NTPase	NA	R9TRQ8	Vibrio_phage	28.5	4.6e-19
WP_010989045.1|4134218_4134587_-	antitermination protein Q	NA	A5LH77	Enterobacteria_phage	81.7	7.4e-52
WP_001202279.1|4134601_4135591_-	DUF968 domain-containing protein	NA	A0A1C9IHZ5	Salmonella_phage	97.3	6.0e-189
WP_001115840.1|4135919_4138286_-	SPI-2 type III secretion system effector E3 ubiquitin transferase SspH2	NA	Q9MBL9	Phage_Gifsy-2	88.7	2.9e-72
WP_001113462.1|4138454_4138658_-|tail	tail protein	tail	NA	NA	NA	NA
WP_000624225.1|4138954_4139746_-|tail	tail fiber protein	tail	Q1MVL8	Enterobacteria_phage	31.6	1.7e-48
WP_001653202.1|4140048_4140252_+	virulence protein MsgA	NA	NA	NA	NA	NA
WP_000512961.1|4140443_4140704_-	acyloxyacyl hydrolase	NA	NA	NA	NA	NA
WP_000654806.1|4140903_4141872_+|transposase	IS5 family transposase	transposase	A0A1B0VFY5	Salmonella_phage	94.1	4.4e-176
>prophage 1
NC_021811	Salmonella enterica subsp. enterica serovar Heidelberg str. 41578 plasmid pSEEH1578_01, complete sequence	117929	33717	68596	117929	integrase,transposase	Stx2-converting_phage(21.43%)	40	27692:27708	73403:73419
27692:27708	attL	TCATTGGCGTCCTGACT	NA	NA	NA	NA
WP_000381395.1|33717_35289_-|transposase	IS66 family transposase	transposase	A0A0P0ZEB3	Stx2-converting_phage	58.7	9.9e-170
WP_000624622.1|35308_35656_-	IS66 family insertion sequence element accessory protein TnpB	NA	A0A0P0ZDM8	Stx2-converting_phage	76.6	2.6e-46
WP_001682408.1|35655_36333_-|transposase	transposase	transposase	A0A0P0ZCV4	Stx2-converting_phage	46.0	3.3e-21
WP_000078704.1|36467_37406_-|transposase	Rpn family recombination-promoting nuclease/putative transposase	transposase	Q2A0A7	Sodalis_phage	53.4	3.6e-66
WP_001247862.1|37470_37737_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000218863.1|37830_38265_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000117611.1|38993_39494_-	antirestriction protein ArdA	NA	G9FHQ1	Rhodococcus_virus	27.3	2.4e-05
WP_000977997.1|39955_40552_-	hypothetical protein	NA	A0A0N7KZV3	Escherichia_phage	55.3	3.4e-14
WP_001276270.1|40548_41268_-	plasmid SOS inhibition protein A	NA	NA	NA	NA	NA
WP_001387500.1|41264_41699_-	conjugation system SOS inhibitor PsiB	NA	NA	NA	NA	NA
WP_001145485.1|41753_43712_-	ParB/RepB/Spo0J family partition protein	NA	G8DH78	Emiliania_huxleyi_virus	29.4	7.3e-21
WP_000006020.1|43770_44004_-	DUF905 domain-containing protein	NA	A0A096XUX0	Cronobacter_phage	53.2	1.7e-06
WP_001276120.1|44061_44589_-	single-stranded DNA-binding protein	NA	I3PGW4	Xanthomonas_phage	73.5	1.6e-47
WP_001434357.1|44972_45287_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001027495.1|45357_45549_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000271705.1|45545_45968_-	DUF1380 family protein	NA	NA	NA	NA	NA
WP_001198939.1|46014_46440_-	antirestriction protein	NA	NA	NA	NA	NA
WP_001668483.1|46412_46985_-	YubH family protein	NA	NA	NA	NA	NA
WP_000274500.1|47679_48114_-	DUF1380 domain-containing protein	NA	NA	NA	NA	NA
WP_001104881.1|48127_48349_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000086147.1|48349_49033_-	DNA methylase	NA	A0A2I7RE86	Vibrio_phage	36.4	1.1e-29
WP_086016659.1|49417_50320_-	DUF1281 domain-containing protein	NA	NA	NA	NA	NA
WP_000272884.1|51000_51393_-	plasmid partitioning/stability family protein	NA	NA	NA	NA	NA
WP_001217836.1|51396_52371_-	hypothetical protein	NA	A0A222YXF2	Escherichia_phage	45.1	3.1e-73
WP_000752652.1|52609_52984_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000312331.1|52983_53616_-	ParA family protein	NA	A0A0K1LMB9	Rhodobacter_phage	39.1	1.4e-29
WP_001164192.1|54199_54985_-|integrase	phage integrase family protein	integrase	I3WFA4	Macacine_betaherpesvirus	96.5	4.0e-55
WP_000465034.1|54986_55400_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000343102.1|55968_56229_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000194555.1|56225_56816_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000142424.1|56833_57181_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000762580.1|57299_57647_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001283356.1|57664_59545_-	colicin	NA	NA	NA	NA	NA
WP_001132019.1|59823_61170_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000517689.1|61523_62126_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001442119.1|62181_62676_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000627831.1|62675_62942_+	hypothetical protein	NA	NA	NA	NA	NA
WP_044568872.1|63418_63823_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000427623.1|64087_65092_-|transposase	IS110-like element IS4321 family transposase	transposase	NA	NA	NA	NA
WP_001067855.1|67891_68596_-|transposase	IS6-like element IS26 family transposase	transposase	A0A077SL39	Escherichia_phage	100.0	1.8e-139
73403:73419	attR	AGTCAGGACGCCAATGA	NA	NA	NA	NA
