The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
NC_021486	Streptococcus agalactiae ILRI005, complete genome	2109759	40492	48568	2109759		Synechococcus_phage(33.33%)	7	NA	NA
WP_016480155.1|40492_41947_+	amidophosphoribosyltransferase	NA	A0A0M3SGR2	Mollivirus	32.9	8.3e-54
WP_016480156.1|41974_42997_+	phosphoribosylformylglycinamidine cyclo-ligase	NA	R9TMC7	Synechococcus_phage	41.7	5.8e-62
WP_016480157.1|43164_43713_+	phosphoribosylglycinamide formyltransferase	NA	M4QRX9	Synechococcus_phage	34.4	6.8e-25
WP_016480158.1|43735_44488_+	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_016480159.1|44507_46055_+	bifunctional phosphoribosylaminoimidazolecarboxamide formyltransferase/IMP cyclohydrolase	NA	Q58MG4	Prochlorococcus_phage	48.9	4.3e-77
WP_001045908.1|46247_47147_+	peptidoglycan DD-metalloendopeptidase family protein	NA	A0A221J6U0	Arthrobacter_phage	45.9	4.1e-19
WP_016480160.1|47293_48568_+	LysM peptidoglycan-binding domain-containing protein	NA	A0A2D1GNZ3	Streptomyces_phage	40.5	1.6e-05
>prophage 2
NC_021486	Streptococcus agalactiae ILRI005, complete genome	2109759	584351	590913	2109759	transposase,holin	Streptococcus_phage(87.5%)	12	NA	NA
WP_016480195.1|584351_584627_+|transposase	transposase	transposase	A0A1P8CWP5	Bacillus_phage	43.5	1.0e-13
WP_016480474.1|585245_585539_+	hypothetical protein	NA	J7KH30	Streptococcus_phage	91.5	1.2e-39
WP_016480475.1|585541_585769_+|holin	phage holin	holin	A7J2B3	Streptococcus_phage	90.7	3.0e-27
WP_016480477.1|585896_587231_+	N-acetylmuramoyl-L-alanine amidase	NA	Q5MY96	Streptococcus_phage	91.2	7.9e-245
WP_000634506.1|587596_588109_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016480478.1|588268_588469_+	CsbD family protein	NA	J7KJ36	Streptococcus_phage	89.4	4.3e-22
WP_016480479.1|588640_588871_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016480480.1|588896_589322_+	hypothetical protein	NA	C5IUL6	Streptococcus_phage	55.5	1.9e-35
WP_041165659.1|589381_589738_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016480482.1|589670_590213_-	hypothetical protein	NA	A3F671	Streptococcus_phage	89.7	3.4e-77
WP_016480483.1|590251_590491_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016480484.1|590706_590913_+	hypothetical protein	NA	J7KBZ4	Streptococcus_phage	79.7	2.1e-19
>prophage 3
NC_021486	Streptococcus agalactiae ILRI005, complete genome	2109759	615037	699737	2109759	transposase,holin,tail,capsid,terminase,head,integrase	Streptococcus_phage(58.67%)	107	618731:618747	628521:628537
WP_016480499.1|615037_616405_+	23S rRNA (uracil(1939)-C(5))-methyltransferase RlmD	NA	F5CA72	Streptococcus_phi-m46.1-like_phage	72.7	2.6e-190
WP_041165661.1|616653_616848_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016480500.1|616878_617643_+	DNA (cytosine-5-)-methyltransferase	NA	Q83VT0	Escherichia_phage	49.0	1.5e-62
WP_144312746.1|617660_618805_-|transposase	IS3 family transposase	transposase	A0A1P8CWP5	Bacillus_phage	39.5	3.4e-10
618731:618747	attL	CTGAGTTTTTCCAGTTT	NA	NA	NA	NA
WP_001872860.1|619283_619763_+	sigma-70 family RNA polymerase sigma factor	NA	NA	NA	NA	NA
WP_016480502.1|619942_621097_-|integrase	site-specific integrase	integrase	Q938N9	Temperate_phage	96.4	1.0e-200
WP_016480503.1|621216_621483_-	hypothetical protein	NA	M1PF81	Streptococcus_phage	86.7	4.7e-08
WP_016480504.1|621550_622108_-	hypothetical protein	NA	Q0H269	Geobacillus_phage	30.2	1.6e-18
WP_016480505.1|622109_622907_-	XRE family transcriptional regulator	NA	A0A1S5S8S8	Streptococcus_phage	74.1	4.8e-64
WP_016480506.1|623270_623450_+	hypothetical protein	NA	M1Q149	Streptococcus_phage	46.8	7.3e-05
WP_016480507.1|623429_623627_-	hypothetical protein	NA	M1PRU3	Streptococcus_phage	63.1	4.3e-14
WP_001104149.1|623685_623844_+	hypothetical protein	NA	J7KH24	Streptococcus_phage	92.3	2.2e-21
WP_016480508.1|623874_624063_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016480509.1|624045_624852_-	DUF4393 domain-containing protein	NA	A0A1S5SD60	Streptococcus_phage	36.5	1.9e-28
WP_001166512.1|624903_625092_+	helix-turn-helix transcriptional regulator	NA	A0A0B5A7F0	Streptococcus_phage	65.0	1.8e-14
WP_016480510.1|625139_626051_+	hypothetical protein	NA	J7KDG2	Streptococcus_phage	85.1	3.1e-123
WP_016480511.1|626043_626553_+	ORF6C domain-containing protein	NA	J7KJY1	Streptococcus_phage	98.8	3.9e-83
WP_016480512.1|626563_626749_+	hypothetical protein	NA	A0A141E0V7	Streptococcus_phage	55.4	1.0e-09
WP_016480513.1|626726_626966_-	hypothetical protein	NA	A0A1X9I5M1	Streptococcus_phage	81.0	3.1e-35
WP_016480514.1|627014_627206_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016480515.1|627233_627410_-	hypothetical protein	NA	NA	NA	NA	NA
WP_079269280.1|627619_627781_+	helix-turn-helix transcriptional regulator	NA	J7KH19	Streptococcus_phage	90.6	5.6e-20
WP_016480517.1|627859_628117_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000214000.1|628411_628591_+	hypothetical protein	NA	A0A1X9I5M8	Streptococcus_phage	65.5	1.2e-12
628521:628537	attR	AAACTGGAAAAACTCAG	NA	NA	NA	NA
WP_000370473.1|628762_629035_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000568479.1|629024_629405_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001074391.1|629460_629907_+	hypothetical protein	NA	G4KNN0	Staphylococcus_phage	32.7	5.9e-11
WP_016480518.1|630023_630707_+	DnaD domain protein	NA	A0A1P8BL54	Lactococcus_phage	68.6	1.8e-38
WP_016480519.1|630693_631476_+	ATP-binding protein	NA	A0A097PAQ0	Streptococcus_pyogenes_phage	90.4	7.4e-134
WP_016480520.1|631466_631610_+	hypothetical protein	NA	J7KBQ4	Streptococcus_phage	91.3	4.3e-16
WP_124759159.1|631662_632807_-|transposase	IS3 family transposase	transposase	A0A1P8CWP5	Bacillus_phage	39.5	3.4e-10
WP_041165743.1|632877_633141_+	hypothetical protein	NA	J7KJY6	Streptococcus_phage	59.5	3.1e-20
WP_016480522.1|633127_633382_+	hypothetical protein	NA	J7KK18	Streptococcus_phage	82.1	2.2e-34
WP_016480524.1|633546_634029_+	siphovirus Gp157 family protein	NA	A0A1P8VVS5	Streptococcus_phage	67.5	5.3e-50
WP_016480525.1|634029_634704_+	ERF family protein	NA	Q938M8	Temperate_phage	84.8	2.8e-97
WP_016480526.1|634696_635113_+	single-stranded DNA-binding protein	NA	M1NRI2	Streptococcus_phage	80.4	2.5e-56
WP_041165663.1|635115_635319_+	hypothetical protein	NA	J7KIX6	Streptococcus_phage	87.3	2.3e-23
WP_016480527.1|635308_635785_+	RusA family crossover junction endodeoxyribonuclease	NA	J7KBT1	Streptococcus_phage	99.1	2.5e-60
WP_041165664.1|635774_636122_+	hypothetical protein	NA	J7KK12	Streptococcus_phage	82.6	7.7e-51
WP_041165665.1|636133_636406_+	DUF1599 domain-containing protein	NA	J7KBY0	Streptococcus_phage	74.2	2.4e-31
WP_016480529.1|636405_636768_+	hypothetical protein	NA	F8HGR8	Streptococcus_phage	49.4	6.2e-19
WP_041165744.1|636770_637040_+	membrane protein	NA	A7J287	Streptococcus_phage	60.7	9.3e-20
WP_173390332.1|637041_637206_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016480531.1|637195_637720_+	DUF1642 domain-containing protein	NA	A0A097PAV5	Streptococcus_pyogenes_phage	41.0	4.6e-23
WP_016480532.1|637915_638149_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000142570.1|638490_638925_+	ArpU family transcriptional regulator	NA	J7KDQ1	Streptococcus_phage	95.1	6.5e-71
WP_016480534.1|639597_639981_-	type II toxin-antitoxin system HicB family antitoxin	NA	I3NLB2	Bifidobacterium_phage	40.5	4.0e-16
WP_001138286.1|640024_640213_-	type II toxin-antitoxin system HicA family toxin	NA	F0PIL1	Enterococcus_phage	44.4	7.7e-05
WP_079269281.1|640315_640807_+|terminase	terminase small subunit	terminase	U6E976	Streptococcus_phage	51.6	1.1e-34
WP_016480536.1|640796_642032_+|terminase	PBSX family phage terminase large subunit	terminase	C9W9H4	Streptococcus_virus	71.8	8.0e-175
WP_144312747.1|643253_644359_-|transposase	IS3 family transposase	transposase	A0A2I7SC85	Paenibacillus_phage	51.3	6.3e-70
WP_016480540.1|646005_646977_+|capsid	minor capsid protein	capsid	U6E9F1	Streptococcus_phage	37.1	3.6e-53
WP_016480541.1|647194_647773_+	DUF4355 domain-containing protein	NA	A0A0P0IXG5	Lactobacillus_phage	36.5	1.1e-06
WP_016480542.1|647782_648163_+	hypothetical protein	NA	A0A286QPB3	Streptococcus_phage	37.8	5.6e-10
WP_016480543.1|648165_649218_+|capsid	major capsid protein	capsid	A0A286QR01	Streptococcus_phage	58.9	6.5e-109
WP_016480544.1|649230_649485_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016480545.1|649500_649854_+|head,tail	phage head-tail connector protein	head,tail	A0A2H4J002	uncultured_Caudovirales_phage	53.8	1.2e-27
WP_016480546.1|649850_650150_+	hypothetical protein	NA	A0A286QRJ8	Streptococcus_phage	36.9	3.5e-07
WP_016480547.1|650142_650526_+	hypothetical protein	NA	B5SP35	Lactococcus_phage	43.7	1.2e-17
WP_016480548.1|650522_650909_+	DUF3168 domain-containing protein	NA	W6LLG8	Streptococcus_phage	47.7	8.4e-30
WP_016480549.1|650917_651451_+|tail	phage major tail protein, TP901-1 family	tail	L0P2Q8	Streptococcus_phage	58.7	3.0e-46
WP_016480550.1|651523_651883_+	hypothetical protein	NA	O34069	Streptococcus_phage	47.9	7.1e-23
WP_025194532.1|651984_652263_+	hypothetical protein	NA	A0A0S2MYH1	Enterococcus_phage	41.0	7.7e-09
WP_016480551.1|652255_654904_+|tail	phage tail tape measure protein	tail	Q9G097	Lactococcus_phage	54.9	5.3e-107
WP_016480552.1|654904_656479_+|tail	phage tail family protein	tail	J7KH53	Streptococcus_phage	78.1	8.5e-238
WP_016480554.1|660086_660854_+	collagen-like protein	NA	Q938K0	Temperate_phage	75.0	4.7e-16
WP_016480555.1|660855_661440_+	hypothetical protein	NA	A3F658	Streptococcus_phage	34.5	8.8e-31
WP_016480556.1|661449_663426_+	gp58-like family protein	NA	Q938J9	Temperate_phage	57.1	1.1e-114
WP_016480557.1|663439_663598_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016480558.1|663600_664221_+	DUF1366 domain-containing protein	NA	Q938J7	Temperate_phage	81.4	1.2e-70
WP_016480559.1|664231_664534_+	hypothetical protein	NA	J7KH30	Streptococcus_phage	91.3	4.5e-39
WP_016480560.1|664526_664781_+|holin	phage holin	holin	J7KDR1	Streptococcus_phage	84.5	4.5e-32
WP_016480561.1|664908_666252_+	N-acetylmuramoyl-L-alanine amidase	NA	Q5MY96	Streptococcus_phage	92.6	8.3e-250
WP_016480563.1|668527_668863_-	hypothetical protein	NA	A0A1P8VVU1	Streptococcus_phage	63.1	1.1e-30
WP_016480564.1|668875_669100_-	hypothetical protein	NA	J7KBY5	Streptococcus_phage	87.8	8.0e-33
WP_016480565.1|669302_670049_-	phage antirepressor Ant	NA	A0A2P0VG01	Streptococcus_phage	70.9	7.6e-96
WP_016480566.1|670379_670739_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016480567.1|670722_670926_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016480569.1|671066_671255_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001104152.1|671285_671444_-	hypothetical protein	NA	J7KH24	Streptococcus_phage	96.2	6.9e-23
WP_000274022.1|671501_671684_+	DUF1508 domain-containing protein	NA	NA	NA	NA	NA
WP_001113676.1|671803_671947_-	hypothetical protein	NA	Q938N4	Temperate_phage	95.2	1.3e-15
WP_016480571.1|672303_673068_+	helix-turn-helix transcriptional regulator	NA	J7KJ52	Streptococcus_phage	64.9	1.2e-83
WP_016480504.1|673069_673627_+	hypothetical protein	NA	Q0H269	Geobacillus_phage	30.2	1.6e-18
WP_016480572.1|673694_673961_+	hypothetical protein	NA	M1PF81	Streptococcus_phage	86.7	4.7e-08
WP_124759159.1|674851_675996_-|transposase	IS3 family transposase	transposase	A0A1P8CWP5	Bacillus_phage	39.5	3.4e-10
WP_016480574.1|676113_676287_+	Maf family protein	NA	NA	NA	NA	NA
WP_041165668.1|676360_677059_+	noncanonical pyrimidine nucleotidase, YjjG family	NA	NA	NA	NA	NA
WP_016480576.1|677276_677945_+	response regulator transcription factor	NA	NA	NA	NA	NA
WP_016480577.1|677976_678534_+	HAMP domain-containing protein	NA	NA	NA	NA	NA
WP_016480578.1|678539_679064_+	HAMP domain-containing histidine kinase	NA	W8CYF6	Bacillus_phage	33.5	1.3e-22
WP_016480579.1|679472_679778_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016480580.1|679777_680626_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016480581.1|680622_681345_+	3-oxoacyl-ACP reductase FabG	NA	Q06VL0	Trichoplusia_ni_ascovirus	31.7	1.9e-14
WP_000611494.1|681337_681643_+	acyl carrier protein	NA	NA	NA	NA	NA
WP_041165669.1|681626_682103_+	3-hydroxyacyl-ACP dehydratase FabZ	NA	NA	NA	NA	NA
WP_000403525.1|682092_683022_+	ABC transporter ATP-binding protein	NA	A0A2H4PQG7	Staphylococcus_phage	30.6	2.6e-24
WP_016480583.1|683014_683893_+	ABC transporter permease	NA	NA	NA	NA	NA
WP_016480584.1|683889_685893_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016480585.1|685889_686843_+	aminomethyl transferase family protein	NA	NA	NA	NA	NA
WP_041165670.1|686839_689035_+	cylI protein	NA	NA	NA	NA	NA
WP_016480587.1|689039_690251_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001068960.1|690219_690795_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001288728.1|691136_691478_+	hypothetical protein	NA	NA	NA	NA	NA
WP_079269282.1|691511_698228_+	S8 family serine peptidase	NA	A0A217EQY2	Bacillus_phage	32.6	1.0e-13
WP_016480589.1|698411_698579_+	hypothetical protein	NA	NA	NA	NA	NA
WP_144312748.1|698592_699737_-|transposase	IS3 family transposase	transposase	A0A1P8CWP5	Bacillus_phage	39.5	3.4e-10
>prophage 4
NC_021486	Streptococcus agalactiae ILRI005, complete genome	2109759	765300	771564	2109759	transposase,tRNA	Staphylococcus_phage(50.0%)	6	NA	NA
WP_000975997.1|765300_766410_+	bifunctional diaminohydroxyphosphoribosylaminopyrimidine deaminase/5-amino-6-(5-phosphoribosylamino)uracil reductase RibD	NA	A0A1V0SE20	Indivirus	37.2	1.2e-55
WP_016480625.1|766390_767041_+	riboflavin synthase	NA	A0A2H4PQS5	Staphylococcus_phage	40.9	2.3e-35
WP_016480626.1|767058_768210_+	bifunctional 3,4-dihydroxy-2-butanone-4-phosphate synthase/GTP cyclohydrolase II	NA	A0A2H4PQS2	Staphylococcus_phage	50.9	3.1e-104
WP_144312750.1|768223_769368_-|transposase	IS3 family transposase	transposase	A0A1P8CWP5	Bacillus_phage	39.5	3.4e-10
WP_000152414.1|769528_769999_+	6,7-dimethyl-8-ribityllumazine synthase	NA	A0A2H4PQS3	Staphylococcus_phage	52.7	1.3e-40
WP_000070708.1|770073_771564_-|tRNA	lysine--tRNA ligase	tRNA	A0A1V0SAC0	Catovirus	38.5	5.8e-87
>prophage 5
NC_021486	Streptococcus agalactiae ILRI005, complete genome	2109759	1504900	1557307	2109759	transposase,protease,holin,integrase	Paenibacillus_phage(13.33%)	54	1510773:1510832	1551070:1551419
WP_079269295.1|1504900_1505155_-|protease	CPBP family intramembrane metalloprotease	protease	NA	NA	NA	NA
WP_000551533.1|1505883_1506285_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000143288.1|1506521_1507421_-	GTPase Era	NA	NA	NA	NA	NA
WP_000365220.1|1507462_1507861_-	diacylglycerol kinase family protein	NA	NA	NA	NA	NA
WP_001867191.1|1507841_1508339_-	rRNA maturation RNase YbeY	NA	NA	NA	NA	NA
WP_016481054.1|1508733_1509540_-	class I SAM-dependent methyltransferase	NA	NA	NA	NA	NA
WP_144312756.1|1509995_1511142_+|transposase	IS3 family transposase	transposase	A0A1P8CWP5	Bacillus_phage	39.5	3.4e-10
1510773:1510832	attL	CAAAGTTAGCATGTGACACTCTAGAATTAGCTCTTAATAAAAGAAAGGTTGAAGGAACAC	NA	NA	NA	NA
WP_144312757.1|1511190_1512295_+|transposase	IS3 family transposase	transposase	A0A2I7SC85	Paenibacillus_phage	51.3	6.3e-70
WP_016481057.1|1512374_1512821_-	NUDIX domain-containing protein	NA	NA	NA	NA	NA
WP_000349559.1|1513012_1513816_+	DUF4037 domain-containing protein	NA	NA	NA	NA	NA
WP_001158916.1|1513906_1514893_-	PhoH family protein	NA	W8D063	Erwinia_phage	48.5	1.3e-47
WP_016481058.1|1515016_1516789_-	oleate hydratase	NA	NA	NA	NA	NA
WP_001232076.1|1516945_1517161_-	YozE family protein	NA	NA	NA	NA	NA
WP_016481059.1|1517157_1517667_-	peptide-methionine (S)-S-oxide reductase MsrA	NA	NA	NA	NA	NA
WP_016481060.1|1517804_1518659_-	RNA-binding virulence regulatory protein CvfB	NA	NA	NA	NA	NA
WP_016481061.1|1518776_1519334_-	ribosome recycling factor	NA	NA	NA	NA	NA
WP_000433491.1|1519349_1520078_-	UMP kinase	NA	NA	NA	NA	NA
WP_016481062.1|1520198_1520879_-	ABC transporter ATP-binding protein	NA	F2Y1V5	Organic_Lake_phycodnavirus	30.4	3.1e-11
WP_016481063.1|1520865_1521654_-	ABC transporter ATP-binding protein	NA	F2Y1V6	Organic_Lake_phycodnavirus	28.5	2.8e-08
WP_000044261.1|1521641_1522448_-	ABC transporter permease	NA	NA	NA	NA	NA
WP_000281512.1|1522447_1523392_-	ABC transporter permease	NA	NA	NA	NA	NA
WP_016481064.1|1523378_1524995_-	nickel ABC transporter, nickel/metallophore periplasmic binding protein	NA	NA	NA	NA	NA
WP_001085664.1|1525384_1526074_-	50S ribosomal protein L1	NA	NA	NA	NA	NA
WP_001085802.1|1526177_1526603_-	50S ribosomal protein L11	NA	NA	NA	NA	NA
WP_000958259.1|1526813_1528196_-	MFS transporter	NA	NA	NA	NA	NA
WP_016481065.1|1528203_1529418_-	amidohydrolase	NA	NA	NA	NA	NA
WP_000795892.1|1529676_1530582_+	LysR family transcriptional regulator	NA	A0A2P0ZL89	Lactobacillus_phage	27.9	7.3e-24
WP_000639447.1|1530642_1530996_+	DUF3397 domain-containing protein	NA	NA	NA	NA	NA
WP_016481066.1|1531024_1532740_-	aminodeoxychorismate synthase component I	NA	S4VT78	Pandoravirus	30.8	2.0e-35
WP_016481067.1|1532821_1535272_-	DNA translocase FtsK	NA	S5VNE3	Mycobacterium_phage	51.7	3.9e-88
WP_016481068.1|1535437_1536241_+	peptidylprolyl isomerase	NA	A0A2H4UTF4	Bodo_saltans_virus	37.8	4.3e-20
WP_000494350.1|1536292_1537126_-	metal ABC transporter permease	NA	NA	NA	NA	NA
WP_016481069.1|1537127_1537844_-	metal ABC transporter ATP-binding protein	NA	A0A1V0SE00	Indivirus	32.5	4.3e-19
WP_016481070.1|1538014_1538941_-	metal ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_000188490.1|1539107_1539755_+	metal-dependent transcriptional regulator	NA	NA	NA	NA	NA
WP_000689759.1|1539794_1540484_-	5'-methylthioadenosine/adenosylhomocysteine nucleosidase	NA	NA	NA	NA	NA
WP_016481071.1|1540493_1540763_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016481072.1|1540762_1541317_-	NUDIX hydrolase	NA	NA	NA	NA	NA
WP_016481073.1|1541337_1542717_-	bifunctional UDP-N-acetylglucosamine diphosphorylase/glucosamine-1-phosphate N-acetyltransferase GlmU	NA	A0A2K9L4K9	Tupanvirus	37.2	2.6e-33
WP_016481074.1|1542960_1543374_-	VOC family protein	NA	NA	NA	NA	NA
WP_000625774.1|1543386_1543764_-	VOC family protein	NA	NA	NA	NA	NA
WP_016481075.1|1543852_1544809_-	Gfo/Idh/MocA family oxidoreductase	NA	NA	NA	NA	NA
WP_016481076.1|1544805_1545258_-	ASCH domain-containing protein	NA	NA	NA	NA	NA
WP_016481077.1|1545496_1546195_-	3-oxoacyl-ACP reductase	NA	NA	NA	NA	NA
WP_000141918.1|1546187_1546424_-	DUF2829 domain-containing protein	NA	NA	NA	NA	NA
WP_016481078.1|1546519_1547665_-|integrase	site-specific integrase	integrase	A0A1X9I5Y5	Streptococcus_phage	49.2	3.6e-97
WP_016481079.1|1547992_1548136_+|holin	putative holin-like toxin	holin	NA	NA	NA	NA
WP_001137532.1|1548801_1549011_-	TM2 domain-containing protein	NA	NA	NA	NA	NA
WP_016481081.1|1549119_1549752_-	helix-turn-helix transcriptional regulator	NA	A0A1X9I723	Streptococcus_phage	61.4	1.3e-16
WP_016481082.1|1549974_1550175_+	transcriptional regulator	NA	NA	NA	NA	NA
WP_016481083.1|1550198_1550744_+	phage repressor protein	NA	A0A2H4JB17	uncultured_Caudovirales_phage	45.4	1.2e-37
WP_000752173.1|1551762_1552296_-	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
1551070:1551419	attR	GTGTTCCTTCAACCTTTCTTTTATTAAGAGCTAATTCTAGAGTGTCACATGCTAACTTTGTTGAAGGAACACTTCTCTTTCATTCCGACCAAGGGGCACAATTTAAGGCCAGGGAATTTAGAAAAATAATTGATGACAACAATATCATGCATTCTTTTTCTAAACCTGGATATCCTTATGATAATGCCGTAACGGAAGCTTTTTTCAAGTATTTAAAGCATAGACAAATCAACCGAAAAAAGTATCAAAATATCAAACAGGTTCAATTAGACTGCTTTGAATATATTGAAAATTTTTATAACAATTACAACCCACATACGGCTAATCTAGGACTAACCCCTAATCAGAAA	NA	NA	NA	NA
WP_016481086.1|1552542_1553955_-	glycosyltransferase family 2 protein	NA	NA	NA	NA	NA
WP_144312747.1|1556201_1557307_-|transposase	IS3 family transposase	transposase	A0A2I7SC85	Paenibacillus_phage	51.3	6.3e-70
>prophage 6
NC_021486	Streptococcus agalactiae ILRI005, complete genome	2109759	1569781	1580506	2109759		Streptococcus_phage(83.33%)	13	NA	NA
WP_016481097.1|1569781_1570609_+	exodeoxyribonuclease III	NA	M1PSC0	Streptococcus_phage	77.7	9.6e-124
WP_000287943.1|1570648_1571005_-	arsenate reductase family protein	NA	M1PLC0	Streptococcus_phage	72.6	5.2e-42
WP_016481100.1|1571538_1572720_-	phosphoglycerate dehydrogenase	NA	M1NSB9	Streptococcus_phage	75.1	1.7e-166
WP_016481101.1|1572782_1573331_-	acetyltransferase	NA	M1PSC3	Streptococcus_phage	57.9	1.2e-53
WP_016481102.1|1573398_1574490_-	3-phosphoserine/phosphohydroxythreonine transaminase	NA	M1Q1P2	Streptococcus_phage	78.0	1.7e-165
WP_016481103.1|1574622_1575258_+	copper homeostasis protein CutC	NA	NA	NA	NA	NA
WP_016481104.1|1575527_1576397_-	16S rRNA (cytidine(1402)-2'-O)-methyltransferase	NA	M1PLC5	Streptococcus_phage	70.4	1.1e-109
WP_016481105.1|1576396_1576717_-	DNA replication initiation control protein YabA	NA	M1PFV3	Streptococcus_phage	61.3	9.1e-30
WP_000364568.1|1576746_1577610_-	DNA polymerase III subunit delta'	NA	M1NSC1	Streptococcus_phage	50.0	2.5e-74
WP_000715591.1|1577629_1578265_-	dTMP kinase	NA	M1PSC7	Streptococcus_phage	61.1	4.9e-67
WP_001144245.1|1578353_1579013_-	CBS domain-containing protein	NA	M1NSC5	Streptococcus_phage	56.0	8.0e-65
WP_000178146.1|1579031_1579742_-	ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	28.5	4.7e-18
WP_001185985.1|1579741_1580506_-	ABC transporter ATP-binding protein	NA	A0A2H4PQG7	Staphylococcus_phage	24.8	2.6e-14
>prophage 7
NC_021486	Streptococcus agalactiae ILRI005, complete genome	2109759	2058314	2068097	2109759	integrase	Streptococcus_phage(87.5%)	14	2059187:2059203	2070804:2070820
WP_041165785.1|2058314_2058845_-	hypothetical protein	NA	A0A1X9I5U4	Streptococcus_phage	58.5	1.2e-50
2059187:2059203	attL	CTTGTCAACCTTTATCA	NA	NA	NA	NA
WP_016481374.1|2060307_2061804_-	DNA primase phage associated	NA	Q9AZI5	Lactococcus_phage	37.2	1.5e-63
WP_016481375.1|2061823_2062693_-	primase C-terminal domain-containing protein	NA	A0A1X9I6L2	Streptococcus_phage	73.7	1.7e-123
WP_041165715.1|2062827_2063109_-	hypothetical protein	NA	A0A1X9I5U9	Streptococcus_phage	74.4	2.9e-32
WP_016481376.1|2063101_2063434_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016481377.1|2063430_2063664_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016481378.1|2063665_2063917_-	hypothetical protein	NA	M1PF88	Streptococcus_phage	49.4	3.3e-11
WP_016481379.1|2063933_2064128_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016481380.1|2064124_2064613_-	hypothetical protein	NA	A0A1X9I5T7	Streptococcus_phage	61.3	3.1e-45
WP_016481381.1|2064617_2064767_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016481382.1|2064838_2064994_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016481383.1|2065495_2065684_-	helix-turn-helix transcriptional regulator	NA	A0A141E205	Streptococcus_phage	42.6	1.2e-05
WP_016481384.1|2065873_2066494_+	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_041165786.1|2066930_2068097_+|integrase	site-specific integrase	integrase	A0A1X9I5Y5	Streptococcus_phage	76.0	2.1e-169
2070804:2070820	attR	CTTGTCAACCTTTATCA	NA	NA	NA	NA
>prophage 8
NC_021486	Streptococcus agalactiae ILRI005, complete genome	2109759	2079107	2086311	2109759		uncultured_Caudovirales_phage(16.67%)	8	NA	NA
WP_001042662.1|2079107_2079812_-	transglycosylase SLT domain-containing protein	NA	A0A2H4J6C5	uncultured_Caudovirales_phage	65.3	6.4e-28
WP_000029067.1|2079917_2080457_-	LysM peptidoglycan-binding domain-containing protein	NA	A0A249XZV3	Enterococcus_phage	46.4	3.0e-17
WP_016481391.1|2080672_2081467_-	energy-coupling factor transporter transmembrane protein EcfT	NA	NA	NA	NA	NA
WP_000510606.1|2081459_2082302_-	energy-coupling factor transporter ATPase	NA	A0A2H4PQG7	Staphylococcus_phage	28.5	2.0e-15
WP_000181757.1|2082277_2083117_-	energy-coupling factor transporter ATPase	NA	G9BWD6	Planktothrix_phage	30.0	3.5e-20
WP_000976003.1|2083116_2083659_-	CDP-diacylglycerol--glycerol-3-phosphate 3-phosphatidyltransferase	NA	NA	NA	NA	NA
WP_016481393.1|2083781_2085065_-	insulinase family protein	NA	A0A2H4UVM3	Bodo_saltans_virus	22.8	4.8e-05
WP_016481394.1|2085066_2086311_-	insulinase family protein	NA	A0A1X9I714	Streptococcus_phage	41.1	8.3e-87
