The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
NC_021812	Salmonella enterica subsp. enterica serovar Heidelberg str. CFSAN002069, complete sequence	4783943	61996	82893	4783943	tail,plate	Burkholderia_phage(45.0%)	26	NA	NA
WP_000587739.1|61996_62638_-	hypothetical protein	NA	A0A077SLK3	Escherichia_phage	37.9	4.6e-33
WP_024132246.1|63216_63633_-	serine acetyltransferase	NA	NA	NA	NA	NA
WP_000084336.1|64013_64469_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001151758.1|64465_65080_-	DUF4376 domain-containing protein	NA	NA	NA	NA	NA
WP_000368193.1|65086_66745_-|tail	tail protein	tail	A0A0M3ULF6	Salmonella_phage	52.7	1.8e-52
WP_000359509.1|66747_67380_-|tail	phage tail protein I	tail	Q6QI98	Burkholderia_phage	56.4	8.6e-24
WP_000951734.1|67372_68488_-|plate	baseplate protein	plate	Q6QI99	Burkholderia_phage	52.2	3.1e-101
WP_001093501.1|68478_68838_-|plate	baseplate protein	plate	Q6QIA0	Burkholderia_phage	64.2	2.8e-35
WP_000632053.1|69001_70549_-	hypothetical protein	NA	B9UDL6	Salmonella_phage	29.9	3.8e-49
WP_000703633.1|70548_71478_-	glycosyltransferase family 2 protein	NA	S5FKN0	Shigella_phage	84.1	1.4e-150
WP_000593182.1|71474_71837_-	GtrA family protein	NA	I1TED9	Salmonella_phage	70.8	1.2e-43
WP_000679398.1|72164_72887_-|plate	phage baseplate assembly protein V	plate	A0A067ZIM2	Vibrio_phage	41.0	3.3e-11
WP_000818154.1|72896_73940_-	phage late control D family protein	NA	Q6QIA2	Burkholderia_phage	45.1	2.5e-76
WP_001269716.1|73927_74137_-	membrane protein	NA	A4JWL2	Burkholderia_virus	60.3	9.8e-17
WP_000271420.1|74136_75090_-	chemotaxis protein	NA	A4JWL1	Burkholderia_virus	50.8	2.3e-36
WP_001262499.1|75089_77444_-|tail	phage tail tape measure protein	tail	A4JWL0	Burkholderia_virus	30.6	9.0e-66
WP_001185654.1|77540_77669_-|tail	GpE family phage tail protein	tail	NA	NA	NA	NA
WP_001003642.1|77628_77946_-|tail	phage tail assembly protein	tail	NA	NA	NA	NA
WP_000907497.1|77997_78522_-|tail	phage major tail tube protein	tail	Q6QIA9	Burkholderia_phage	69.0	2.3e-67
WP_000729852.1|78521_79949_-|tail	phage tail sheath family protein	tail	A4JWK5	Burkholderia_virus	70.9	1.1e-194
WP_000875314.1|79938_80136_-	hypothetical protein	NA	Q6QIB1	Burkholderia_phage	52.9	8.6e-07
WP_000449433.1|80132_80588_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000777266.1|80747_81062_-	membrane protein	NA	Q6QIC4	Burkholderia_phage	49.1	6.4e-20
WP_001270441.1|81074_81680_-	transglycosylase SLT domain-containing protein	NA	Q5ZQZ1	Pseudomonas_phage	59.9	2.5e-60
WP_001226442.1|81682_81970_-	membrane protein	NA	Q6QIC8	Burkholderia_phage	49.1	2.3e-16
WP_000615248.1|82545_82893_+	DNA-binding protein	NA	Q6QIE8	Burkholderia_phage	51.5	4.9e-21
>prophage 2
NC_021812	Salmonella enterica subsp. enterica serovar Heidelberg str. CFSAN002069, complete sequence	4783943	851103	894699	4783943	lysis,protease,integrase,coat,portal,terminase	Enterobacteria_phage(44.44%)	64	854950:854995	894215:894260
WP_001043660.1|851103_852156_-	phosphoporin PhoE	NA	Q1MVN1	Enterobacteria_phage	58.5	2.2e-112
WP_001285275.1|852438_853542_+	glutamate 5-kinase	NA	A0A1X9I5D0	Streptococcus_phage	39.8	6.9e-61
WP_000893221.1|853553_854804_+	glutamate-5-semialdehyde dehydrogenase	NA	A0A1X9I5D4	Streptococcus_phage	48.2	2.1e-98
854950:854995	attL	ATTCGTAATGCGAAGGTCGTAGGTTCGACTCCTATTATCGGCACCA	NA	NA	NA	NA
WP_000051900.1|855009_856173_-|integrase	site-specific integrase	integrase	A0A075B8E2	Enterobacteria_phage	99.7	2.4e-229
WP_000016640.1|856402_857038_-	hypothetical protein	NA	A0A075B8I7	Enterobacteria_phage	99.5	1.3e-120
WP_001277769.1|857138_857318_-	Eag protein	NA	A0A075B8F7	Enterobacteria_phage	98.3	1.6e-28
WP_000208013.1|857414_858101_-	DUF550 domain-containing protein	NA	S4TSR6	Salmonella_phage	53.2	4.3e-53
WP_000224223.1|858111_858375_-	hypothetical protein	NA	A0A2P0P958	Salmonella_phage	72.4	2.0e-30
WP_001289978.1|858376_858862_-	ead/Ea22-like family protein	NA	A5VWB3	Enterobacteria_phage	86.1	1.3e-43
WP_000812182.1|858858_859485_-	hypothetical protein	NA	A5VWB1	Enterobacteria_phage	71.2	7.1e-71
WP_001682200.1|859481_859646_-	DUF2737 family protein	NA	A0A2I6PID4	Escherichia_phage	98.1	1.6e-22
WP_001111313.1|859656_859953_-	DUF2856 family protein	NA	Q76H42	Enterobacteria_phage	90.8	3.9e-43
WP_000031375.1|860283_860901_-	ERF family protein	NA	A0A0N7CFJ3	Salmonella_phage	100.0	3.3e-105
WP_001163402.1|860897_861041_-	hypothetical protein	NA	A0A075B8I9	Enterobacteria_phage	100.0	3.2e-19
WP_000158027.1|861030_861219_-	DUF5444 family protein	NA	A0A075B8F9	Enterobacteria_phage	100.0	1.4e-30
WP_000582314.1|861199_861358_-|protease	protease FtsH-inhibitory lysogeny factor CIII	protease	A0A075B8H4	Enterobacteria_phage	100.0	4.0e-23
WP_000776964.1|861443_861755_-	superinfection exclusion protein	NA	A0A075B8E5	Enterobacteria_phage	100.0	1.1e-48
WP_001737461.1|861902_862106_-	DUF551 domain-containing protein	NA	A0A0N7CAQ5	Salmonella_phage	100.0	1.7e-34
WP_000651935.1|862105_862342_-	hypothetical protein	NA	A0A075B8J0	Enterobacteria_phage	100.0	4.3e-37
WP_000213983.1|862378_862573_-	hypothetical protein	NA	A0A075B8G0	Enterobacteria_phage	100.0	2.5e-30
WP_001682202.1|862787_863366_+	superinfection exclusion protein B	NA	A0A075B8E6	Enterobacteria_phage	100.0	8.8e-92
WP_000216175.1|863386_863689_-	hypothetical protein	NA	B8K1E6	Salmonella_phage	98.0	1.1e-48
WP_001095984.1|864042_864693_-	LexA family transcriptional regulator	NA	B1B6L9	Salmonella_phage	100.0	5.4e-122
WP_000276884.1|864773_864959_+	hypothetical protein	NA	Q5G8T3	Enterobacteria_phage	100.0	5.4e-27
WP_000424167.1|865065_865344_+	transcriptional regulator	NA	Q5G8T2	Enterobacteria_phage	100.0	2.5e-44
WP_001125981.1|865378_865525_+	DUF2740 family protein	NA	A0A075B8K7	Enterobacteria_phage	100.0	1.5e-19
WP_000067075.1|865517_866333_+	replication protein	NA	A0A075B8J2	Enterobacteria_phage	100.0	9.4e-148
WP_001248406.1|866329_867706_+	DNA helicase	NA	A0A075B8G2	Enterobacteria_phage	100.0	3.3e-254
WP_000736921.1|867779_868217_+	recombination protein NinB	NA	A8CGE3	Salmonella_phage	100.0	1.3e-79
WP_000679702.1|868213_868387_+	hypothetical protein	NA	C6ZR56	Salmonella_phage	100.0	5.2e-32
WP_000113772.1|868353_868530_+	NinE family protein	NA	I6RSQ2	Salmonella_phage	100.0	4.6e-28
WP_001531428.1|868532_868865_+	DUF2591 domain-containing protein	NA	A0A075B8G3	Enterobacteria_phage	100.0	3.5e-61
WP_000950959.1|868857_869034_+	protein ninF	NA	I6S668	Salmonella_phage	100.0	2.5e-26
WP_001129733.1|869026_869638_+	recombination protein NinG	NA	A0A075B8E9	Enterobacteria_phage	100.0	1.3e-98
WP_000036317.1|869634_869859_+	hypothetical protein	NA	Q5G8R9	Enterobacteria_phage	100.0	2.2e-38
WP_000149925.1|869855_870059_+	protein ninH	NA	A0A075B8J4	Enterobacteria_phage	100.0	7.2e-33
WP_000219131.1|870039_870219_+	hypothetical protein	NA	A0A1U8QR34	Salmonella_phage	100.0	1.4e-24
WP_001235453.1|870215_870839_+	antitermination protein	NA	A0A075B8H9	Enterobacteria_phage	100.0	2.3e-114
WP_000286100.1|871277_871481_+	hypothetical protein	NA	I6R0S9	Salmonella_phage	100.0	1.1e-33
WP_000074137.1|871458_871956_+	lysozyme	NA	A0A1R3Y5W5	Salmonella_virus	97.0	6.0e-89
WP_001531485.1|872044_872482_+|lysis	lysis protein	lysis	O80289	Bacteriophage	99.3	9.1e-73
WP_001177703.1|872694_873381_+	Rha family transcriptional regulator	NA	A0A192Y918	Salmonella_phage	99.6	4.7e-124
WP_000807785.1|873683_873926_+	DUF2560 family protein	NA	A0A0M4R322	Salmonella_phage	100.0	7.5e-37
WP_001278047.1|873927_874107_+	hypothetical protein	NA	Q9AZ02	Salmonella_phage	91.5	3.0e-22
WP_000729925.1|874130_874619_+	hypothetical protein	NA	O80290	Bacteriophage	100.0	2.9e-88
WP_000417849.1|874596_876096_+|terminase	terminase	terminase	A0A192Y824	Salmonella_phage	99.8	1.4e-306
WP_000774656.1|876095_878273_+|portal	portal protein	portal	A0A2H4FNE2	Salmonella_phage	99.9	0.0e+00
WP_000433852.1|878286_879198_+	scaffold protein	NA	A0A192Y6T4	Salmonella_phage	100.0	4.9e-161
WP_001196938.1|879197_880490_+|coat	coat protein	coat	A0A192Y6V4	Salmonella_phage	100.0	3.2e-243
WP_000684729.1|880528_880738_+	hypothetical protein	NA	A0A192Y697	Salmonella_phage	100.0	1.3e-32
WP_001166098.1|880721_881222_+	packaged DNA stabilization protein p27	NA	I1TEJ0	Salmonella_phage	99.4	5.5e-90
WP_001122424.1|881181_882600_+	Packaged DNA stabilization protein gp10	NA	A0A075B8I2	Enterobacteria_phage	100.0	7.6e-278
WP_000774927.1|882603_883305_+	hypothetical protein	NA	A0A192Y6T9	Salmonella_phage	100.0	8.8e-78
WP_000627697.1|883304_883760_+	DUF2824 family protein	NA	A0A192Y6V9	Salmonella_phage	100.0	5.2e-87
WP_000964902.1|883762_884455_+	hypothetical protein	NA	G5DA80	Enterobacteria_phage	98.7	1.2e-108
WP_000246945.1|884464_885760_+	phage DNA ejection protein	NA	Q716G3	Shigella_phage	84.5	2.1e-181
WP_001029838.1|885759_887757_+	hypothetical protein	NA	Q716G2	Shigella_phage	94.9	0.0e+00
WP_000749288.1|887847_888333_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000287064.1|888735_888990_-	Arc family DNA-binding protein	NA	A0A088CPT2	Enterobacteria_phage	63.3	4.4e-19
WP_000129930.1|889125_891129_+	endorhamnosidase	NA	A0A2H4FWI0	Salmonella_phage	99.9	0.0e+00
WP_000671495.1|891187_892645_-	hypothetical protein	NA	A0A192Y7W8	Salmonella_phage	100.0	4.5e-241
WP_000703640.1|892634_893567_-	glycosyltransferase family 2 protein	NA	A0A192Y8W7	Salmonella_phage	100.0	5.5e-176
WP_000915528.1|893563_893926_-	GtrA family protein	NA	A0A192Y6N5	Salmonella_phage	100.0	5.0e-61
WP_001683918.1|894423_894699_+	DUF4102 domain-containing protein	NA	Q7M297	Enterobacteria_phage	64.1	1.9e-23
894215:894260	attR	ATTCGTAATGCGAAGGTCGTAGGTTCGACTCCTATTATCGGCACCA	NA	NA	NA	NA
>prophage 3
NC_021812	Salmonella enterica subsp. enterica serovar Heidelberg str. CFSAN002069, complete sequence	4783943	1498925	1506948	4783943	protease,transposase	Dickeya_phage(14.29%)	8	NA	NA
WP_001201751.1|1498925_1500044_+	macrolide transporter subunit MacA	NA	A0A140XAI1	Dickeya_phage	38.9	1.4e-08
WP_000125890.1|1500040_1501987_+	macrolide ABC transporter ATP-binding protein/permease MacB	NA	G9BWD6	Planktothrix_phage	42.3	9.1e-40
WP_000447499.1|1502116_1502338_-	cold shock-like protein CspD	NA	A0A2H4N7Y6	Lake_Baikal_phage	64.2	9.3e-18
WP_000520789.1|1502661_1502982_+|protease	ATP-dependent Clp protease adapter ClpS	protease	A0A1B1IT64	uncultured_Mediterranean_phage	45.7	4.5e-13
WP_000934063.1|1503012_1505289_+|protease	ATP-dependent Clp protease ATP-binding subunit ClpA	protease	A0A223W0B1	Agrobacterium_phage	42.3	6.2e-165
WP_000502119.1|1505479_1505938_+|transposase	IS200/IS605-like element IS200F family transposase	transposase	I4AZI8	Saccharomonospora_phage	31.5	1.0e-13
WP_001117984.1|1506211_1506409_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001531374.1|1506570_1506948_-	hypothetical protein	NA	A0A077KET4	Ralstonia_phage	40.2	1.7e-19
>prophage 4
NC_021812	Salmonella enterica subsp. enterica serovar Heidelberg str. CFSAN002069, complete sequence	4783943	1557557	1655517	4783943	tRNA,tail,lysis,protease,integrase,transposase,portal,terminase	Salmonella_phage(44.83%)	103	1560466:1560485	1631404:1631423
WP_001154025.1|1557557_1558361_+|tRNA	tRNA uridine 5-oxyacetic acid(34) methyltransferase CmoM	tRNA	NA	NA	NA	NA
WP_001288828.1|1558353_1559676_+	chromosome partition protein MukF	NA	NA	NA	NA	NA
WP_000060025.1|1559656_1560361_+	chromosome partition protein MukE	NA	NA	NA	NA	NA
WP_000572753.1|1560360_1564827_+	chromosome partition protein MukB	NA	NA	NA	NA	NA
1560466:1560485	attL	AACGGCGCCGGGAAATCCAC	NA	NA	NA	NA
WP_000925883.1|1565171_1566992_+	L,D-transpeptidase	NA	NA	NA	NA	NA
WP_000357052.1|1567251_1567800_+	YcbK family protein	NA	A0A0K1LKR7	Rhodobacter_phage	33.7	1.2e-05
WP_001109471.1|1567827_1568475_+	MBL fold metallo-hydrolase	NA	NA	NA	NA	NA
WP_000462653.1|1568536_1569727_-	aspartate transaminase	NA	NA	NA	NA	NA
WP_000977713.1|1569911_1571003_-	porin OmpF	NA	Q1MVN1	Enterobacteria_phage	51.7	2.2e-99
WP_000117870.1|1571609_1573010_-|tRNA	asparagine--tRNA ligase	tRNA	A0A167RLM0	Powai_lake_megavirus	35.1	4.5e-81
WP_000762342.1|1573210_1573672_-	Lrp/AsnC family transcriptional regulator	NA	NA	NA	NA	NA
WP_000544849.1|1573988_1575203_+	diaminopropionate ammonia-lyase	NA	NA	NA	NA	NA
WP_000893206.1|1575447_1576881_+	sodium:alanine symporter family protein	NA	NA	NA	NA	NA
WP_000191413.1|1576961_1578164_-	nicotinate phosphoribosyltransferase	NA	NA	NA	NA	NA
WP_001262307.1|1578358_1579651_-|integrase	site-specific integrase	integrase	S4TSP2	Salmonella_phage	100.0	3.4e-253
WP_000065276.1|1579695_1579944_-	excisionase family protein	NA	S4TND0	Salmonella_phage	100.0	4.7e-42
WP_001682304.1|1579984_1580224_-	DUF4060 family protein	NA	S4TR31	Salmonella_phage	98.7	3.3e-37
WP_000189634.1|1580229_1581099_-	Dam family site-specific DNA-(adenine-N6)-methyltransferase	NA	A0A1C9II58	Salmonella_phage	86.3	7.2e-146
WP_000187054.1|1581095_1581776_-	YqaJ viral recombinase family protein	NA	A0A0M3ULE0	Salmonella_phage	97.8	3.3e-130
WP_000100830.1|1581772_1582558_-	phage recombination protein Bet	NA	A0A0M4RD39	Salmonella_phage	98.8	2.4e-148
WP_000995352.1|1582563_1582860_-	host-nuclease inhibitor protein Gam	NA	A0A0M5M5Z9	Salmonella_phage	100.0	1.1e-48
WP_000186242.1|1582950_1583151_-	cell division protein FtsZ	NA	G8C7T2	Escherichia_phage	48.4	2.4e-12
WP_000373338.1|1583438_1583645_+	hypothetical protein	NA	K7P7I0	Enterobacteria_phage	67.6	1.6e-16
WP_000091280.1|1583671_1584106_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000439725.1|1584107_1584533_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001230956.1|1584575_1584971_-	helix-turn-helix domain-containing protein	NA	K7PM35	Enterobacteria_phage	72.5	3.5e-47
WP_000992434.1|1585075_1585312_+	Rha family transcriptional regulator	NA	A0A0M4QX15	Salmonella_phage	73.1	9.0e-27
WP_015675517.1|1585277_1585652_+	hypothetical protein	NA	S4TTD7	Salmonella_phage	99.2	1.9e-63
WP_000024046.1|1585743_1586649_+	replication protein	NA	A0A0M5M7Y1	Salmonella_phage	99.7	9.1e-176
WP_000788826.1|1586645_1587347_+	hypothetical protein	NA	A0A0M3ULE2	Salmonella_phage	99.1	1.9e-128
WP_023602525.1|1587391_1587793_+	ParB/RepB/Spo0J family partition protein	NA	S4TTI6	Salmonella_phage	98.5	5.4e-72
WP_000215887.1|1587789_1588323_+	hypothetical protein	NA	A0A192Y7N1	Salmonella_phage	89.8	8.1e-92
WP_000224239.1|1588324_1588582_+	hypothetical protein	NA	A0A192Y5W0	Salmonella_phage	95.3	4.5e-40
WP_000208143.1|1588592_1588994_+	hypothetical protein	NA	I6R0R2	Salmonella_phage	82.0	1.2e-18
WP_000877758.1|1589101_1589746_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001217669.1|1589976_1590210_+	DinI family protein	NA	H6WRY5	Salmonella_phage	100.0	5.6e-37
WP_014343878.1|1590326_1590575_+	hypothetical protein	NA	A0A0U2C0C8	Salmonella_phage	100.0	1.6e-42
WP_000929790.1|1590609_1591212_+	DUF1367 family protein	NA	S4TTI0	Salmonella_phage	99.5	7.5e-110
WP_001096547.1|1591420_1592032_+	hypothetical protein	NA	A0A0M4RU10	Salmonella_phage	99.5	4.2e-92
WP_001617856.1|1592028_1592175_+	YlcG family protein	NA	A0A0M5M7B2	Salmonella_phage	97.9	4.3e-19
WP_001047631.1|1592164_1592962_+	antitermination protein	NA	A0A0M4S661	Salmonella_phage	99.6	2.3e-151
WP_000508329.1|1593128_1593347_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000658038.1|1593627_1593816_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001682303.1|1594018_1594321_+	alpha/beta hydrolase	NA	NA	NA	NA	NA
WP_000301013.1|1594298_1594838_+	lysozyme	NA	K7PLY1	Enterobacteria_phage	72.4	2.2e-76
WP_086010216.1|1595154_1595640_+|lysis	lysis protein	lysis	Q56118	Enterobacteria_phage	80.4	1.1e-58
WP_000371784.1|1595850_1596384_+	DUF1441 family protein	NA	A0A291AWV8	Escherichia_phage	48.1	1.0e-33
WP_000989238.1|1596340_1598479_+|terminase	phage terminase large subunit family protein	terminase	A5LH27	Enterobacteria_phage	72.6	6.9e-291
WP_000196190.1|1598475_1598682_+	hypothetical protein	NA	A0A1W6JT66	Pseudomonas_phage	53.3	2.9e-05
WP_001009205.1|1598678_1600226_+|portal	phage portal protein	portal	A0A291AWU2	Escherichia_phage	63.8	1.1e-176
WP_077906133.1|1600149_1602228_+|protease	Clp protease ClpP	protease	A0A291AWT6	Escherichia_phage	69.3	2.4e-264
WP_001107908.1|1602318_1602642_+	DUF2190 family protein	NA	K7PLV6	Enterobacteria_phage	61.3	7.7e-29
WP_000774239.1|1602634_1602934_+	ATP-binding protein	NA	K7PH43	Enterobacteria_phage	45.1	4.5e-15
WP_000453192.1|1602914_1603481_+|tail	phage tail protein	tail	Q9G063	Phage_Gifsy-2	95.7	2.1e-13
WP_000196703.1|1603477_1603879_+|tail	tail protein	tail	K7PHM6	Enterobacterial_phage	60.9	2.0e-42
WP_000132755.1|1603890_1604640_+|tail	phage tail protein	tail	A0A291AWU6	Escherichia_phage	68.6	3.7e-90
WP_000478858.1|1604685_1605084_+|tail	phage minor tail protein G	tail	K7PLV8	Enterobacteria_phage	56.8	8.6e-30
WP_010989009.1|1605080_1605410_+|tail	phage tail assembly protein T	tail	A5LH37	Enterobacteria_phage	50.9	5.0e-23
WP_065305406.1|1605489_1608477_+|tail	phage tail tape measure protein	tail	A0A291AWX1	Escherichia_phage	62.0	2.5e-262
WP_000978295.1|1608473_1608806_+|tail	phage tail protein	tail	A5LH39	Enterobacteria_phage	61.5	2.6e-35
WP_000410972.1|1608904_1609429_+	outer membrane beta-barrel protein	NA	A0A1B0VBR9	Salmonella_phage	35.3	1.8e-19
WP_000877926.1|1609518_1610052_-	superoxide dismutase [Cu-Zn]	NA	Q9MC02	Salmonella_phage	54.0	1.8e-46
WP_001152416.1|1610141_1610837_+|tail	phage minor tail protein L	tail	A0A0K2FJ01	Enterobacteria_phage	66.7	1.0e-89
WP_000606356.1|1610846_1611584_+|tail	phage tail protein	tail	A0A0P0ZE89	Stx2-converting_phage	75.6	5.2e-113
WP_020867839.1|1611481_1612186_+|tail	tail assembly protein	tail	A5LH42	Enterobacteria_phage	62.6	2.0e-66
WP_000033414.1|1612257_1615608_+	host specificity protein J	NA	A0A0K2FI38	Escherichia_phage	69.3	0.0e+00
WP_000178849.1|1615646_1615889_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001532020.1|1615942_1618318_+|tail	tail protein	tail	A0A0K2FIZ6	Escherichia_phage	64.9	1.9e-87
WP_031618324.1|1618818_1619139_+	hypothetical protein	NA	A0A0M4QWS3	Salmonella_phage	79.2	4.9e-44
WP_000143158.1|1619128_1619710_+|tail	tail fiber assembly protein	tail	A0A0M4RTP2	Salmonella_phage	87.4	1.8e-92
WP_000161705.1|1619906_1620629_-	SPI-1 type III secretion system guanine nucleotide exchange factor SopE	NA	NA	NA	NA	NA
WP_000388788.1|1620841_1621060_+	helix-turn-helix domain-containing protein	NA	S4TTF2	Salmonella_phage	89.7	1.7e-24
WP_000343758.1|1621279_1622500_+|transposase	ISL3 family transposase	transposase	NA	NA	NA	NA
WP_071531551.1|1622496_1622994_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000193784.1|1623428_1626041_+	aminopeptidase N	NA	A0A0P0IY26	Acinetobacter_phage	22.6	6.3e-20
WP_000291723.1|1626248_1627259_+	quinone-dependent dihydroorotate dehydrogenase	NA	NA	NA	NA	NA
WP_001220671.1|1627424_1627967_+	cell division protein ZapC	NA	NA	NA	NA	NA
WP_000224069.1|1627963_1629073_-	MOSC domain-containing protein	NA	NA	NA	NA	NA
WP_001086485.1|1629171_1631280_+	bifunctional 23S rRNA (guanine(2069)-N(7))-methyltransferase RlmK/23S rRNA (guanine(2445)-N(2))-methyltransferase RlmL	NA	NA	NA	NA	NA
WP_000053044.1|1631292_1633200_+	ABC transporter ATP-binding protein	NA	A0A2K9L3Z8	Tupanvirus	29.8	2.4e-53
1631404:1631423	attR	AACGGCGCCGGGAAATCCAC	NA	NA	NA	NA
WP_000433414.1|1634473_1636114_+	intermembrane transport protein PqiB	NA	NA	NA	NA	NA
WP_000759136.1|1636110_1636674_+	membrane integrity-associated transporter subunit PqiC	NA	NA	NA	NA	NA
WP_001537784.1|1636929_1637097_+	ribosome modulation factor	NA	NA	NA	NA	NA
WP_000227928.1|1637196_1637715_-	bifunctional 3-hydroxydecanoyl-ACP dehydratase/trans-2-decenoyl-ACP isomerase	NA	NA	NA	NA	NA
WP_000156454.1|1637783_1639544_-|protease	Lon protease family protein	protease	NA	NA	NA	NA
WP_000877172.1|1639729_1640182_+	macrodomain Ter protein MatP	NA	NA	NA	NA	NA
WP_001674965.1|1640253_1641306_-	porin OmpA	NA	NA	NA	NA	NA
WP_000288732.1|1641662_1642172_-	cell division inhibitor SulA	NA	NA	NA	NA	NA
WP_001202375.1|1642388_1642994_+	TfoX/Sxy family DNA transformation protein	NA	NA	NA	NA	NA
WP_000950880.1|1642980_1645134_-	TIGR01666 family membrane protein	NA	NA	NA	NA	NA
WP_001261222.1|1645152_1645599_-	YccF domain-containing protein	NA	NA	NA	NA	NA
WP_000420505.1|1645722_1647777_+	DNA helicase IV	NA	A7KV33	Bacillus_phage	27.6	8.5e-20
WP_000424187.1|1647812_1648271_-	methylglyoxal synthase	NA	NA	NA	NA	NA
WP_000847716.1|1648365_1649028_-	DUF2057 family protein	NA	NA	NA	NA	NA
WP_001537782.1|1649201_1649615_+	CoA-binding protein	NA	NA	NA	NA	NA
WP_000561983.1|1649659_1649977_-	heat shock protein HspQ	NA	NA	NA	NA	NA
WP_000140480.1|1650034_1651246_-	23S rRNA (cytosine(1962)-C(5))-methyltransferase RlmI	NA	NA	NA	NA	NA
WP_000859416.1|1651460_1652009_+	YbhB/YbcL family Raf kinase inhibitor-like protein	NA	NA	NA	NA	NA
WP_000548082.1|1652034_1652814_+	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_000072884.1|1652862_1653144_+	acylphosphatase	NA	NA	NA	NA	NA
WP_000904446.1|1653140_1653470_-	sulfurtransferase TusE	NA	NA	NA	NA	NA
WP_000374046.1|1653556_1654216_-|protease	FtsH protease modulator YccA	protease	A0A2H4JFM9	uncultured_Caudovirales_phage	52.4	2.7e-44
WP_000938191.1|1654836_1655517_-|protease	type III secretion system effector protease PipA	protease	Q9MBM0	Phage_Gifsy-2	70.6	8.3e-81
>prophage 5
NC_021812	Salmonella enterica subsp. enterica serovar Heidelberg str. CFSAN002069, complete sequence	4783943	2554640	2565241	4783943		Morganella_phage(25.0%)	12	NA	NA
WP_001157304.1|2554640_2556071_-	DNA cytosine methyltransferase	NA	E5E3X6	Burkholderia_phage	57.4	7.8e-105
WP_000377037.1|2556144_2556840_-	phosphohydrolase	NA	A0A1D6Y7U0	Golden_Marseillevirus	27.1	1.6e-07
WP_000107434.1|2556919_2557231_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001080662.1|2557881_2559078_+	porin OmpS1	NA	Q1MVN1	Enterobacteria_phage	56.1	5.1e-110
WP_024131109.1|2559335_2559524_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000208509.1|2559534_2559747_-	cold-shock protein	NA	A0A1W6JNX5	Morganella_phage	70.0	3.9e-21
WP_000457664.1|2560201_2561470_-	Y-family DNA polymerase	NA	I6RSM4	Salmonella_phage	92.2	1.2e-226
WP_000394197.1|2561472_2561892_-	translesion error-prone DNA polymerase V autoproteolytic subunit	NA	A0A1W6JNS2	Morganella_phage	60.5	8.5e-36
WP_000500831.1|2562018_2562180_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000598921.1|2562660_2563458_+	DgsA anti-repressor MtfA	NA	NA	NA	NA	NA
WP_001683376.1|2563829_2564120_+	DUF4102 domain-containing protein	NA	B7SYF8	Stenotrophomonas_phage	52.6	2.1e-09
WP_001219015.1|2564767_2565241_+	peptidase	NA	A0A0F6TJ61	Escherichia_coli_O157_typing_phage	77.6	7.1e-39
>prophage 6
NC_021812	Salmonella enterica subsp. enterica serovar Heidelberg str. CFSAN002069, complete sequence	4783943	2651236	2661742	4783943		Enterobacteria_phage(37.5%)	10	NA	NA
WP_000126349.1|2651236_2652550_-	lipopolysaccharide biosynthesis protein RfbH	NA	H8ZJ36	Ostreococcus_tauri_virus	35.1	7.0e-52
WP_000565905.1|2652576_2653656_-	CDP-glucose 4,6-dehydratase	NA	A0A222YY99	Synechococcus_phage	24.1	6.6e-16
WP_000648784.1|2653660_2654434_-	glucose-1-phosphate cytidylyltransferase	NA	NA	NA	NA	NA
WP_000018226.1|2654430_2655423_-	CDP-6-deoxy-delta-3,4-glucoseen reductase	NA	NA	NA	NA	NA
WP_000973708.1|2655428_2655980_-	dTDP-4-dehydrorhamnose 3,5-epimerase	NA	I7HJC4	Enterobacteria_phage	58.0	2.2e-52
WP_000857529.1|2655980_2656859_-	glucose-1-phosphate thymidylyltransferase RfbA	NA	I7I009	Enterobacteria_phage	65.5	9.3e-109
WP_001023662.1|2656906_2657806_-	dTDP-4-dehydrorhamnose reductase	NA	A0A291LA50	Escherichia_phage	36.3	1.4e-30
WP_000697840.1|2657805_2658891_-	dTDP-glucose 4,6-dehydratase	NA	I7HTA3	Enterobacteria_phage	53.9	1.2e-102
WP_000981469.1|2659267_2660161_-	GalU regulator GalF	NA	A0A127AW70	Bacillus_phage	42.2	4.8e-44
WP_001111845.1|2660338_2661742_-	colanic acid biosynthesis protein WcaM	NA	A0A291LBB9	Klebsiella_phage	26.5	6.8e-21
>prophage 7
NC_021812	Salmonella enterica subsp. enterica serovar Heidelberg str. CFSAN002069, complete sequence	4783943	2730018	2739189	4783943	tRNA	Enterobacteria_phage(66.67%)	10	NA	NA
WP_000195330.1|2730018_2732052_+|tRNA	methionine--tRNA ligase	tRNA	A0A1V0SDF2	Indivirus	27.6	1.0e-54
WP_000703137.1|2732292_2732751_+	YehR family lipoprotein	NA	Q9EYF5	Enterobacteria_phage	72.5	8.4e-53
WP_001197951.1|2732922_2733453_+	YehR family lipoprotein	NA	NA	NA	NA	NA
WP_000950413.1|2733509_2733977_-	DUF1456 family protein	NA	Q9EYF4	Enterobacteria_phage	90.3	3.9e-74
WP_000598637.1|2734023_2734743_-	two-component system response regulator BtsR	NA	NA	NA	NA	NA
WP_000272850.1|2734739_2736425_-	sensor histidine kinase	NA	Q9EYF3	Enterobacteria_phage	91.3	4.8e-279
WP_001240417.1|2736647_2737379_+	HTH-type transcriptional regulator MlrA	NA	Q9EYF2	Enterobacteria_phage	87.9	4.5e-101
WP_001261696.1|2737438_2737546_+	protein YohO	NA	NA	NA	NA	NA
WP_000824857.1|2737526_2738258_-	ABC transporter permease	NA	NA	NA	NA	NA
WP_000569165.1|2738241_2739189_-	ABC transporter ATP-binding protein	NA	F2Y1V5	Organic_Lake_phycodnavirus	27.8	3.7e-10
>prophage 8
NC_021812	Salmonella enterica subsp. enterica serovar Heidelberg str. CFSAN002069, complete sequence	4783943	2758596	2824982	4783943	tail,holin,lysis	Salmonella_phage(25.0%)	58	NA	NA
WP_000989295.1|2758596_2759292_+|lysis	CidB/LrgB family autolysis modulator	lysis	NA	NA	NA	NA
WP_000553526.1|2759445_2760330_+	cytidine deaminase	NA	NA	NA	NA	NA
WP_000920081.1|2760506_2761226_+	outer membrane permeability protein SanA	NA	NA	NA	NA	NA
WP_000605187.1|2761222_2761468_+	DUF2542 family protein	NA	NA	NA	NA	NA
WP_001136394.1|2761672_2762914_+	NAD(P)-dependent oxidoreductase	NA	NA	NA	NA	NA
WP_000956097.1|2762907_2764143_+	NAD-dependent dihydropyrimidine dehydrogenase subunit PreA	NA	NA	NA	NA	NA
WP_001275101.1|2764217_2765228_-	galactose/methyl galactoside ABC transporter permease MglC	NA	NA	NA	NA	NA
WP_000535907.1|2765243_2766764_-	galactose/methyl galactoside ABC transporter ATP-binding protein MglA	NA	F2Y2R6	Organic_Lake_phycodnavirus	31.9	1.0e-09
WP_001036943.1|2766897_2767896_-	galactose/glucose ABC transporter substrate-binding protein MglB	NA	NA	NA	NA	NA
WP_001520237.1|2769565_2770708_-	DUF418 family protein	NA	NA	NA	NA	NA
WP_001139611.1|2770722_2771391_-	GTP cyclohydrolase I FolE	NA	M1Q6X8	Cellulophaga_phage	56.3	4.1e-56
WP_000425488.1|2771720_2772578_+	S-formylglutathione hydrolase	NA	NA	NA	NA	NA
WP_000876817.1|2772566_2772956_-	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_001531764.1|2772960_2774328_-	L-serine ammonia-lyase	NA	NA	NA	NA	NA
WP_000022910.1|2774544_2775432_+	phosphoserine phosphatase SerB	NA	NA	NA	NA	NA
WP_000023807.1|2775464_2776787_+	MFS transporter	NA	NA	NA	NA	NA
WP_000488244.1|2776830_2778822_-	catecholate siderophore receptor CirA	NA	A0A0P0I887	Acinetobacter_phage	37.9	6.7e-14
WP_000535000.1|2779167_2780637_-	lysine-specific permease	NA	NA	NA	NA	NA
WP_000548316.1|2780826_2781690_-	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_000137966.1|2781810_2782860_+	YeiH family protein	NA	NA	NA	NA	NA
WP_000873906.1|2782938_2783796_+	deoxyribonuclease IV	NA	A0A1V0SBL9	Catovirus	28.5	1.3e-22
WP_000854395.1|2783860_2785549_-	PTS fructose transporter subunit IIBC	NA	NA	NA	NA	NA
WP_000091249.1|2785565_2786504_-	1-phosphofructokinase	NA	NA	NA	NA	NA
WP_000487287.1|2786503_2787634_-	fused PTS fructose transporter subunit IIA/HPr protein	NA	NA	NA	NA	NA
WP_000551937.1|2788001_2789183_+	sugar efflux transporter SetB	NA	NA	NA	NA	NA
WP_001213897.1|2789246_2789912_-	membrane protein	NA	NA	NA	NA	NA
WP_001519564.1|2789913_2790036_-	membrane protein	NA	NA	NA	NA	NA
WP_001523448.1|2790423_2790678_-	YkgJ family cysteine cluster protein	NA	NA	NA	NA	NA
WP_001136822.1|2791001_2791574_+	elongation factor P-like protein YeiP	NA	NA	NA	NA	NA
WP_000169346.1|2791786_2792773_+	GTP-binding protein	NA	NA	NA	NA	NA
WP_000178095.1|2792802_2793522_+	phosphatase PAP2 family protein	NA	NA	NA	NA	NA
WP_000241015.1|2793935_2794508_+	bifunctional murein DD-endopeptidase/murein LD-carboxypeptidase	NA	A0A1V0DZX6	Clostridioides_phage	38.9	8.1e-13
WP_000957755.1|2794833_2796390_+	cyclic di-GMP phosphodiesterase	NA	NA	NA	NA	NA
WP_000561742.1|2796496_2798302_+	ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_000501626.1|2798311_2799406_+	microcin C ABC transporter permease YejB	NA	NA	NA	NA	NA
WP_001137747.1|2799405_2800431_+	ABC transporter permease	NA	NA	NA	NA	NA
WP_000222013.1|2800432_2802022_+	microcin C ABC transporter ATP-binding protein YejF	NA	G9BWD6	Planktothrix_phage	32.1	7.2e-19
WP_001094639.1|2802025_2802370_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000213347.1|2802760_2803951_-	Bcr/CflA family multidrug efflux MFS transporter	NA	S4TR35	Salmonella_phage	22.2	2.4e-19
WP_001234834.1|2803978_2804674_-	16S rRNA pseudouridine(516) synthase RsuA	NA	NA	NA	NA	NA
WP_000578130.1|2804825_2806586_+	DEAD/DEAH box helicase	NA	M4Q3N1	Vibrio_phage	41.8	1.4e-100
WP_000494192.1|2806710_2806995_+	50S ribosomal protein L25	NA	NA	NA	NA	NA
WP_000033443.1|2807103_2807724_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000050806.1|2807751_2808759_-	nucleoid-associated protein YejK	NA	A0A1V0E8C0	Vibrio_phage	48.3	4.5e-83
WP_001135904.1|2808938_2809166_+	YejL family protein	NA	NA	NA	NA	NA
WP_000256150.1|2809197_2810958_+	cardiolipin transport protein PbgA	NA	NA	NA	NA	NA
WP_000806401.1|2811238_2811742_-	LexA family transcriptional regulator	NA	Q1MVE7	Enterobacteria_phage	71.3	9.5e-50
WP_000884778.1|2811769_2812060_+	DinI family protein	NA	S4TND2	Salmonella_phage	83.3	4.7e-25
WP_000022213.1|2814283_2814727_-|tail	tail fiber assembly protein	tail	A0A0F7LDZ0	Escherichia_phage	43.9	1.4e-28
WP_001215679.1|2815104_2815632_-|tail	tail fiber assembly protein	tail	A0A1S6KZZ1	Salmonella_phage	31.3	3.1e-11
WP_000554739.1|2815634_2816876_-	hypothetical protein	NA	Q8HAB4	Salmonella_phage	95.3	1.0e-52
WP_001120499.1|2817468_2817798_-|holin	phage holin, lambda family	holin	Q8SBE1	Shigella_phage	94.6	3.9e-36
WP_000894638.1|2818094_2819426_+	NTPase	NA	R9TRQ8	Vibrio_phage	28.5	4.6e-19
WP_010989045.1|2819454_2819823_-	antitermination protein Q	NA	A5LH77	Enterobacteria_phage	81.7	7.4e-52
WP_001202279.1|2819837_2820827_-	DUF968 domain-containing protein	NA	A0A1C9IHZ5	Salmonella_phage	97.3	6.0e-189
WP_001115840.1|2821155_2823522_-	SPI-2 type III secretion system effector E3 ubiquitin transferase SspH2	NA	Q9MBL9	Phage_Gifsy-2	88.7	2.9e-72
WP_001113462.1|2823690_2823894_-|tail	tail protein	tail	NA	NA	NA	NA
WP_000624225.1|2824190_2824982_-|tail	tail protein	tail	Q1MVL8	Enterobacteria_phage	31.6	1.7e-48
>prophage 1
NC_021813	Salmonella enterica subsp. enterica serovar Heidelberg str. CFSAN002069 plasmid pCFSAN002069_01, complete sequence	110363	47080	88329	110363	transposase,integrase	Stx2-converting_phage(16.67%)	47	77139:77168	97020:97049
WP_000078704.1|47080_48019_-|transposase	Rpn family recombination-promoting nuclease/putative transposase	transposase	Q2A0A7	Sodalis_phage	53.4	3.6e-66
WP_001247862.1|48083_48350_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000218863.1|48443_48878_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000117611.1|49606_50107_-	antirestriction protein ArdA	NA	G9FHQ1	Rhodococcus_virus	27.3	2.4e-05
WP_000977997.1|50568_51165_-	hypothetical protein	NA	A0A0N7KZV3	Escherichia_phage	55.3	3.4e-14
WP_001276270.1|51161_51881_-	plasmid SOS inhibition protein A	NA	NA	NA	NA	NA
WP_001387500.1|51877_52312_-	conjugation system SOS inhibitor PsiB	NA	NA	NA	NA	NA
WP_001145485.1|52366_54325_-	ParB/RepB/Spo0J family partition protein	NA	G8DH78	Emiliania_huxleyi_virus	29.4	7.3e-21
WP_000006020.1|54383_54617_-	DUF905 domain-containing protein	NA	A0A096XUX0	Cronobacter_phage	53.2	1.7e-06
WP_001276120.1|54674_55202_-	single-stranded DNA-binding protein	NA	I3PGW4	Xanthomonas_phage	73.5	1.6e-47
WP_001434357.1|55585_55900_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001027495.1|55970_56162_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000271705.1|56158_56581_-	DUF1380 family protein	NA	NA	NA	NA	NA
WP_001198939.1|56627_57053_-	antirestriction protein	NA	NA	NA	NA	NA
WP_001668483.1|57025_57598_-	YubH family protein	NA	NA	NA	NA	NA
WP_000274500.1|58292_58727_-	DUF1380 domain-containing protein	NA	NA	NA	NA	NA
WP_001104881.1|58740_58962_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000086147.1|58962_59646_-	DNA methylase	NA	A0A2I7RE86	Vibrio_phage	36.4	1.1e-29
WP_001348079.1|60030_60933_-	DUF1281 domain-containing protein	NA	NA	NA	NA	NA
WP_000272884.1|61613_62006_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001217836.1|62009_62984_-	hypothetical protein	NA	A0A222YXF2	Escherichia_phage	45.1	3.1e-73
WP_001394937.1|63222_63426_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000312331.1|63596_64229_-	ParA family protein	NA	A0A0K1LMB9	Rhodobacter_phage	39.1	1.4e-29
WP_001164192.1|64812_65598_-|integrase	phage integrase family protein	integrase	I3WFA4	Macacine_betaherpesvirus	96.5	4.0e-55
WP_000465034.1|65599_66013_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000343102.1|66581_66842_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000194555.1|66838_67429_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000142424.1|67446_67794_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000762580.1|67912_68260_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001283356.1|68277_70158_-	colicin	NA	NA	NA	NA	NA
WP_001132019.1|70436_71783_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000517689.1|72136_72739_+	hypothetical protein	NA	NA	NA	NA	NA
WP_041031003.1|72794_73271_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001339397.1|73307_73985_+	IS66 family insertion sequence hypothetical protein	NA	A0A0P0ZCV4	Stx2-converting_phage	46.0	3.3e-21
WP_000624622.1|73984_74332_+	IS66 family insertion sequence element accessory protein TnpB	NA	A0A0P0ZDM8	Stx2-converting_phage	76.6	2.6e-46
WP_000381395.1|74351_75923_+|transposase	IS66 family transposase	transposase	A0A0P0ZEB3	Stx2-converting_phage	58.7	9.9e-170
WP_000627831.1|75995_76262_+	hypothetical protein	NA	NA	NA	NA	NA
WP_031610367.1|76738_77155_-	hypothetical protein	NA	NA	NA	NA	NA
77139:77168	attL	CTCAGAAAACGGAAAATAAAGCACGCTAAG	NA	NA	NA	NA
WP_001138064.1|77163_80130_-|transposase	Tn3-like element TnAs3 family transposase	transposase	A0A1B0V7H9	Salmonella_phage	73.6	0.0e+00
WP_000147566.1|80132_80693_-	recombinase family protein	NA	A0A1B0V7I5	Salmonella_phage	87.0	2.1e-50
WP_000454193.1|80818_81169_-	DUF3330 domain-containing protein	NA	NA	NA	NA	NA
WP_000845048.1|81371_82385_-|integrase	class 1 integron integrase IntI1	integrase	A0A1P8DJJ6	Virus_Rctr41k	45.5	1.0e-71
WP_001206316.1|82533_83325_+	ANT(3'')-Ia family aminoglycoside nucleotidyltransferase AadA1	NA	NA	NA	NA	NA
WP_020837048.1|83491_84391_+	aminoglycoside N-acetyltransferase AAC(3)-VIa	NA	NA	NA	NA	NA
WP_000535481.1|84597_84918_+	co-chaperone GroES	NA	A0A221S4G8	uncultured_virus	47.9	1.0e-17
WP_000719078.1|84973_86611_+	chaperonin GroEL	NA	A0A240F779	uncultured_virus	60.6	1.8e-174
WP_001137772.1|86799_88329_+|transposase	IS91 family transposase	transposase	NA	NA	NA	NA
97020:97049	attR	CTTAGCGTGCTTTATTTTCCGTTTTCTGAG	NA	NA	NA	NA
