The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
NC_021744	Lactobacillus helveticus CNRZ32, complete sequence	2225962	10519	139803	2225962	transposase,protease	Streptococcus_phage(11.11%)	106	NA	NA
WP_041806241.1|10519_11698_-|transposase	IS256 family transposase	transposase	NA	NA	NA	NA
WP_101812846.1|15291_15978_-	hypothetical protein	NA	NA	NA	NA	NA
WP_020828862.1|18767_18926_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003631389.1|20737_22759_+	DHH family phosphoesterase	NA	NA	NA	NA	NA
WP_003624877.1|22770_23226_+	50S ribosomal protein L9	NA	NA	NA	NA	NA
WP_003624875.1|23256_24651_+	replicative DNA helicase	NA	A0A1P8VVQ6	Streptococcus_phage	50.6	3.7e-120
WP_003624873.1|24887_25817_+	phosphate/phosphite/phosphonate ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_020828865.1|28423_29302_+	ROK family protein	NA	NA	NA	NA	NA
WP_003624867.1|29453_29624_+	CsbD family protein	NA	NA	NA	NA	NA
WP_003631749.1|29675_29936_+	GlsB/YeaQ/YmgE family stress response membrane protein	NA	NA	NA	NA	NA
WP_041806154.1|30096_31818_+|transposase	IS1182 family transposase	transposase	A0ZS58	Staphylococcus_virus	36.7	1.4e-87
WP_003624862.1|31809_33039_-	DUF2974 domain-containing protein	NA	NA	NA	NA	NA
WP_020828866.1|33122_33827_-	MgtC/SapB family protein	NA	G3MA03	Bacillus_virus	43.6	1.6e-18
WP_020828867.1|34264_35029_-	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_003624857.1|35234_35678_+	hypothetical protein	NA	NA	NA	NA	NA
WP_035504224.1|35695_36247_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003624855.1|36236_37031_+	cell division protein FtsK	NA	A0A1S5SFB5	Streptococcus_phage	27.3	3.9e-13
WP_003624854.1|37117_37939_+	replication initiation factor domain-containing protein	NA	NA	NA	NA	NA
WP_003624852.1|37938_38322_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003624850.1|38323_38503_+	DNA-binding protein	NA	NA	NA	NA	NA
WP_003624843.1|41027_41231_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003624842.1|41243_41603_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003624840.1|41848_42085_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003624837.1|42671_42872_-	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_041806155.1|43049_44228_-|transposase	IS256 family transposase	transposase	NA	NA	NA	NA
WP_003624835.1|44418_45057_+	ATP-binding cassette domain-containing protein	NA	F2Y302	Organic_Lake_phycodnavirus	31.8	7.6e-20
WP_003624831.1|45053_45812_+	iron export ABC transporter permease subunit FetB	NA	NA	NA	NA	NA
WP_020828872.1|47073_47661_+	TetR/AcrR family transcriptional regulator	NA	NA	NA	NA	NA
WP_020828873.1|47764_49066_+	restriction endonuclease	NA	NA	NA	NA	NA
WP_035509017.1|50645_52046_+	LPXTG cell wall anchor domain-containing protein	NA	NA	NA	NA	NA
WP_012211216.1|52142_52916_+	putative ABC transporter permease	NA	NA	NA	NA	NA
WP_003624806.1|52954_53515_-	cob(I)yrinic acid a,c-diamide adenosyltransferase	NA	NA	NA	NA	NA
WP_003624803.1|53515_54040_-	ECF transporter S component	NA	NA	NA	NA	NA
WP_003628011.1|54041_54452_-	DUF4430 domain-containing protein	NA	NA	NA	NA	NA
WP_003624800.1|54471_56706_-	ribonucleoside-triphosphate reductase, adenosylcobalamin-dependent	NA	A0A222ZQ84	Mycobacterium_phage	33.2	6.5e-90
WP_003624796.1|56960_57995_+	AI-2E family transporter	NA	NA	NA	NA	NA
WP_003624794.1|57991_58564_+	SGNH/GDSL hydrolase family protein	NA	NA	NA	NA	NA
WP_003624790.1|58592_58775_-	hypothetical protein	NA	NA	NA	NA	NA
WP_020828876.1|58952_59237_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003624787.1|59610_60372_-	ATP-binding cassette domain-containing protein	NA	G9BWD6	Planktothrix_phage	28.6	6.5e-18
WP_003628104.1|60379_61264_-	branched-chain amino acid ABC transporter permease	NA	NA	NA	NA	NA
WP_020828877.1|61260_62253_-	ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_003628105.1|62600_63308_+	noncanonical pyrimidine nucleotidase, YjjG family	NA	NA	NA	NA	NA
WP_158648608.1|63564_63819_+	hypothetical protein	NA	NA	NA	NA	NA
WP_041806156.1|63948_65133_+|transposase	IS200/IS605 family element transposase accessory protein TnpB	transposase	Q5ULQ4	Lactobacillus_virus	60.4	3.5e-127
WP_158648592.1|65361_65469_+	hypothetical protein	NA	NA	NA	NA	NA
WP_158648609.1|65492_65690_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003628107.1|67052_67910_+	aldo/keto reductase	NA	A0A2H4PQR8	Staphylococcus_phage	43.1	5.0e-59
WP_003628108.1|71188_72202_-	D-2-hydroxyacid dehydrogenase	NA	M1H502	Paramecium_bursaria_Chlorella_virus	35.6	1.3e-50
WP_003624755.1|72328_73171_+	fructosamine kinase family protein	NA	NA	NA	NA	NA
WP_003624751.1|73625_74453_+	exodeoxyribonuclease III	NA	M1PSC0	Streptococcus_phage	63.5	3.4e-97
WP_020828879.1|75470_78302_+	DEAD/DEAH box helicase	NA	A0A0K2CZF8	Paenibacillus_phage	24.9	1.6e-29
WP_003624746.1|78341_79352_-	serine hydrolase	NA	NA	NA	NA	NA
WP_003624744.1|80501_80915_+	peptide deformylase	NA	E3SLL2	Synechococcus_phage	38.9	1.0e-09
WP_187289109.1|80974_81115_+	hypothetical protein	NA	NA	NA	NA	NA
WP_023192402.1|87121_88171_+|transposase	IS30 family transposase	transposase	H7BWC8	unidentified_phage	35.9	4.7e-51
WP_003627959.1|89289_90627_-|transposase	IS66 family transposase	transposase	S5VTD3	Leptospira_phage	34.4	7.4e-49
WP_003627958.1|90601_90832_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_143441508.1|90871_91222_-	IS66 family insertion sequence element accessory protein TnpB	NA	NA	NA	NA	NA
WP_023060818.1|91215_91392_-	hypothetical protein	NA	NA	NA	NA	NA
WP_020828880.1|91456_92065_-	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_023060818.1|92221_92398_+	hypothetical protein	NA	NA	NA	NA	NA
WP_143441508.1|92391_92742_+	IS66 family insertion sequence element accessory protein TnpB	NA	NA	NA	NA	NA
WP_003627958.1|92781_93012_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_003627959.1|92986_94324_+|transposase	IS66 family transposase	transposase	S5VTD3	Leptospira_phage	34.4	7.4e-49
WP_003625317.1|94486_94705_-	steroid-binding protein	NA	NA	NA	NA	NA
WP_003628365.1|94793_95663_-	1-acyl-sn-glycerol-3-phosphate acyltransferase	NA	NA	NA	NA	NA
WP_020828881.1|96626_97583_-	glycosyltransferase family 8 protein	NA	NA	NA	NA	NA
WP_003625326.1|97601_98438_-	glycosyl transferase	NA	NA	NA	NA	NA
WP_003625329.1|99445_99613_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003628375.1|99770_100160_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003628377.1|100209_100968_-	hypothetical protein	NA	NA	NA	NA	NA
WP_020828882.1|101096_102218_+	SLAP domain-containing protein	NA	NA	NA	NA	NA
WP_020828883.1|102277_103015_-	SLAP domain-containing protein	NA	NA	NA	NA	NA
WP_003625340.1|104160_104310_+	hypothetical protein	NA	NA	NA	NA	NA
WP_020828886.1|106943_107660_+	response regulator transcription factor	NA	W8CYM9	Bacillus_phage	38.8	2.0e-40
WP_020828887.1|107726_109583_+	cell wall metabolism sensor histidine kinase WalK	NA	W8CYF6	Bacillus_phage	31.6	3.0e-32
WP_003628552.1|109572_110922_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003625350.1|110924_111749_+	two-component system regulatory protein YycI	NA	NA	NA	NA	NA
WP_003625352.1|111764_112562_+	MBL fold metallo-hydrolase	NA	A0A2I7SDH3	Paenibacillus_phage	34.6	2.0e-30
WP_003625355.1|112648_113890_+	trypsin-like peptidase domain-containing protein	NA	A0A1B1IT49	uncultured_Mediterranean_phage	29.4	1.1e-17
WP_003628556.1|114355_114835_+	23S rRNA (pseudouridine(1915)-N(3))-methyltransferase RlmH	NA	NA	NA	NA	NA
WP_023192402.1|114936_115986_-|transposase	IS30 family transposase	transposase	H7BWC8	unidentified_phage	35.9	4.7e-51
WP_003625363.1|117573_118458_-	proline iminopeptidase-family hydrolase	NA	NA	NA	NA	NA
WP_003625366.1|118466_119120_-	energy-coupling factor transporter transmembrane protein EcfT	NA	NA	NA	NA	NA
WP_020828891.1|119123_120473_-	ABC transporter ATP-binding protein	NA	G3M9Y6	Bacillus_virus	28.1	3.3e-12
WP_003628663.1|120631_121573_+	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_023192429.1|122661_123150_-	helix-turn-helix domain-containing protein	NA	A0A0C5AJ29	Paenibacillus_phage	34.4	2.2e-11
WP_003625376.1|123241_124138_-|protease	zinc metalloprotease HtpX	protease	NA	NA	NA	NA
WP_020828893.1|124152_124713_-	LemA family protein	NA	A0A1X9IGG1	Lactococcus_phage	33.7	2.1e-13
WP_020828894.1|124779_125886_-	anion permease	NA	NA	NA	NA	NA
WP_003625382.1|126063_126468_+	iron-sulfur cluster biosynthesis family protein	NA	NA	NA	NA	NA
WP_003548644.1|126801_126942_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003625387.1|127046_127907_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003625394.1|130090_130417_-	PepSY domain-containing protein	NA	NA	NA	NA	NA
WP_003629452.1|130391_130625_-	hypothetical protein	NA	NA	NA	NA	NA
WP_041806157.1|130683_131541_-|transposase	IS982 family transposase	transposase	NA	NA	NA	NA
WP_003625398.1|131762_132410_+	HD domain-containing protein	NA	NA	NA	NA	NA
WP_003629454.1|132410_133328_+	HNH endonuclease	NA	NA	NA	NA	NA
WP_003625404.1|133380_134136_-	amino acid ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	37.2	1.4e-28
WP_003629455.1|134135_135749_-	ABC transporter substrate-binding protein/permease	NA	NA	NA	NA	NA
WP_020828897.1|136076_136709_-	DNA-3-methyladenine glycosylase	NA	NA	NA	NA	NA
WP_003625411.1|136778_137141_+	DUF488 family protein	NA	NA	NA	NA	NA
WP_003625412.1|137177_137966_-	DUF475 domain-containing protein	NA	A0A068EP98	Bacillus_phage	40.8	1.0e-37
WP_003625413.1|137952_138471_-	methylated-DNA--[protein]-cysteine S-methyltransferase	NA	A0A1S5V092	Saudi_moumouvirus	42.2	3.9e-14
WP_041806158.1|138945_139803_+|transposase	IS982 family transposase	transposase	NA	NA	NA	NA
>prophage 3
NC_021744	Lactobacillus helveticus CNRZ32, complete sequence	2225962	280811	339134	2225962	integrase,holin,transposase	Streptococcus_phage(25.0%)	48	317601:317616	334980:334995
WP_107504371.1|280811_280901_-|holin	putative holin-like toxin	holin	NA	NA	NA	NA
WP_003625174.1|281310_282660_+	FAD-dependent oxidoreductase	NA	A0A2K5B2C5	Erysipelothrix_phage	50.3	1.4e-124
WP_035509442.1|284319_285546_+|transposase	ISL3 family transposase	transposase	A0A1S5SBP9	Streptococcus_phage	29.0	1.6e-37
WP_012212328.1|285889_286408_+	N-acetyltransferase	NA	NA	NA	NA	NA
WP_020828940.1|286872_289140_+	copper-translocating P-type ATPase	NA	E4ZFI9	Streptococcus_phage	30.1	2.1e-59
WP_020828941.1|291423_292311_-	GRP family sugar transporter	NA	NA	NA	NA	NA
WP_143441533.1|293963_294410_-	recombinase family protein	NA	A0A0A8WIK3	Clostridium_phage	43.7	1.4e-23
WP_002831196.1|294911_295160_+	GlsB/YeaQ/YmgE family stress response membrane protein	NA	NA	NA	NA	NA
WP_172756900.1|295302_296379_+	thymidine phosphorylase	NA	A0A0H3UZD4	Geobacillus_virus	49.9	6.7e-85
WP_003625233.1|296862_297309_+	3-hydroxyacyl-ACP dehydratase FabZ	NA	NA	NA	NA	NA
WP_003625235.1|297338_297806_+	MarR family transcriptional regulator	NA	NA	NA	NA	NA
WP_003625237.1|297802_298786_+	ketoacyl-ACP synthase III	NA	NA	NA	NA	NA
WP_003625239.1|298844_299087_+	acyl carrier protein	NA	NA	NA	NA	NA
WP_003625242.1|299096_300014_+	ACP S-malonyltransferase	NA	NA	NA	NA	NA
WP_003625244.1|300013_300745_+	3-oxoacyl-ACP reductase FabG	NA	Q06VL0	Trichoplusia_ni_ascovirus	30.0	1.2e-13
WP_003625246.1|300766_301996_+	beta-ketoacyl-ACP synthase II	NA	NA	NA	NA	NA
WP_003625248.1|301999_302470_+	acetyl-CoA carboxylase biotin carboxyl carrier protein	NA	NA	NA	NA	NA
WP_003625250.1|302474_302891_+	beta-hydroxyacyl-ACP dehydratase	NA	NA	NA	NA	NA
WP_012212319.1|302904_304284_+	acetyl-CoA carboxylase biotin carboxylase subunit	NA	NA	NA	NA	NA
WP_003625253.1|304264_305107_+	acetyl-CoA carboxylase carboxyltransferase subunit beta	NA	NA	NA	NA	NA
WP_020828944.1|305099_305870_+	acetyl-CoA carboxyltransferase subunit alpha	NA	NA	NA	NA	NA
WP_020828945.1|305928_306687_+	enoyl-ACP reductase FabI	NA	NA	NA	NA	NA
WP_003625259.1|306734_307724_+	biotin--[acetyl-CoA-carboxylase] ligase	NA	NA	NA	NA	NA
WP_003625260.1|307797_308340_+	biotin transporter BioY	NA	NA	NA	NA	NA
WP_143441532.1|308285_308675_-	hypothetical protein	NA	NA	NA	NA	NA
WP_013854585.1|309223_310453_-|transposase	IS110-like element ISLhe4 family transposase	transposase	A0A1X9I619	Streptococcus_phage	38.4	1.8e-65
WP_003625261.1|312131_312689_-	adenine phosphoribosyltransferase	NA	NA	NA	NA	NA
WP_080516443.1|315006_315912_-	methylenetetrahydrofolate reductase [NAD(P)H]	NA	NA	NA	NA	NA
WP_003625266.1|315889_318175_-	5-methyltetrahydropteroyltriglutamate-- homocysteine S-methyltransferase	NA	NA	NA	NA	NA
317601:317616	attL	TCAATAATTTGTTTGT	NA	NA	NA	NA
WP_003625268.1|318328_318802_-	S-ribosylhomocysteine lyase	NA	NA	NA	NA	NA
WP_014562912.1|318916_320323_-|transposase	ISLre2 family transposase	transposase	NA	NA	NA	NA
WP_003625273.1|321638_322094_+	hypothetical protein	NA	NA	NA	NA	NA
WP_044000216.1|322144_322477_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003625277.1|322427_323036_-|integrase	site-specific integrase	integrase	D2XR58	Bacillus_phage	31.2	1.2e-17
WP_003625288.1|323139_323418_+	type II toxin-antitoxin system RelB/DinJ family antitoxin	NA	NA	NA	NA	NA
WP_003572735.1|323407_323710_+	type II toxin-antitoxin system YafQ family toxin	NA	NA	NA	NA	NA
WP_003633334.1|325508_325685_+	hypothetical protein	NA	NA	NA	NA	NA
WP_143441508.1|325678_326029_+	IS66 family insertion sequence element accessory protein TnpB	NA	NA	NA	NA	NA
WP_003627958.1|326068_326299_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_003627959.1|326273_327611_+|transposase	IS66 family transposase	transposase	S5VTD3	Leptospira_phage	34.4	7.4e-49
WP_003625293.1|328076_328220_+	hypothetical protein	NA	NA	NA	NA	NA
WP_041806161.1|328297_328480_+	hypothetical protein	NA	NA	NA	NA	NA
WP_041806162.1|330445_331615_-|transposase	IS256 family transposase	transposase	NA	NA	NA	NA
WP_003625300.1|332191_333208_+	ThiF family adenylyltransferase	NA	A0A1V0SCZ9	Indivirus	37.8	2.0e-06
WP_020807709.1|333240_334083_+	hypothetical protein	NA	NA	NA	NA	NA
WP_020828948.1|334093_335680_+	ABC transporter ATP-binding protein	NA	A0A076FI99	Aureococcus_anophage	21.8	4.1e-14
334980:334995	attR	ACAAACAAATTATTGA	NA	NA	NA	NA
WP_020828949.1|335686_337258_+	ABC transporter ATP-binding protein	NA	A0A076FI99	Aureococcus_anophage	23.6	4.5e-13
WP_041806162.1|337964_339134_+|transposase	IS256 family transposase	transposase	NA	NA	NA	NA
>prophage 4
NC_021744	Lactobacillus helveticus CNRZ32, complete sequence	2225962	349851	418863	2225962	bacteriocin,transposase	Bacillus_phage(16.67%)	57	NA	NA
WP_041806163.1|349851_351552_+|transposase	IS1182 family transposase	transposase	A0ZS58	Staphylococcus_virus	37.1	1.7e-87
WP_020828952.1|355713_356070_-	hypothetical protein	NA	NA	NA	NA	NA
WP_023192509.1|357546_358710_-	MFS transporter	NA	NA	NA	NA	NA
WP_020828954.1|358860_359841_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003627391.1|359904_360264_-	hypothetical protein	NA	A0A0E3XCL7	Enterococcus_phage	67.1	1.5e-20
WP_003627390.1|360470_363005_+	M1 family metallopeptidase	NA	A0A0P0IY26	Acinetobacter_phage	25.9	1.9e-69
WP_003627386.1|364782_365427_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003627385.1|365485_366247_+	peroxide stress protein YaaA	NA	NA	NA	NA	NA
WP_020828958.1|366243_366999_-	alpha/beta fold hydrolase	NA	NA	NA	NA	NA
WP_020828959.1|367142_367742_+	histidine phosphatase family protein	NA	NA	NA	NA	NA
WP_003630236.1|367852_368380_+	TetR/AcrR family transcriptional regulator	NA	NA	NA	NA	NA
WP_003627381.1|368380_369442_+	ABC transporter permease	NA	NA	NA	NA	NA
WP_003630234.1|369443_370118_+	ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	39.4	1.7e-33
WP_003627379.1|370162_371575_-	C69 family dipeptidase	NA	NA	NA	NA	NA
WP_003630233.1|371676_371919_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003627375.1|372045_372669_+	TetR/AcrR family transcriptional regulator	NA	NA	NA	NA	NA
WP_041806164.1|372878_374285_+|transposase	ISLre2 family transposase	transposase	NA	NA	NA	NA
WP_003627373.1|374440_375739_+	MFS transporter	NA	NA	NA	NA	NA
WP_003627371.1|376210_376750_+	NAD(P)H-dependent oxidoreductase	NA	NA	NA	NA	NA
WP_003627370.1|376763_377312_+	NAD(P)H-dependent oxidoreductase	NA	A0A2P0ZL82	Lactobacillus_phage	38.8	1.1e-27
WP_003630226.1|377404_378196_+	tyrosine-protein phosphatase	NA	NA	NA	NA	NA
WP_003627368.1|378204_379134_+	FAD:protein FMN transferase	NA	NA	NA	NA	NA
WP_003627367.1|379175_379712_-	CvpA family protein	NA	NA	NA	NA	NA
WP_003627366.1|379873_380596_+	16S rRNA (guanine(527)-N(7))-methyltransferase RsmG	NA	NA	NA	NA	NA
WP_003630225.1|380610_381450_+	nucleoid occlusion protein	NA	S5VSZ7	Leptospira_phage	42.5	2.1e-17
WP_003627364.1|381465_382245_+	ParA family protein	NA	Q8JL10	Natrialba_phage	31.5	4.3e-25
WP_003627363.1|382222_383107_+	ParB/RepB/Spo0J family partition protein	NA	S5VTK0	Leptospira_phage	29.5	5.1e-14
WP_003627362.1|383099_383363_+	DUF951 domain-containing protein	NA	NA	NA	NA	NA
WP_003627361.1|383412_384513_+	redox-regulated ATPase YchF	NA	NA	NA	NA	NA
WP_003627359.1|384521_385304_+	DUF1129 domain-containing protein	NA	NA	NA	NA	NA
WP_020828961.1|385418_387143_+	ABC transporter ATP-binding protein	NA	W8CYL7	Bacillus_phage	27.1	8.9e-39
WP_020828962.1|387152_389012_+	ABC transporter ATP-binding protein	NA	W8CYL7	Bacillus_phage	26.0	6.2e-46
WP_003627353.1|389189_389876_+	response regulator transcription factor	NA	W8CYM9	Bacillus_phage	37.6	9.6e-37
WP_003627352.1|389879_391028_+	HAMP domain-containing histidine kinase	NA	A0A1V0SGX0	Hokovirus	31.7	2.0e-18
WP_003627351.1|391078_392650_+	UDP-N-acetylmuramoyl-L-alanyl-D-glutamate--2, 6-diaminopimelate ligase	NA	NA	NA	NA	NA
WP_003627350.1|392658_393408_+	aspartate/glutamate racemase family protein	NA	NA	NA	NA	NA
WP_035505054.1|395009_395321_+|bacteriocin	bacteriocin immunity protein	bacteriocin	NA	NA	NA	NA
WP_003627960.1|395577_396186_+|transposase	IS607 family transposase	transposase	A0A1V0SJI5	Klosneuvirus	43.2	1.5e-33
WP_041806165.1|396215_397541_+|transposase	IS200/IS605 family element transposase accessory protein TnpB	transposase	G3MB42	Bacillus_virus	35.8	2.0e-54
WP_003630198.1|397768_397996_+	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_003630196.1|397985_398207_+	hypothetical protein	NA	NA	NA	NA	NA
WP_014919460.1|398505_398697_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003627337.1|398967_399276_+	type II toxin-antitoxin system RelB/DinJ family antitoxin	NA	NA	NA	NA	NA
WP_003627335.1|399256_399424_+	type II toxin-antitoxin system RelB/DinJ family antitoxin	NA	NA	NA	NA	NA
WP_003630188.1|399777_400533_+	DeoR/GlpR transcriptional regulator	NA	A0A077SK06	Escherichia_phage	27.8	5.0e-18
WP_020828964.1|400532_401447_+	1-phosphofructokinase	NA	NA	NA	NA	NA
WP_096001360.1|401550_402780_+|transposase	IS200/IS605 family element transposase accessory protein TnpB	transposase	Q5ULQ4	Lactobacillus_virus	58.7	8.9e-126
WP_020828965.1|402892_404890_+	PTS sugar transporter subunit IIA	NA	NA	NA	NA	NA
WP_003630183.1|405093_405366_+	winged helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_003630181.1|406576_407224_+	ATP-binding cassette domain-containing protein	NA	G9BWD6	Planktothrix_phage	29.3	7.5e-15
WP_003627328.1|407223_408018_+	metal ABC transporter permease	NA	NA	NA	NA	NA
WP_020828966.1|408452_409835_+	cation:dicarboxylase symporter family transporter	NA	NA	NA	NA	NA
WP_020828967.1|411944_412217_+|bacteriocin	bacteriocin immunity protein	bacteriocin	NA	NA	NA	NA
WP_003627319.1|413114_414911_-	oligoendopeptidase F	NA	NA	NA	NA	NA
WP_041806167.1|415091_415949_+|transposase	IS982 family transposase	transposase	NA	NA	NA	NA
WP_003627318.1|416044_417286_+	LCP family protein	NA	NA	NA	NA	NA
WP_187289103.1|417633_418863_+|transposase	IS200/IS605 family element transposase accessory protein TnpB	transposase	Q5ULQ4	Lactobacillus_virus	56.9	1.7e-121
>prophage 5
NC_021744	Lactobacillus helveticus CNRZ32, complete sequence	2225962	424412	483079	2225962	transposase	Clostridioides_phage(14.29%)	53	NA	NA
WP_041806170.1|424412_425654_+|transposase	IS200/IS605 family element transposase accessory protein TnpB	transposase	A0A0P0IJS6	Lactobacillus_phage	57.1	2.5e-120
WP_012212258.1|425893_426430_+	hypothetical protein	NA	NA	NA	NA	NA
WP_020828973.1|426542_426887_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003630140.1|428626_429268_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003627301.1|429282_430788_-	O-antigen ligase family protein	NA	NA	NA	NA	NA
WP_003627299.1|430880_431180_-	DUF2187 domain-containing protein	NA	NA	NA	NA	NA
WP_020828975.1|431274_431820_+	AAA family ATPase	NA	A0A218KC48	Bacillus_phage	31.7	7.2e-11
WP_003627296.1|432009_432561_+	C40 family peptidase	NA	A0A1V0DZX6	Clostridioides_phage	44.4	1.2e-18
WP_003627295.1|432654_432924_+	hypothetical protein	NA	NA	NA	NA	NA
WP_096001362.1|433013_434237_+|transposase	IS200/IS605 family element transposase accessory protein TnpB	transposase	Q5ULQ4	Lactobacillus_virus	57.7	3.0e-121
WP_023192438.1|434331_434541_+	Protein of unknown function	NA	NA	NA	NA	NA
WP_023062121.1|434588_434909_+	hypothetical protein	NA	NA	NA	NA	NA
WP_014919431.1|434974_435625_+|transposase	IS607 family transposase	transposase	A0A7Q0	Microcystis_virus	45.2	5.2e-40
WP_051356298.1|435557_437141_+|transposase	IS200/IS605 family element transposase accessory protein TnpB	transposase	NA	NA	NA	NA
WP_035509074.1|437477_437840_+	ATPase	NA	NA	NA	NA	NA
WP_014919428.1|438057_438834_+	C40 family peptidase	NA	A0A1V0DZX6	Clostridioides_phage	47.2	1.3e-18
WP_020828976.1|439864_440797_+	C40 family peptidase	NA	M9MUG9	Rhodococcus_phage	36.9	1.6e-13
WP_020828977.1|441007_442021_-	CAP domain-containing protein	NA	NA	NA	NA	NA
WP_020828978.1|442042_443308_-	GTPase HflX	NA	NA	NA	NA	NA
WP_020828979.1|443783_444842_+	LCP family protein	NA	A0A1X9I5X1	Streptococcus_phage	31.1	1.4e-15
WP_020828980.1|444853_445738_+	Tyrosine-protein kinase modulator Wzd	NA	NA	NA	NA	NA
WP_020828981.1|445748_446537_+	CpsD/CapB family tyrosine-protein kinase	NA	NA	NA	NA	NA
WP_020828982.1|446536_447307_+	protein-tyrosine-phosphatase	NA	NA	NA	NA	NA
WP_035509081.1|447426_448077_+	sugar transferase	NA	NA	NA	NA	NA
WP_187289104.1|448274_449345_+	hypothetical protein	NA	NA	NA	NA	NA
WP_020828985.1|449313_450477_+	glycosyltransferase family 1 protein	NA	NA	NA	NA	NA
WP_020828986.1|450478_451333_+	glycosyltransferase family 2 protein	NA	NA	NA	NA	NA
WP_020828987.1|451329_452436_+	glycosyltransferase	NA	NA	NA	NA	NA
WP_020828988.1|452438_453440_+	glycosyltransferase family 2 protein	NA	NA	NA	NA	NA
WP_020828989.1|453441_454242_+	LicD family protein	NA	A0A1V0SAS8	Catovirus	36.1	5.8e-09
WP_020828990.1|454280_455144_+	glycosyltransferase	NA	NA	NA	NA	NA
WP_020828991.1|455154_455976_+	glycosyl transferase	NA	NA	NA	NA	NA
WP_035509085.1|456124_457492_-|transposase	IS66 family transposase	transposase	A0A218MNE7	uncultured_virus	27.4	6.0e-38
WP_148286624.1|459138_459330_-	IS66 family insertion sequence element accessory protein TnpB	NA	NA	NA	NA	NA
WP_080669045.1|459362_459560_-	IS66 family insertion sequence element accessory protein TnpB	NA	NA	NA	NA	NA
WP_020828992.1|459553_459730_-	hypothetical protein	NA	NA	NA	NA	NA
WP_041806173.1|460101_461283_+|transposase	IS256 family transposase	transposase	NA	NA	NA	NA
WP_020828993.1|462319_463813_+	flippase	NA	NA	NA	NA	NA
WP_020828994.1|465515_466445_+	NTP transferase domain-containing protein	NA	NA	NA	NA	NA
WP_020828995.1|466492_468262_+	phosphotransferase	NA	NA	NA	NA	NA
WP_020828996.1|468276_469761_+	APC family permease	NA	NA	NA	NA	NA
WP_020828997.1|469773_470052_+	hypothetical protein	NA	NA	NA	NA	NA
WP_023192710.1|470093_470393_+	hypothetical protein	NA	NA	NA	NA	NA
WP_020828999.1|470580_470763_+	hypothetical protein	NA	NA	NA	NA	NA
WP_020829000.1|471303_471903_+	hypothetical protein	NA	NA	NA	NA	NA
WP_020829001.1|472051_473227_+	methyltransferase domain-containing protein	NA	NA	NA	NA	NA
WP_014919383.1|473312_474350_+	dTDP-glucose 4,6-dehydratase	NA	A0A291LAD7	Escherichia_phage	47.4	9.0e-87
WP_020829002.1|474354_475239_+	glucose-1-phosphate thymidylyltransferase RfbA	NA	I7I009	Enterobacteria_phage	57.5	1.2e-92
WP_020829004.1|475884_476871_+	dTDP-4-dehydrorhamnose reductase	NA	I7HXC9	Enterobacteria_phage	37.3	3.7e-29
WP_003627373.1|478892_480191_+	MFS transporter	NA	NA	NA	NA	NA
WP_020829005.1|480694_481045_+	hypothetical protein	NA	NA	NA	NA	NA
WP_020829006.1|481243_481408_+	hypothetical protein	NA	NA	NA	NA	NA
WP_096001364.1|481849_483079_-|transposase	IS110-like element ISLhe4 family transposase	transposase	A0A1X9I619	Streptococcus_phage	37.9	1.5e-64
>prophage 6
NC_021744	Lactobacillus helveticus CNRZ32, complete sequence	2225962	498807	646771	2225962	bacteriocin,protease,transposase,tRNA,holin	Lactobacillus_virus(11.76%)	115	NA	NA
WP_020829017.1|498807_499494_-|protease	matrixin family metalloprotease	protease	NA	NA	NA	NA
WP_020829018.1|499643_501953_+	AAA family ATPase	NA	NA	NA	NA	NA
WP_003627820.1|502392_503040_+	amino acid ABC transporter permease	NA	NA	NA	NA	NA
WP_003627821.1|503055_503676_+	amino acid ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	38.7	7.4e-28
WP_003627822.1|503679_504483_+	amino acid ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_003627823.1|504486_504933_+	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_003627824.1|504929_505490_-	SGNH/GDSL hydrolase family protein	NA	NA	NA	NA	NA
WP_023192120.1|505548_506463_+	type I pantothenate kinase	NA	A0A1B1ISL9	uncultured_Mediterranean_phage	33.6	9.5e-32
WP_020829019.1|506497_507070_+	elongation factor P	NA	NA	NA	NA	NA
WP_035509935.1|507122_508403_-	extracellular solute-binding protein	NA	NA	NA	NA	NA
WP_003629973.1|508593_509013_-	PepSY domain-containing protein	NA	NA	NA	NA	NA
WP_003629972.1|509094_509271_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003627831.1|509421_509925_-	nucleoside 2-deoxyribosyltransferase	NA	C1KFI2	Lactobacillus_virus	31.2	5.4e-13
WP_003627832.1|509972_510974_-	adenosine deaminase	NA	NA	NA	NA	NA
WP_003627833.1|511063_511978_-	prolyl aminopeptidase	NA	NA	NA	NA	NA
WP_003627836.1|514107_514848_+	nicotinamide mononucleotide transporter	NA	A0A0A7NTY4	Lactobacillus_phage	83.5	1.1e-121
WP_052317678.1|515523_516681_+|transposase	IS200/IS605 family element transposase accessory protein TnpB	transposase	A0A0P0IJS6	Lactobacillus_phage	57.8	4.2e-117
WP_023192200.1|516774_516933_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003627839.1|516947_517769_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003627840.1|517777_518731_+	ribonuclease H-like domain-containing protein	NA	A0A0K2SUJ2	Clostridium_phage	33.1	1.5e-11
WP_003627841.1|518821_519676_+	DNA/RNA non-specific endonuclease	NA	NA	NA	NA	NA
WP_003627842.1|519717_521145_+	C69 family dipeptidase	NA	NA	NA	NA	NA
WP_041806175.1|521367_522225_+|transposase	IS982 family transposase	transposase	NA	NA	NA	NA
WP_003629946.1|522368_523454_+	ABC transporter ATP-binding protein	NA	G3M9Y6	Bacillus_virus	33.2	3.2e-26
WP_020829021.1|523453_524320_+	sugar ABC transporter permease	NA	NA	NA	NA	NA
WP_003629944.1|524323_525148_+	carbohydrate ABC transporter permease	NA	NA	NA	NA	NA
WP_003627846.1|525131_526427_+	MBL fold metallo-hydrolase	NA	NA	NA	NA	NA
WP_003627847.1|526478_527780_+	extracellular solute-binding protein	NA	NA	NA	NA	NA
WP_041806176.1|527918_528836_+	magnesium transporter CorA family protein	NA	NA	NA	NA	NA
WP_003629940.1|528848_529799_+	serine hydrolase	NA	NA	NA	NA	NA
WP_003627850.1|529934_530507_+	TetR/AcrR family transcriptional regulator	NA	NA	NA	NA	NA
WP_020829023.1|530511_534120_+	MMPL family transporter	NA	NA	NA	NA	NA
WP_020829024.1|534277_535312_+	zinc ribbon domain-containing protein	NA	NA	NA	NA	NA
WP_020829025.1|535357_536740_-	NAD-dependent succinate-semialdehyde dehydrogenase	NA	NA	NA	NA	NA
WP_003627854.1|536823_537525_-	hypothetical protein	NA	NA	NA	NA	NA
WP_020829026.1|537680_538478_-	alpha/beta hydrolase	NA	NA	NA	NA	NA
WP_020829027.1|538607_539216_+	TVP38/TMEM64 family protein	NA	M1Q152	Streptococcus_phage	39.1	3.6e-35
WP_020829028.1|539215_539767_+	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_020829029.1|539990_541298_+|tRNA	serine--tRNA ligase	tRNA	A0A1B1IVT2	uncultured_Mediterranean_phage	44.1	6.2e-93
WP_023192538.1|548118_548316_+	GH36 C-terminal domain-containing protein	NA	NA	NA	NA	NA
WP_003627006.1|548378_549398_+	PTS mannose transporter subunit IIAB	NA	NA	NA	NA	NA
WP_020829030.1|549434_550247_+	PTS mannose/fructose/sorbose transporter subunit IIC	NA	NA	NA	NA	NA
WP_003627003.1|550275_551196_+	PTS mannose/fructose/sorbose transporter family subunit IID	NA	NA	NA	NA	NA
WP_012211481.1|551199_551568_+	DUF956 family protein	NA	NA	NA	NA	NA
WP_020829031.1|551612_552443_-	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_003626993.1|553156_554530_-	amino acid permease	NA	NA	NA	NA	NA
WP_003626990.1|554843_557468_+	bifunctional acetaldehyde-CoA/alcohol dehydrogenase	NA	NA	NA	NA	NA
WP_003626989.1|557663_559475_+	glutamine--fructose-6-phosphate transaminase (isomerizing)	NA	Q76DQ7	Chlorella_virus	37.4	1.6e-91
WP_003626988.1|559548_559842_+	hypothetical protein	NA	NA	NA	NA	NA
WP_023061029.1|560025_560139_-|holin	putative holin-like toxin	holin	NA	NA	NA	NA
WP_003626986.1|560925_561309_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003626983.1|562711_563896_+	acetate kinase	NA	NA	NA	NA	NA
WP_003626981.1|563999_564731_+	carboxymuconolactone decarboxylase family protein	NA	NA	NA	NA	NA
WP_003626979.1|564817_565045_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003626977.1|565206_565620_+	NUDIX domain-containing protein	NA	NA	NA	NA	NA
WP_096001365.1|567238_568468_+|transposase	IS200/IS605 family element transposase accessory protein TnpB	transposase	Q5ULQ4	Lactobacillus_virus	57.7	1.3e-124
WP_003626968.1|568736_569108_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003626966.1|569125_569875_-	TIGR02452 family protein	NA	NA	NA	NA	NA
WP_003626965.1|570076_570376_+|transposase	PD-(D/E)XK nuclease family transposase	transposase	NA	NA	NA	NA
WP_003627960.1|570483_571092_+|transposase	IS607 family transposase	transposase	A0A1V0SJI5	Klosneuvirus	43.2	1.5e-33
WP_041806178.1|571121_572447_+|transposase	IS200/IS605 family element transposase accessory protein TnpB	transposase	G3MB42	Bacillus_virus	36.3	2.1e-56
WP_051349531.1|572657_572921_+	hypothetical protein	NA	NA	NA	NA	NA
WP_023192402.1|573221_574271_+|transposase	IS30 family transposase	transposase	H7BWC8	unidentified_phage	35.9	4.7e-51
WP_003626963.1|575144_575858_+	GntR family transcriptional regulator	NA	NA	NA	NA	NA
WP_020829034.1|575874_577029_+	N-acetylglucosamine-6-phosphate deacetylase	NA	NA	NA	NA	NA
WP_041806179.1|577294_578536_+|transposase	IS200/IS605 family element transposase accessory protein TnpB	transposase	A0A0P0IJS6	Lactobacillus_phage	57.5	4.3e-120
WP_003626961.1|578841_579240_-	iron-sulfur cluster biosynthesis family protein	NA	NA	NA	NA	NA
WP_003626960.1|579338_579539_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003626959.1|579649_580042_+	hypothetical protein	NA	NA	NA	NA	NA
WP_041806180.1|581211_582594_-|transposase	IS3 family transposase	transposase	A0A1B1P773	Bacillus_phage	46.7	4.0e-58
WP_003626950.1|583185_583881_+	SLAP domain-containing protein	NA	A0A249XZV3	Enterococcus_phage	50.7	4.9e-12
WP_023192357.1|584018_585077_+	SEC10/PgrA surface exclusion domain-containing protein	NA	NA	NA	NA	NA
WP_003626946.1|585146_585725_+	histidine phosphatase family protein	NA	A0A1X9IGJ2	Lactococcus_phage	37.1	1.1e-22
WP_003626945.1|585725_586943_+	histidine phosphatase family protein	NA	A0A1X9IGJ2	Lactococcus_phage	37.3	1.8e-14
WP_003626944.1|586993_587689_+	glycerophosphoryl diester phosphodiesterase	NA	M1ICP4	Paramecium_bursaria_Chlorella_virus	25.8	1.4e-14
WP_003626939.1|592545_593661_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003633005.1|593749_594451_+	GntR family transcriptional regulator	NA	NA	NA	NA	NA
WP_003633007.1|594514_594901_-	glycerol-3-phosphate cytidylyltransferase	NA	A0A0F7LBI5	uncultured_marine_virus	47.2	7.1e-13
WP_187289105.1|595011_596241_-|transposase	IS200/IS605 family element transposase accessory protein TnpB	transposase	Q5ULQ4	Lactobacillus_virus	56.4	8.7e-121
WP_020829039.1|596451_597180_+	WecB/TagA/CpsF family glycosyltransferase	NA	NA	NA	NA	NA
WP_003633019.1|597187_598288_+	glycosyltransferase family 4 protein	NA	NA	NA	NA	NA
WP_003633021.1|598375_599854_+	nicotinate phosphoribosyltransferase	NA	G3MA18	Bacillus_virus	47.6	1.3e-115
WP_003626929.1|599850_600681_+	ammonia-dependent NAD(+) synthetase	NA	G3MA24	Bacillus_virus	51.1	1.3e-67
WP_041806182.1|600877_602119_+|transposase	IS200/IS605 family element transposase accessory protein TnpB	transposase	A0A0P0IJS6	Lactobacillus_phage	57.4	5.3e-118
WP_003633044.1|605112_606267_+	CDP-glycerol--glycerophosphate glycerophosphotransferase	NA	NA	NA	NA	NA
WP_003633045.1|606271_607702_+	polysaccharide biosynthesis protein	NA	NA	NA	NA	NA
WP_003626913.1|607704_608403_+	glycosyl transferase	NA	L7RBS6	Acanthamoeba_polyphaga_moumouvirus	27.6	2.1e-07
WP_003626912.1|608390_608861_+	SprT family protein	NA	NA	NA	NA	NA
WP_003633047.1|609098_609746_+	glycoside hydrolase family 73 protein	NA	S5M633	Brevibacillus_phage	47.7	1.0e-27
WP_003633049.1|609831_612069_+	DNA helicase PcrA	NA	A7KV33	Bacillus_phage	41.5	5.2e-132
WP_012211516.1|612109_614116_+	NAD-dependent DNA ligase LigA	NA	A0A0K2QQN8	Ralstonia_phage	36.1	7.1e-104
WP_020829042.1|614128_615277_+	CamS family sex pheromone protein	NA	NA	NA	NA	NA
WP_020829043.1|615290_615599_+|tRNA	Asp-tRNA(Asn)/Glu-tRNA(Gln) amidotransferase subunit GatC	tRNA	NA	NA	NA	NA
WP_003626902.1|615598_617038_+|tRNA	Asp-tRNA(Asn)/Glu-tRNA(Gln) amidotransferase subunit GatA	tRNA	NA	NA	NA	NA
WP_003626901.1|617042_618473_+|tRNA	Asp-tRNA(Asn)/Glu-tRNA(Gln) amidotransferase subunit GatB	tRNA	NA	NA	NA	NA
WP_003633052.1|618497_619418_+	diacylglycerol kinase family lipid kinase	NA	A0A1V0SBJ0	Catovirus	25.8	2.7e-18
WP_003633053.1|620211_620916_-	Bax inhibitor-1/YccA family protein	NA	NA	NA	NA	NA
WP_041806167.1|621060_621918_+|transposase	IS982 family transposase	transposase	NA	NA	NA	NA
WP_020829045.1|622114_622693_-	recombinase family protein	NA	A0A0A8WIK3	Clostridium_phage	39.9	6.7e-31
WP_041806246.1|623012_624191_+|transposase	IS256-like element IS1201 family transposase	transposase	NA	NA	NA	NA
WP_003630841.1|624545_624755_-	hypothetical protein	NA	NA	NA	NA	NA
WP_020829047.1|626460_627255_+	Fe-S cluster assembly ATPase SufC	NA	A0A1M7XV31	Cedratvirus	27.6	7.3e-12
WP_003626809.1|627266_628544_+	Fe-S cluster assembly protein SufD	NA	NA	NA	NA	NA
WP_003626808.1|628518_629757_+	SufS family cysteine desulfurase	NA	Q2XUY6	environmental_halophage	41.8	1.0e-97
WP_003626807.1|629743_630205_+	SUF system NifU family Fe-S cluster assembly protein	NA	NA	NA	NA	NA
WP_003626806.1|630197_631601_+	Fe-S cluster assembly protein SufB	NA	NA	NA	NA	NA
WP_003626804.1|631600_631924_+	metal-sulfur cluster assembly factor	NA	NA	NA	NA	NA
WP_020829049.1|632010_632376_-|bacteriocin	bacteriocin immunity protein	bacteriocin	NA	NA	NA	NA
WP_003633240.1|633442_635842_+	phosphoketolase family protein	NA	NA	NA	NA	NA
WP_003626797.1|635909_636758_+	patatin family protein	NA	NA	NA	NA	NA
WP_023192377.1|636920_637709_+	hypothetical protein	NA	NA	NA	NA	NA
WP_158648818.1|637760_638003_+	GHKL domain-containing protein	NA	NA	NA	NA	NA
WP_003631137.1|640314_641163_+|protease	CPBP family intramembrane metalloprotease	protease	NA	NA	NA	NA
WP_181414318.1|642454_643684_+|transposase	IS200/IS605 family element transposase accessory protein TnpB	transposase	Q5ULQ4	Lactobacillus_virus	57.9	1.7e-124
WP_096001367.1|645472_646771_+|transposase	ISLre2 family transposase	transposase	NA	NA	NA	NA
>prophage 7
NC_021744	Lactobacillus helveticus CNRZ32, complete sequence	2225962	659400	720916	2225962	transposase	Bacillus_phage(20.0%)	48	NA	NA
WP_003627958.1|659400_659631_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_003627959.1|659605_660943_+|transposase	IS66 family transposase	transposase	S5VTD3	Leptospira_phage	34.4	7.4e-49
WP_020829054.1|662741_663284_-	GtrA family protein	NA	NA	NA	NA	NA
WP_003626773.1|663276_663723_-	flavodoxin	NA	NA	NA	NA	NA
WP_003633294.1|663865_664693_+	type I methionyl aminopeptidase	NA	NA	NA	NA	NA
WP_012211577.1|664701_665625_+	YihY/virulence factor BrkB family protein	NA	NA	NA	NA	NA
WP_003626768.1|665686_666586_+	UTP--glucose-1-phosphate uridylyltransferase GalU	NA	A0A127AW70	Bacillus_phage	48.1	6.4e-73
WP_023192390.1|666650_667979_+|transposase	IS200/IS605 family element transposase accessory protein TnpB	transposase	A0A286QMQ9	Streptococcus_phage	41.3	2.7e-59
WP_003633307.1|668212_669373_+	thiolase family protein	NA	NA	NA	NA	NA
WP_003626761.1|669372_670584_+	hydroxymethylglutaryl-CoA reductase, degradative	NA	NA	NA	NA	NA
WP_020829055.1|670583_671747_+	hydroxymethylglutaryl-CoA synthase	NA	NA	NA	NA	NA
WP_003626759.1|671785_672070_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003633232.1|673405_674224_+	HAD family hydrolase	NA	NA	NA	NA	NA
WP_003633228.1|674288_674612_-	AAC(3) family N-acetyltransferase	NA	NA	NA	NA	NA
WP_003633207.1|676019_676235_-	transcriptional regulator	NA	NA	NA	NA	NA
WP_003626821.1|677012_677939_-	nucleoside hydrolase	NA	NA	NA	NA	NA
WP_020829057.1|678054_680070_-	KUP/HAK/KT family potassium transporter	NA	M1HZV6	Acanthocystis_turfacea_Chlorella_virus	34.6	5.0e-65
WP_003633200.1|680130_680823_-	ribose-5-phosphate isomerase RpiA	NA	NA	NA	NA	NA
WP_003633198.1|680822_681749_-	ribokinase	NA	A0A2H4N7X4	Lake_Baikal_phage	37.5	6.3e-07
WP_003626825.1|681832_682636_-	DUF4931 domain-containing protein	NA	NA	NA	NA	NA
WP_003633177.1|684398_684668_+	ACT domain-containing protein	NA	NA	NA	NA	NA
WP_020829058.1|684686_686030_+	PFL family protein	NA	NA	NA	NA	NA
WP_020829059.1|686178_687480_+	extracellular solute-binding protein	NA	NA	NA	NA	NA
WP_003626838.1|689479_690133_-	amino acid ABC transporter permease	NA	NA	NA	NA	NA
WP_003626839.1|690147_690789_-	amino acid ABC transporter permease	NA	NA	NA	NA	NA
WP_003626841.1|690788_691607_-	transporter substrate-binding domain-containing protein	NA	NA	NA	NA	NA
WP_003626843.1|691617_692358_-	amino acid ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	41.4	3.2e-38
WP_003626847.1|693404_693983_-	ECF transporter S component	NA	NA	NA	NA	NA
WP_020829060.1|694145_695915_-	ABC transporter ATP-binding protein	NA	W8CYL7	Bacillus_phage	28.5	1.2e-54
WP_003633124.1|695914_697645_-	ABC transporter ATP-binding protein	NA	W8CYL7	Bacillus_phage	25.9	1.1e-28
WP_012211536.1|697623_698085_-	MarR family transcriptional regulator	NA	NA	NA	NA	NA
WP_003633120.1|698226_699045_+	transporter substrate-binding domain-containing protein	NA	NA	NA	NA	NA
WP_020829061.1|699087_699756_-	type 1 glutamine amidotransferase	NA	NA	NA	NA	NA
WP_003626854.1|699769_700441_-	hypothetical protein	NA	NA	NA	NA	NA
WP_020829062.1|700717_702340_-	ATP-binding cassette domain-containing protein	NA	A0A1V0SKJ1	Klosneuvirus	27.6	1.1e-54
WP_003633113.1|702444_703527_-	M42 family peptidase	NA	NA	NA	NA	NA
WP_020829063.1|703653_704859_+	multidrug efflux MFS transporter	NA	NA	NA	NA	NA
WP_020829064.1|704882_706352_-	MFS transporter	NA	NA	NA	NA	NA
WP_020829065.1|706642_707173_+	bifunctional pyr operon transcriptional regulator/uracil phosphoribosyltransferase PyrR	NA	NA	NA	NA	NA
WP_003633105.1|707185_708514_+	uracil transporter	NA	Q9KX94	Enterobacteria_phage	35.9	2.0e-62
WP_096001369.1|709436_710666_-|transposase	IS200/IS605 family element transposase accessory protein TnpB	transposase	Q5ULQ4	Lactobacillus_virus	57.4	9.3e-123
WP_041806185.1|712312_713638_-|transposase	IS200/IS605 family element transposase accessory protein TnpB	transposase	G3MB42	Bacillus_virus	35.8	4.0e-55
WP_003627960.1|713667_714276_-|transposase	IS607 family transposase	transposase	A0A1V0SJI5	Klosneuvirus	43.2	1.5e-33
WP_020829066.1|714378_714879_-	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_041806186.1|715089_716496_-|transposase	ISLre2-like element ISLhe10 family transposase	transposase	NA	NA	NA	NA
WP_035509267.1|717767_718196_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003633083.1|718404_718605_+	cold-shock protein	NA	Q9AZD3	Lactococcus_phage	71.4	2.4e-20
WP_012211524.1|719959_720916_+|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	37.0	2.9e-39
>prophage 8
NC_021744	Lactobacillus helveticus CNRZ32, complete sequence	2225962	732826	775294	2225962	tRNA,transposase,protease	Streptococcus_phage(28.57%)	37	NA	NA
WP_041806167.1|732826_733684_-|transposase	IS982 family transposase	transposase	NA	NA	NA	NA
WP_020829069.1|733753_734980_-	MFS transporter	NA	NA	NA	NA	NA
WP_020829070.1|735131_735770_+	deoxynucleoside kinase	NA	NA	NA	NA	NA
WP_003626752.1|735805_737080_+	glycosyltransferase family 2 protein	NA	NA	NA	NA	NA
WP_003627959.1|740543_741881_-|transposase	IS66 family transposase	transposase	S5VTD3	Leptospira_phage	34.4	7.4e-49
WP_003627958.1|741855_742086_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_143441508.1|742125_742476_-	IS66 family insertion sequence element accessory protein TnpB	NA	NA	NA	NA	NA
WP_003633334.1|742469_742646_-	hypothetical protein	NA	NA	NA	NA	NA
WP_041806187.1|742710_743799_-|transposase	IS110 family transposase	transposase	A0A1X9I5Z0	Streptococcus_phage	38.2	8.4e-51
WP_003627796.1|744152_744422_+	hypothetical protein	NA	NA	NA	NA	NA
WP_012211582.1|744425_744881_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_003627794.1|744929_745514_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_003627793.1|746225_747608_-	23S rRNA (uracil(1939)-C(5))-methyltransferase RlmD	NA	A0A2K5B251	Erysipelothrix_phage	33.2	3.9e-69
WP_020829071.1|747729_748545_+	recombination regulator RecX	NA	NA	NA	NA	NA
WP_003627790.1|748555_749038_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003627789.1|749039_749501_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003627788.1|749608_750481_+	HlyC/CorC family transporter	NA	NA	NA	NA	NA
WP_003633365.1|750480_752052_+	peptide chain release factor 3	NA	A0A1S5SF82	Streptococcus_phage	26.0	7.1e-35
WP_003627786.1|752119_752401_-	DUF1827 family protein	NA	NA	NA	NA	NA
WP_041806188.1|752552_754742_-|protease	ATP-dependent Clp protease ATP-binding subunit	protease	A0A1C3S747	Escherichia_phage	40.6	2.3e-124
WP_014919161.1|756526_756709_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003627782.1|756822_757089_+	phosphocarrier protein HPr	NA	NA	NA	NA	NA
WP_003627781.1|757088_758822_+	phosphoenolpyruvate--protein phosphotransferase	NA	NA	NA	NA	NA
WP_003627780.1|759053_759452_+	transcriptional regulator Spx	NA	NA	NA	NA	NA
WP_003633395.1|759543_760284_+	adaptor protein MecA	NA	NA	NA	NA	NA
WP_041806241.1|761056_762235_-|transposase	IS256 family transposase	transposase	NA	NA	NA	NA
WP_020829073.1|762595_763213_-	DsbA family protein	NA	NA	NA	NA	NA
WP_003633400.1|763291_763906_-	CYTH domain-containing protein	NA	NA	NA	NA	NA
WP_003627775.1|764029_764662_+	GTP pyrophosphokinase family protein	NA	NA	NA	NA	NA
WP_003627773.1|764658_765471_+	NAD kinase	NA	NA	NA	NA	NA
WP_020829074.1|765454_766351_+	RluA family pseudouridine synthase	NA	A0A2H4UV25	Bodo_saltans_virus	30.1	2.3e-06
WP_003633403.1|766469_768245_+	oleate hydratase	NA	NA	NA	NA	NA
WP_003625976.1|768279_768972_-	VTT domain-containing protein	NA	NA	NA	NA	NA
WP_003625978.1|769078_770107_-	lactonase family protein	NA	NA	NA	NA	NA
WP_003633405.1|770259_773016_+	cation-transporting P-type ATPase	NA	A0A1J0FA34	Only_Syngen_Nebraska_virus	28.7	6.1e-74
WP_020829076.1|773483_774683_+	AI-2E family transporter	NA	NA	NA	NA	NA
WP_003625990.1|774733_775294_+|tRNA	tRNA (cytidine(34)-2'-O)-methyltransferase	tRNA	NA	NA	NA	NA
>prophage 9
NC_021744	Lactobacillus helveticus CNRZ32, complete sequence	2225962	870619	916009	2225962	integrase,tRNA,transposase	Lactobacillus_phage(16.67%)	49	870526:870549	907572:907595
870526:870549	attL	ACGCGTGGTGCTAGTTAAATCGTT	NA	NA	NA	NA
WP_041806190.1|870619_871477_+|transposase	IS982 family transposase	transposase	NA	NA	NA	NA
WP_003628016.1|871650_872664_-	serine hydrolase	NA	A0A1D8EXR7	Mycobacterium_phage	27.0	1.8e-07
WP_165709581.1|873225_873594_+	hypothetical protein	NA	NA	NA	NA	NA
WP_020829092.1|874214_875015_-	hypothetical protein	NA	NA	NA	NA	NA
WP_020829093.1|875380_876727_-	VirE family protein	NA	U3PCP1	Lactobacillus_phage	44.2	1.2e-91
WP_003631016.1|877024_877300_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003631017.1|877302_877530_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003631018.1|877533_877752_-	hypothetical protein	NA	NA	NA	NA	NA
WP_020829094.1|877744_877984_-	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_020829095.1|878119_878653_+	helix-turn-helix transcriptional regulator	NA	Q9T1H4	Lactobacillus_phage	63.2	4.3e-16
WP_020829096.1|878791_879949_+|integrase	site-specific integrase	integrase	P97010	Streptococcus_pyogenes_phage	38.2	4.9e-57
WP_020829097.1|880126_881479_-	Mur ligase family protein	NA	NA	NA	NA	NA
WP_003626146.1|881628_882228_+	thymidine kinase	NA	C1KFH3	Lactobacillus_virus	50.8	2.4e-47
WP_003626148.1|882244_883333_+	peptide chain release factor 1	NA	W8EDB3	Pseudomonas_phage	44.6	1.4e-05
WP_003626150.1|883325_884168_+	peptide chain release factor N(5)-glutamine methyltransferase	NA	NA	NA	NA	NA
WP_003628018.1|884173_885175_+	threonylcarbamoyl-AMP synthase	NA	S4VW33	Pandoravirus	38.1	1.2e-48
WP_003626154.1|885258_885888_+	uracil phosphoribosyltransferase	NA	NA	NA	NA	NA
WP_003626156.1|886011_886725_+	F0F1 ATP synthase subunit A	NA	NA	NA	NA	NA
WP_061287255.1|886753_886978_+	F0F1 ATP synthase subunit C	NA	NA	NA	NA	NA
WP_003628019.1|887029_887539_+	F0F1 ATP synthase subunit B	NA	NA	NA	NA	NA
WP_020829098.1|887538_888087_+	F0F1 ATP synthase subunit delta	NA	NA	NA	NA	NA
WP_020829099.1|888101_889613_+	F0F1 ATP synthase subunit alpha	NA	NA	NA	NA	NA
WP_012211672.1|889623_890586_+	F0F1 ATP synthase subunit gamma	NA	NA	NA	NA	NA
WP_003628021.1|890608_892048_+	F0F1 ATP synthase subunit beta	NA	NA	NA	NA	NA
WP_012211673.1|892059_892500_+	F0F1 ATP synthase subunit epsilon	NA	NA	NA	NA	NA
WP_003626167.1|892563_892794_+	DUF1146 domain-containing protein	NA	NA	NA	NA	NA
WP_003626168.1|892877_893867_+	rod shape-determining protein	NA	NA	NA	NA	NA
WP_003628023.1|893880_894174_+	membrane protein insertion efficiency factor YidD	NA	NA	NA	NA	NA
WP_003626171.1|894182_894410_+	DUF2969 domain-containing protein	NA	NA	NA	NA	NA
WP_003626172.1|894431_895625_+	rod shape-determining protein RodA	NA	NA	NA	NA	NA
WP_041806191.1|895784_897518_+|transposase	IS1182 family transposase	transposase	A0ZS58	Staphylococcus_virus	36.6	3.0e-87
WP_003626174.1|897498_897963_-	universal stress protein	NA	NA	NA	NA	NA
WP_003628024.1|898611_899925_-	replication-associated recombination protein A	NA	A0A127AWE7	Bacillus_phage	49.3	4.8e-101
WP_003626181.1|899924_900392_-	YueI family protein	NA	NA	NA	NA	NA
WP_003628026.1|900481_901093_-	30S ribosomal protein S4	NA	NA	NA	NA	NA
WP_014563861.1|901375_903085_+	septation ring formation regulator EzrA	NA	NA	NA	NA	NA
WP_003626187.1|903176_904337_+	cysteine desulfurase	NA	A0A1X6WFP1	Pacmanvirus	32.6	6.0e-39
WP_003628027.1|904336_905554_+|tRNA	tRNA 4-thiouridine(8) synthase ThiI	tRNA	NA	NA	NA	NA
WP_003628028.1|905688_905862_+	hypothetical protein	NA	NA	NA	NA	NA
WP_110554682.1|906042_906264_-	DUF3232 domain-containing protein	NA	NA	NA	NA	NA
WP_035509928.1|906574_907267_+	pseudouridine synthase	NA	NA	NA	NA	NA
WP_080669029.1|909277_909700_+	SLAP domain-containing protein	NA	NA	NA	NA	NA
907572:907595	attR	ACGCGTGGTGCTAGTTAAATCGTT	NA	NA	NA	NA
WP_020829106.1|909854_910436_+	DUF3232 domain-containing protein	NA	NA	NA	NA	NA
WP_035509155.1|910452_911262_+	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_023192402.1|911570_912620_+|transposase	IS30 family transposase	transposase	H7BWC8	unidentified_phage	35.9	4.7e-51
WP_023060818.1|913906_914083_+	hypothetical protein	NA	NA	NA	NA	NA
WP_143441508.1|914076_914427_+	IS66 family insertion sequence element accessory protein TnpB	NA	NA	NA	NA	NA
WP_003627958.1|914466_914697_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_003627959.1|914671_916009_+|transposase	IS66 family transposase	transposase	S5VTD3	Leptospira_phage	34.4	7.4e-49
>prophage 10
NC_021744	Lactobacillus helveticus CNRZ32, complete sequence	2225962	987128	1055083	2225962	transposase,protease	Bacillus_virus(33.33%)	52	NA	NA
WP_003627951.1|987128_988403_+|protease	ATP-dependent Clp protease ATP-binding subunit ClpX	protease	G3M9Z9	Bacillus_virus	55.6	2.3e-132
WP_003627952.1|988392_988983_+	YihA family ribosome biogenesis GTP-binding protein	NA	NA	NA	NA	NA
WP_003628082.1|990654_991659_-	diaminopimelate epimerase	NA	NA	NA	NA	NA
WP_020829126.1|991651_993025_-	aspartate kinase	NA	NA	NA	NA	NA
WP_003626731.1|995094_996411_+	diaminopimelate decarboxylase	NA	NA	NA	NA	NA
WP_003626729.1|996430_997141_+	2,3,4,5-tetrahydropyridine-2,6-dicarboxylate N-acetyltransferase	NA	NA	NA	NA	NA
WP_020829127.1|997143_998298_+	N-acetyldiaminopimelate deacetylase	NA	NA	NA	NA	NA
WP_003626725.1|998299_999235_+	4-hydroxy-tetrahydrodipicolinate synthase	NA	NA	NA	NA	NA
WP_003626724.1|999227_1000007_+	4-hydroxy-tetrahydrodipicolinate reductase	NA	NA	NA	NA	NA
WP_003626723.1|1000027_1001194_+	aminotransferase class I/II-fold pyridoxal phosphate-dependent enzyme	NA	NA	NA	NA	NA
WP_003626722.1|1001205_1002264_+	aspartate-semialdehyde dehydrogenase	NA	NA	NA	NA	NA
WP_080669031.1|1002470_1003736_+|transposase	IS3 family transposase	transposase	A0A1B1P773	Bacillus_phage	43.0	5.2e-52
WP_003628084.1|1003837_1004938_+	serine hydrolase	NA	NA	NA	NA	NA
WP_080669032.1|1004994_1005570_+	NUDIX hydrolase	NA	NA	NA	NA	NA
WP_003626719.1|1005613_1007224_-	DUF2974 domain-containing protein	NA	NA	NA	NA	NA
WP_003626716.1|1007830_1008346_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003626714.1|1008408_1009338_-	nucleoside hydrolase	NA	NA	NA	NA	NA
WP_003626713.1|1009476_1010397_+	aldo/keto reductase	NA	NA	NA	NA	NA
WP_041806193.1|1010565_1012272_+|transposase	IS1182 family transposase	transposase	A0ZS58	Staphylococcus_virus	36.7	6.0e-88
WP_003626706.1|1013852_1014488_-	GntR family transcriptional regulator	NA	NA	NA	NA	NA
WP_003626700.1|1016629_1017184_-	cysteine hydrolase	NA	G3MA16	Bacillus_virus	41.8	4.7e-34
WP_003626697.1|1017180_1018620_-	nicotinate phosphoribosyltransferase	NA	G3MA18	Bacillus_virus	41.8	1.5e-95
WP_003626695.1|1020337_1021042_+	NUDIX hydrolase	NA	G3MA14	Bacillus_virus	25.5	1.6e-07
WP_003628093.1|1022066_1022789_-	GntR family transcriptional regulator	NA	NA	NA	NA	NA
WP_012212259.1|1023543_1024785_+|transposase	IS200/IS605 family element transposase accessory protein TnpB	transposase	A0A0P0IJS6	Lactobacillus_phage	56.6	2.8e-119
WP_023192487.1|1024944_1025883_-	PTS sugar transporter subunit IIC	NA	NA	NA	NA	NA
WP_003626688.1|1025882_1027259_-	glycoside hydrolase family 1 protein	NA	NA	NA	NA	NA
WP_003626685.1|1028420_1028909_+	nitroreductase family protein	NA	NA	NA	NA	NA
WP_003626684.1|1029060_1029663_+	DUF4767 domain-containing protein	NA	NA	NA	NA	NA
WP_003626683.1|1029738_1031025_-	phosphopyruvate hydratase	NA	A0A1X9I5Z8	Streptococcus_phage	51.7	2.3e-108
WP_041806194.1|1032248_1033976_+|transposase	IS1182 family transposase	transposase	A0ZS58	Staphylococcus_virus	37.1	1.2e-88
WP_003628100.1|1033941_1034517_-	phosphatase PAP2 family protein	NA	NA	NA	NA	NA
WP_003626673.1|1036469_1037426_+	thymidylate synthase	NA	A0A0N9SH48	Staphylococcus_phage	60.5	3.6e-114
WP_020829131.1|1037440_1037959_+	dihydrofolate reductase	NA	G3MBI7	Bacillus_virus	40.1	7.6e-26
WP_023191133.1|1039354_1039510_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003628116.1|1039548_1041966_+	HAD-IC family P-type ATPase	NA	E4ZFI9	Streptococcus_phage	20.2	1.6e-17
WP_020829132.1|1042317_1043178_+	MetQ/NlpA family ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_003626662.1|1043190_1044252_+	methionine ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	35.2	1.4e-29
WP_003628117.1|1044244_1044946_+	ABC transporter permease	NA	NA	NA	NA	NA
WP_003626652.1|1046409_1046634_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003628120.1|1046821_1048225_+	class II fumarate hydratase	NA	NA	NA	NA	NA
WP_003628121.1|1048236_1049613_+	flavocytochrome c	NA	A0A2P0ZL82	Lactobacillus_phage	32.3	5.8e-57
WP_003628122.1|1049907_1050099_+	hypothetical protein	NA	NA	NA	NA	NA
WP_157999344.1|1050026_1050227_+	hypothetical protein	NA	NA	NA	NA	NA
WP_023192591.1|1050223_1050910_+	mucus-binding protein	NA	NA	NA	NA	NA
WP_003628125.1|1050896_1051199_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003626645.1|1051246_1051414_+	hypothetical protein	NA	NA	NA	NA	NA
WP_023192590.1|1051448_1052528_+	YSIRK-type signal peptide-containing protein	NA	NA	NA	NA	NA
WP_023192589.1|1052596_1052974_+	hypothetical protein	NA	NA	NA	NA	NA
WP_023192588.1|1052980_1053481_+	hypothetical protein	NA	NA	NA	NA	NA
WP_023192587.1|1053487_1053832_+	hypothetical protein	NA	NA	NA	NA	NA
WP_096001372.1|1053898_1055083_+|transposase	IS200/IS605 family element transposase accessory protein TnpB	transposase	Q5ULQ4	Lactobacillus_virus	55.9	5.4e-112
>prophage 11
NC_021744	Lactobacillus helveticus CNRZ32, complete sequence	2225962	1066082	1109533	2225962	tRNA,transposase	Planktothrix_phage(12.5%)	34	NA	NA
WP_041806251.1|1066082_1067237_+|transposase	IS256 family transposase	transposase	NA	NA	NA	NA
WP_003626617.1|1067383_1068850_+	DASS family sodium-coupled anion symporter	NA	NA	NA	NA	NA
WP_003626616.1|1068928_1069720_+	alpha/beta hydrolase	NA	NA	NA	NA	NA
WP_003628156.1|1069810_1070863_+	[citrate (pro-3S)-lyase] ligase	NA	NA	NA	NA	NA
WP_003628158.1|1070852_1071146_+	citrate lyase acyl carrier protein	NA	NA	NA	NA	NA
WP_003626613.1|1071146_1072061_+	citrate (pro-3S)-lyase subunit beta	NA	NA	NA	NA	NA
WP_035509333.1|1072032_1073592_+	citrate lyase subunit alpha	NA	NA	NA	NA	NA
WP_020829134.1|1073998_1074817_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003628182.1|1077136_1077592_+	DUF441 domain-containing protein	NA	NA	NA	NA	NA
WP_003626603.1|1077622_1077781_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003628184.1|1077802_1078636_-	energy-coupling factor transporter transmembrane protein EcfT	NA	NA	NA	NA	NA
WP_020829135.1|1078628_1080338_-	ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	32.1	3.9e-18
WP_003628186.1|1080350_1080908_-	ECF-type riboflavin transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_020829136.1|1081038_1081419_+	DUF1828 domain-containing protein	NA	NA	NA	NA	NA
WP_003626591.1|1081674_1082007_-	hypothetical protein	NA	A0A0P0I7G8	Lactobacillus_phage	43.6	1.1e-17
WP_020829137.1|1082008_1082962_-	transcription regulator	NA	NA	NA	NA	NA
WP_020829138.1|1083131_1084478_+	threonine/serine exporter family protein	NA	NA	NA	NA	NA
WP_003628193.1|1084580_1085087_+	YbhB/YbcL family Raf kinase inhibitor-like protein	NA	NA	NA	NA	NA
WP_096001364.1|1086735_1087965_+|transposase	IS110-like element ISLhe4 family transposase	transposase	A0A1X9I619	Streptococcus_phage	37.9	1.5e-64
WP_012211785.1|1088445_1088955_-|tRNA	aminoacyl-tRNA deacylase	tRNA	NA	NA	NA	NA
WP_003628222.1|1089015_1089963_+	50S ribosomal protein L11 methyltransferase	NA	NA	NA	NA	NA
WP_020829139.1|1090018_1090381_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003628226.1|1090395_1092636_+	bifunctional (p)ppGpp synthetase/guanosine-3',5'-bis(diphosphate) 3'-pyrophosphohydrolase	NA	A0A2I2L310	Orpheovirus	38.0	1.3e-10
WP_003628228.1|1092635_1093073_+|tRNA	D-tyrosyl-tRNA(Tyr) deacylase	tRNA	NA	NA	NA	NA
WP_003628230.1|1093363_1094650_+|tRNA	histidine--tRNA ligase	tRNA	A0A2K9L0H9	Tupanvirus	25.9	2.1e-21
WP_020829140.1|1094655_1096509_+|tRNA	aspartate--tRNA ligase	tRNA	A0A1V0SAC0	Catovirus	24.4	1.3e-11
WP_041806197.1|1096528_1097386_-|transposase	IS982-like element ISLh1 family transposase	transposase	NA	NA	NA	NA
WP_020829141.1|1097568_1098753_-	aminotransferase class I/II-fold pyridoxal phosphate-dependent enzyme	NA	NA	NA	NA	NA
WP_020829142.1|1100792_1101986_+	bifunctional phosphopantothenoylcysteine decarboxylase/phosphopantothenate--cysteine ligase CoaBC	NA	Q9HH70	Methanothermobacter_phage	32.2	3.3e-40
WP_035164034.1|1102101_1102959_+|transposase	IS982 family transposase	transposase	NA	NA	NA	NA
WP_003628261.1|1103127_1103964_+	aldo/keto reductase	NA	A0A2H4PQR8	Staphylococcus_phage	35.9	2.0e-36
WP_020829143.1|1105910_1107296_-	amino acid permease	NA	NA	NA	NA	NA
WP_080669025.1|1108140_1109097_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_187289107.1|1109050_1109533_-|transposase	transposase	transposase	NA	NA	NA	NA
>prophage 12
NC_021744	Lactobacillus helveticus CNRZ32, complete sequence	2225962	1204535	1294338	2225962	transposase	Lactobacillus_prophage(12.5%)	56	NA	NA
WP_041806167.1|1204535_1205393_+|transposase	IS982 family transposase	transposase	NA	NA	NA	NA
WP_003626440.1|1205891_1207505_+	ABC transporter ATP-binding protein	NA	NA	NA	NA	NA
WP_035509761.1|1207657_1208143_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003626438.1|1211261_1213196_-	PTS glucose transporter subunit IIA	NA	NA	NA	NA	NA
WP_003626436.1|1213391_1214117_+	trehalose operon repressor	NA	NA	NA	NA	NA
WP_020829171.1|1214127_1215789_+	alpha,alpha-phosphotrehalase	NA	NA	NA	NA	NA
WP_003626433.1|1215835_1217416_-	SH3-like domain-containing protein	NA	NA	NA	NA	NA
WP_003626431.1|1217564_1218002_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003626428.1|1218162_1218732_+	peptide-methionine (S)-S-oxide reductase MsrA	NA	NA	NA	NA	NA
WP_003626425.1|1218731_1219100_+	ASCH domain-containing protein	NA	NA	NA	NA	NA
WP_003626419.1|1221871_1222477_+	DUF1819 family protein	NA	NA	NA	NA	NA
WP_014918809.1|1222476_1223076_+	DUF1788 domain-containing protein	NA	NA	NA	NA	NA
WP_148286622.1|1229042_1231367_+	BREX-1 system adenine-specific DNA-methyltransferase PglX	NA	NA	NA	NA	NA
WP_020829172.1|1231552_1234039_+	BREX-1 system phosphatase PglZ type A	NA	NA	NA	NA	NA
WP_020829173.1|1234098_1235991_+	TerB N-terminal domain-containing protein	NA	Q6SEF9	Lactobacillus_prophage	50.5	2.6e-15
WP_143441652.1|1236258_1236906_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_041806199.1|1236997_1238698_-|transposase	IS1182 family transposase	transposase	A0ZS58	Staphylococcus_virus	37.1	6.0e-88
WP_051355179.1|1238925_1239270_-	hypothetical protein	NA	NA	NA	NA	NA
WP_020829174.1|1240199_1245560_+	S8 family serine peptidase	NA	A0A1B0T6A2	Bacillus_phage	32.8	4.6e-17
WP_020829176.1|1246137_1247328_+	glycosyltransferase	NA	NA	NA	NA	NA
WP_020829177.1|1247324_1248182_+	hypothetical protein	NA	NA	NA	NA	NA
WP_035509466.1|1248339_1248753_+	hypothetical protein	NA	NA	NA	NA	NA
WP_023192019.1|1248724_1249009_+	ATP-binding protein	NA	A0A059NT77	Lactococcus_phage	47.3	7.1e-18
WP_020829179.1|1250825_1252232_+	ATP-binding protein	NA	NA	NA	NA	NA
WP_020829180.1|1252308_1253763_+	DUF3387 domain-containing protein	NA	A0A2H4PQP4	Staphylococcus_phage	40.0	4.2e-05
WP_020829181.1|1253782_1255561_+	DUF262 domain-containing protein	NA	NA	NA	NA	NA
WP_023192022.1|1255620_1257306_-	hypothetical protein	NA	NA	NA	NA	NA
WP_012211889.1|1258790_1260737_-	M13 family metallopeptidase	NA	E3T4I7	Cafeteria_roenbergensis_virus	29.3	1.8e-59
WP_003628612.1|1260946_1261312_+	pyridoxamine 5'-phosphate oxidase family protein	NA	NA	NA	NA	NA
WP_035509473.1|1261586_1262933_+	amino acid permease	NA	NA	NA	NA	NA
WP_020829184.1|1262964_1264152_+	amidohydrolase	NA	NA	NA	NA	NA
WP_080669038.1|1265144_1265471_+	homocysteine S-methyltransferase family protein	NA	NA	NA	NA	NA
WP_165709012.1|1265485_1265677_+	hypothetical protein	NA	NA	NA	NA	NA
WP_020829185.1|1266851_1268126_+	DUF2075 domain-containing protein	NA	NA	NA	NA	NA
WP_020829186.1|1269926_1270460_+	hypoxanthine phosphoribosyltransferase	NA	NA	NA	NA	NA
WP_003626377.1|1270616_1270847_+	replication initiator protein A	NA	NA	NA	NA	NA
WP_012211896.1|1270981_1271533_+	metal-dependent hydrolase	NA	NA	NA	NA	NA
WP_096001373.1|1271648_1272878_+|transposase	IS200/IS605 family element transposase accessory protein TnpB	transposase	Q5ULQ4	Lactobacillus_virus	58.7	2.0e-125
WP_003626373.1|1273066_1273306_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003626368.1|1274338_1274674_+	SLAP domain-containing protein	NA	NA	NA	NA	NA
WP_020829187.1|1275056_1276436_+	branched-chain amino acid transport system II carrier protein	NA	NA	NA	NA	NA
WP_003626366.1|1277793_1279197_-	dipeptidase PepV	NA	NA	NA	NA	NA
WP_035509361.1|1279400_1280414_+	serine hydrolase	NA	NA	NA	NA	NA
WP_014563554.1|1284160_1284373_-	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_020829189.1|1285848_1286343_+	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_003626357.1|1286378_1286792_-	DUF3021 domain-containing protein	NA	NA	NA	NA	NA
WP_012211907.1|1286793_1287231_-	LytTR family transcriptional regulator	NA	NA	NA	NA	NA
WP_003628700.1|1287408_1287684_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003626351.1|1287749_1288403_-	endonuclease III	NA	NA	NA	NA	NA
WP_003614991.1|1288842_1289193_+	dihydroneopterin aldolase	NA	NA	NA	NA	NA
WP_020829190.1|1289189_1290263_+	GTP cyclohydrolase I FolE	NA	A0A0P0HSD2	Acinetobacter_phage	42.3	2.3e-37
WP_003628708.1|1290246_1291584_+	bifunctional folylpolyglutamate synthase/dihydrofolate synthase	NA	NA	NA	NA	NA
WP_003628709.1|1291573_1292665_+	dihydropteroate synthase	NA	NA	NA	NA	NA
WP_003621227.1|1292676_1293213_+	NUDIX domain-containing protein	NA	NA	NA	NA	NA
WP_081371216.1|1293633_1293801_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_023192527.1|1294092_1294338_-|transposase	IS5 family transposase	transposase	NA	NA	NA	NA
>prophage 13
NC_021744	Lactobacillus helveticus CNRZ32, complete sequence	2225962	1298699	1356006	2225962	integrase,tRNA,transposase	unidentified_phage(12.5%)	53	1302808:1302867	1316840:1318026
WP_003627959.1|1298699_1300037_-|transposase	IS66 family transposase	transposase	S5VTD3	Leptospira_phage	34.4	7.4e-49
WP_003627958.1|1300011_1300242_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_143441508.1|1300281_1300632_-	IS66 family insertion sequence element accessory protein TnpB	NA	NA	NA	NA	NA
WP_003633334.1|1300625_1300802_-	hypothetical protein	NA	NA	NA	NA	NA
WP_023192585.1|1301507_1302539_+|transposase	IS3 family transposase	transposase	A0A0C5AC89	Paenibacillus_phage	39.2	1.4e-34
1302808:1302867	attL	ACGCCGATTGTAAAATTAACTTGAACACTTTGTAGAAAATAAAAGTCCATTTGGACCTGT	NA	NA	NA	NA
WP_023192402.1|1302911_1303961_+|transposase	IS30 family transposase	transposase	H7BWC8	unidentified_phage	35.9	4.7e-51
WP_023061119.1|1304674_1305313_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003626321.1|1305429_1306050_+|integrase	tyrosine-type recombinase/integrase	integrase	E2ELN7	Clostridium_phage	36.4	4.3e-20
WP_023190388.1|1306306_1306585_-	Na+/H+ antiporter family protein	NA	NA	NA	NA	NA
WP_003626318.1|1306882_1308223_-	NAD(P)/FAD-dependent oxidoreductase	NA	NA	NA	NA	NA
WP_020829194.1|1308387_1308906_+	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_003628750.1|1309053_1309878_+	alpha/beta hydrolase	NA	NA	NA	NA	NA
WP_003628753.1|1309874_1310225_+	alpha/beta hydrolase	NA	NA	NA	NA	NA
WP_014563530.1|1310381_1311140_+	NADPH-dependent oxidoreductase	NA	NA	NA	NA	NA
WP_003628763.1|1311295_1311604_+	ACT domain-containing protein	NA	NA	NA	NA	NA
WP_003628764.1|1311687_1312170_-	TetR/AcrR family transcriptional regulator	NA	NA	NA	NA	NA
WP_003628766.1|1312189_1312780_-	hypothetical protein	NA	NA	NA	NA	NA
WP_023192470.1|1312834_1313248_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003628771.1|1313256_1313553_-	hypothetical protein	NA	NA	NA	NA	NA
WP_020829195.1|1313545_1314406_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003628775.1|1314619_1315138_+	N-acetyltransferase GCN5	NA	M1PSC3	Streptococcus_phage	38.4	5.1e-22
WP_003626288.1|1315226_1315694_+	DNA starvation/stationary phase protection protein	NA	NA	NA	NA	NA
WP_023192402.1|1315745_1316795_-|transposase	IS30 family transposase	transposase	H7BWC8	unidentified_phage	35.9	4.7e-51
WP_020829196.1|1318543_1319161_-	glycerol-3-phosphate 1-O-acyltransferase PlsY	NA	NA	NA	NA	NA
1316840:1318026	attR	ACAGGTCCAAATGGACTTTTATTTTCTACAAAGTGTTCAAGTTAATTTTACAATCGGCGTCTAAAATAAAAAAGGCAGTAAGCGATAATTTTTGCTTACTGTCTTTTTTATCATCGGTAAATTGCAATTGCCCGCTTACCGCTCCTTTTACTTTGCTAAAGAAATGCGGAAGGCTAATTCTTTGCATTTTTCAAGCAATGAATCTTTTAATCAGTTAATTAAAGATCTAAATAAAAATGAACTAAAACAAAATAAATTGCCAGATAAACTTAAAAATGTATTACGTCCATATTAAAAAGAGGATTTCAATTGGCTTAATACACTAGTTAATTACAATTTTGGCGGCATTCTAGCTGATGAAATGGGATTAGGTAAGACAATACAAGTAATATCCTTATTGTTAGCTCACCAAAAGAAAGACAGTACCAATTTAGTAGTAACTCCAGCATCAGTTATCTATAACAGGGAGAATGAGGCACAAAAATTTGCGCCCGAACTTAAAACCGCTGTGCTTGTTGGAACTAAAAAAGAACGAACACAAATTTTAGCCAATGCATCCAAATATGATCTATTGATTACTTCATACCAATCTTTAAACCGTGACTTAGAAGCTTATCAAAAACTTGTTTTTAATATACAGATCCTTGATGAAGCCCAAAATATTAAGAATCATCAATCGATTACAGCTCAATCCGTTAAAGTAATTAAAGCTCATCATAAACTCGCTTTAACCGGAACACCGATAGAAAACAAATTAAGTGAATTATGGAGTGTTTTTGATTATTTAATGCCCAACTTTTTAGGATCATACTTAGATTTTAAGAAAAAGTTTGAACTACCAATAATTAAGGATGAGGATGAAGAAGCCGAAAAACAATTGGTTGAAATGGTTACTCCATTCATTTTGCATCGACTAAAGAAAGACGTTCTGAATGATTTGCCCGCAAAGGAAGAAGAGATTGTTTATGTTAATATGGGATCTAAACAATCCGAATTATATAAACTGCAAACGCAGAAATTAATTGCTGAATTGTCTTGCCAAGGGGATGCAGAGTTTAAACGCGCTCATTTTGAAATTTTTGCTCAGATTACTAAGTTGCGCGAGATATGCTGTGATCCTCACTTGTTATATGAGAATTATCACGGCAATTCAGGTAAATTAATTGCGACTATTGATTTGATTAAAG	NA	NA	NA	NA
WP_023192732.1|1319257_1321204_+	DNA topoisomerase IV subunit B	NA	G3M9Z3	Bacillus_virus	41.0	3.5e-116
WP_020829198.1|1321220_1323677_+	DNA topoisomerase IV subunit A	NA	G3M9Z5	Bacillus_virus	31.3	3.0e-96
WP_023192733.1|1323827_1324790_+	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_003626273.1|1324822_1325758_+	manganese-dependent inorganic pyrophosphatase	NA	NA	NA	NA	NA
WP_003626271.1|1325842_1326427_+	peptidylprolyl isomerase	NA	A0A1V0S9I2	Catovirus	44.6	6.3e-29
WP_003626270.1|1326456_1326810_-	transcriptional regulator	NA	NA	NA	NA	NA
WP_023061618.1|1329286_1329541_-	GlsB/YeaQ/YmgE family stress response membrane protein	NA	NA	NA	NA	NA
WP_003626263.1|1331095_1331299_+	SLAP domain-containing protein	NA	NA	NA	NA	NA
WP_003628839.1|1331363_1331720_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003626259.1|1331926_1332535_+	DUF5052 family protein	NA	A0A2K9VCV0	Lactobacillus_phage	44.2	4.8e-40
WP_003626255.1|1333088_1333544_-	hypothetical protein	NA	NA	NA	NA	NA
WP_014563506.1|1334058_1335141_+	tyrosine recombinase XerS	NA	NA	NA	NA	NA
WP_020829202.1|1335343_1336225_-	DegV family protein	NA	A0A0N9SI50	Staphylococcus_phage	35.9	4.4e-10
WP_003627403.1|1336299_1336716_-	MarR family transcriptional regulator	NA	NA	NA	NA	NA
WP_003628850.1|1336864_1338559_+	NFACT family protein	NA	Q84500	Paramecium_bursaria_Chlorella_virus	40.0	3.2e-09
WP_020829203.1|1338626_1341818_-	carbamoyl phosphate synthase large subunit	NA	NA	NA	NA	NA
WP_020829204.1|1341821_1342877_-	carbamoyl phosphate synthase small subunit	NA	NA	NA	NA	NA
WP_020829205.1|1342879_1343791_-	RluA family pseudouridine synthase	NA	A0A2H4UV25	Bodo_saltans_virus	28.9	2.1e-10
WP_003627408.1|1343783_1344248_-	signal peptidase II	NA	NA	NA	NA	NA
WP_003628852.1|1344254_1345931_-	formate--tetrahydrofolate ligase	NA	NA	NA	NA	NA
WP_051355169.1|1345927_1346212_-	hypothetical protein	NA	NA	NA	NA	NA
WP_020829206.1|1347513_1348638_-	class I SAM-dependent RNA methyltransferase	NA	NA	NA	NA	NA
WP_003627414.1|1349099_1349516_-	DivIVA domain-containing protein	NA	NA	NA	NA	NA
WP_003627415.1|1349606_1350176_-	DUF1273 domain-containing protein	NA	NA	NA	NA	NA
WP_003628860.1|1350239_1350872_+	Holliday junction resolvase RecU	NA	A0A1B1P798	Bacillus_phage	31.2	1.6e-17
WP_020829207.1|1350868_1353148_+	penicillin-binding protein	NA	NA	NA	NA	NA
WP_020829208.1|1353355_1353976_-	endonuclease III	NA	NA	NA	NA	NA
WP_003627421.1|1353977_1354622_-	DnaD domain protein	NA	A0A0N7AE27	Bacillus_phage	36.0	4.2e-10
WP_003627422.1|1354707_1356006_-|tRNA	asparagine--tRNA ligase	tRNA	M1PB22	Moumouvirus	27.8	1.8e-47
>prophage 14
NC_021744	Lactobacillus helveticus CNRZ32, complete sequence	2225962	1374478	1477665	2225962	head,terminase,tail,plate,capsid,portal,integrase,tRNA,transposase	Lactobacillus_phage(69.81%)	111	1374382:1374408	1463058:1463084
1374382:1374408	attL	TATACGCGTGGTGCTAGTTAAATCGTT	NA	NA	NA	NA
WP_041806202.1|1374478_1375336_+|transposase	IS982 family transposase	transposase	NA	NA	NA	NA
WP_003627439.1|1375393_1375585_+	hypothetical protein	NA	NA	NA	NA	NA
WP_020829214.1|1376850_1377609_-	hypothetical protein	NA	NA	NA	NA	NA
WP_020829215.1|1377652_1378483_-	hypothetical protein	NA	NA	NA	NA	NA
WP_020829216.1|1378493_1379339_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003627445.1|1379338_1380046_-	ABC transporter ATP-binding protein	NA	A0A2H4PQG7	Staphylococcus_phage	26.9	3.7e-15
WP_003627446.1|1380047_1380413_-	GntR family transcriptional regulator	NA	NA	NA	NA	NA
WP_003628899.1|1380687_1381929_-	peptidase T	NA	NA	NA	NA	NA
WP_003628901.1|1381948_1382746_-	Nif3-like dinuclear metal center hexameric protein	NA	NA	NA	NA	NA
WP_003628903.1|1382738_1383425_-	SAM-dependent methyltransferase	NA	NA	NA	NA	NA
WP_003627455.1|1383924_1384581_+	M23 family metallopeptidase	NA	NA	NA	NA	NA
WP_020829217.1|1384630_1385743_-	RNA polymerase sigma factor RpoD	NA	M4SMP8	Cyanophage	34.8	3.2e-37
WP_020829218.1|1385759_1387595_-	DNA primase	NA	A0A0K1LMQ9	Caulobacter_phage	34.8	4.5e-57
WP_003628907.1|1387620_1389684_-|tRNA	glycine--tRNA ligase subunit beta	tRNA	NA	NA	NA	NA
WP_003627460.1|1389676_1390594_-|tRNA	glycine--tRNA ligase subunit alpha	tRNA	NA	NA	NA	NA
WP_003627462.1|1390847_1391600_-	DNA repair protein RecO	NA	NA	NA	NA	NA
WP_003627464.1|1391600_1392506_-	GTPase Era	NA	NA	NA	NA	NA
WP_003628912.1|1392505_1393030_-	rRNA maturation RNase YbeY	NA	NA	NA	NA	NA
WP_020829219.1|1393032_1393992_-	PhoH family protein	NA	W8D063	Erwinia_phage	46.1	2.2e-47
WP_003628914.1|1394017_1394461_-	GatB/YqeY domain-containing protein	NA	A0A292GL36	Xanthomonas_phage	32.9	2.0e-11
WP_002880182.1|1394571_1394748_-	30S ribosomal protein S21	NA	NA	NA	NA	NA
WP_003628916.1|1395003_1395840_+	kinase/pyrophosphorylase	NA	NA	NA	NA	NA
WP_020829220.1|1396211_1396643_+	M23 family metallopeptidase	NA	NA	NA	NA	NA
WP_020829221.1|1397192_1398314_-	lysin	NA	Q71JA9	Lactobacillus_phage	95.2	1.3e-200
WP_035509854.1|1398376_1398766_-	hypothetical protein	NA	L0P6Z4	Lactobacillus_phage	96.1	9.6e-58
WP_020829223.1|1398774_1399011_-	hypothetical protein	NA	L0P6E4	Lactobacillus_phage	82.3	2.8e-28
WP_020829224.1|1398994_1399204_-	hypothetical protein	NA	L0P8N8	Lactobacillus_phage	93.5	1.3e-08
WP_023192647.1|1399223_1399628_-	hypothetical protein	NA	NA	NA	NA	NA
WP_020829225.1|1399587_1399779_-	XkdX family protein	NA	NA	NA	NA	NA
WP_020829226.1|1399795_1400401_-	hypothetical protein	NA	NA	NA	NA	NA
WP_020829228.1|1400776_1401172_-	hypothetical protein	NA	NA	NA	NA	NA
WP_023192643.1|1401168_1401597_-	hypothetical protein	NA	NA	NA	NA	NA
WP_020829230.1|1401607_1403524_-	hypothetical protein	NA	L0P6E1	Lactobacillus_phage	43.9	4.5e-108
WP_020829231.1|1403541_1404111_-	DUF2313 domain-containing protein	NA	L0P8N4	Lactobacillus_phage	96.3	7.6e-96
WP_020829232.1|1404103_1405249_-|plate	baseplate J/gp47 family protein	plate	L0P7C2	Lactobacillus_phage	91.6	9.3e-202
WP_035509842.1|1405238_1405652_-	DUF2634 domain-containing protein	NA	L0P6H1	Lactobacillus_phage	94.9	4.6e-66
WP_020829234.1|1405677_1406022_-	DUF2577 domain-containing protein	NA	L0P6Y6	Lactobacillus_phage	91.2	5.1e-55
WP_020829235.1|1405994_1407062_-	hypothetical protein	NA	L0P6D8	Lactobacillus_phage	95.8	2.0e-190
WP_051356301.1|1407058_1407757_-	hypothetical protein	NA	L0P8M9	Lactobacillus_phage	95.2	4.8e-116
WP_035509839.1|1407763_1408237_-	hypothetical protein	NA	L0P7B8	Lactobacillus_phage	91.7	4.1e-55
WP_020829238.1|1411042_1411459_-	hypothetical protein	NA	L0P6Y3	Lactobacillus_phage	98.6	1.9e-67
WP_020829239.1|1411471_1411948_-	hypothetical protein	NA	L0P6D4	Lactobacillus_phage	97.4	1.5e-81
WP_020829240.1|1411961_1413422_-|tail	phage tail sheath subtilisin-like domain-containing protein	tail	L0P8M7	Lactobacillus_phage	90.5	5.3e-250
WP_020829241.1|1413425_1413629_-	hypothetical protein	NA	L0P7B3	Lactobacillus_phage	80.6	1.7e-21
WP_023192641.1|1413597_1414023_-	hypothetical protein	NA	L0P6G4	Lactobacillus_phage	93.6	6.7e-73
WP_020829242.1|1414019_1414421_-	HK97 gp10 family phage protein	NA	X2CXN4	Lactobacillus_phage	55.6	7.9e-39
WP_020829243.1|1414417_1414780_-	hypothetical protein	NA	A9D9T8	Lactobacillus_prophage	68.3	2.4e-39
WP_020829244.1|1414776_1415148_-|head,tail	phage head-tail connector protein	head,tail	L0P6D1	Lactobacillus_phage	94.3	2.2e-59
WP_020829245.1|1415165_1416242_-|capsid	phage capsid protein	capsid	L0P8M2	Lactobacillus_phage	95.0	7.0e-191
WP_020829246.1|1416256_1416796_-	phage scaffolding protein	NA	L0P7B0	Lactobacillus_phage	97.2	3.2e-88
WP_020829247.1|1417320_1418394_-|capsid	minor capsid protein	capsid	A9D9S7	Lactobacillus_prophage	58.9	3.5e-118
WP_023192640.1|1418396_1419848_-|portal	phage portal protein	portal	X2CY64	Lactobacillus_phage	69.3	1.1e-183
WP_020829249.1|1419853_1421083_-|terminase	PBSX family phage terminase large subunit	terminase	A9D9R9	Lactobacillus_prophage	71.9	2.0e-181
WP_020829250.1|1421072_1421588_-|terminase	terminase small subunit	terminase	Q20DD9	Lactobacillus_phage	46.3	2.9e-30
WP_035509820.1|1422192_1422636_-	hypothetical protein	NA	Q6SEE2	Lactobacillus_prophage	62.9	6.2e-45
WP_020829252.1|1422768_1423314_-	hypothetical protein	NA	L0P8Q7	Lactobacillus_phage	62.2	1.6e-05
WP_020829253.1|1423319_1423670_-	VRR-NUC domain-containing protein	NA	L0P7E5	Lactobacillus_phage	83.3	3.2e-52
WP_020829254.1|1423825_1424059_-	hypothetical protein	NA	NA	NA	NA	NA
WP_023192634.1|1424111_1424291_-	hypothetical protein	NA	NA	NA	NA	NA
WP_035509817.1|1424291_1424495_-	hypothetical protein	NA	Q9T1H0	Lactobacillus_phage	62.3	3.9e-18
WP_020829255.1|1424481_1424655_-	hypothetical protein	NA	L0P706	Lactobacillus_phage	81.8	1.7e-19
WP_020829256.1|1424684_1424957_-	hypothetical protein	NA	NA	NA	NA	NA
WP_020829257.1|1424949_1425222_-	DUF1599 domain-containing protein	NA	F8J1G5	Lactobacillus_phage	48.8	2.2e-13
WP_023192633.1|1425221_1425665_-	hypothetical protein	NA	NA	NA	NA	NA
WP_020829258.1|1425654_1426140_-	hypothetical protein	NA	NA	NA	NA	NA
WP_020829259.1|1426382_1427696_-	virulence-associated protein E	NA	U3PCP1	Lactobacillus_phage	53.7	2.1e-128
WP_020829260.1|1427688_1428489_-	bifunctional DNA primase/polymerase	NA	U3PBE3	Lactobacillus_phage	65.5	1.3e-88
WP_020829261.1|1428566_1428875_-	hypothetical protein	NA	NA	NA	NA	NA
WP_020829262.1|1428890_1429475_-	hypothetical protein	NA	U3PDN3	Lactobacillus_phage	49.2	2.4e-44
WP_020829263.1|1429474_1430239_-	AAA family ATPase	NA	U3PIS9	Lactobacillus_phage	59.2	2.7e-72
WP_020829264.1|1430240_1430414_-	sporulation protein Cse60	NA	NA	NA	NA	NA
WP_020829265.1|1430410_1431682_-	DEAD/DEAH box helicase	NA	U3PFS7	Lactobacillus_phage	58.9	2.2e-135
WP_020829266.1|1431799_1432159_-	hypothetical protein	NA	NA	NA	NA	NA
WP_020829267.1|1432161_1432512_-	hypothetical protein	NA	NA	NA	NA	NA
WP_020829268.1|1432508_1432985_-	siphovirus Gp157 family protein	NA	A0A0A1EL06	Lactobacillus_phage	40.3	1.6e-22
WP_020829270.1|1433194_1433494_-	hypothetical protein	NA	NA	NA	NA	NA
WP_020829271.1|1433499_1433709_-	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_020829272.1|1433998_1434343_+	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_020829273.1|1434335_1434737_+	ImmA/IrrE family metallo-endopeptidase	NA	X2CXW8	Lactobacillus_phage	36.8	1.6e-20
WP_020829274.1|1434805_1435645_+	hypothetical protein	NA	NA	NA	NA	NA
WP_020829275.1|1435682_1435904_+	hypothetical protein	NA	E9LUL0	Lactobacillus_phage	61.3	3.9e-16
WP_020829276.1|1436093_1437215_+|integrase	site-specific integrase	integrase	A0A0M9JJ77	Lactobacillus_phage	42.2	4.0e-72
WP_012211982.1|1437316_1438195_+	YitT family protein	NA	NA	NA	NA	NA
WP_035509283.1|1442289_1442574_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003628930.1|1442785_1443391_-	LysR family transcriptional regulator substrate-binding protein	NA	NA	NA	NA	NA
WP_003627475.1|1443393_1443555_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003628932.1|1443570_1444737_-	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_003627477.1|1444857_1445394_-	citrate lyase holo-[acyl-carrier protein] synthase	NA	NA	NA	NA	NA
WP_020829277.1|1448696_1449551_-	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_020829278.1|1449679_1451953_+	HAD-IC family P-type ATPase	NA	A7IUR5	Paramecium_bursaria_Chlorella_virus	24.3	1.8e-42
WP_003627493.1|1452021_1452522_-	SLAP domain-containing protein	NA	NA	NA	NA	NA
WP_041806204.1|1453211_1454069_+|transposase	IS982 family transposase	transposase	NA	NA	NA	NA
WP_012211991.1|1455239_1456034_+	homoserine O-succinyltransferase	NA	NA	NA	NA	NA
WP_003628968.1|1457147_1457675_-	adenine phosphoribosyltransferase	NA	NA	NA	NA	NA
WP_012211993.1|1457779_1460053_-	single-stranded-DNA-specific exonuclease RecJ	NA	A7KV88	Bacillus_phage	35.9	3.7e-77
WP_003627502.1|1460173_1460863_-	class A sortase	NA	NA	NA	NA	NA
WP_020829279.1|1460865_1462704_-	elongation factor 4	NA	E4ZFJ7	Streptococcus_phage	24.1	5.2e-21
WP_003628994.1|1462872_1463088_+	hypothetical protein	NA	NA	NA	NA	NA
1463058:1463084	attR	TATACGCGTGGTGCTAGTTAAATCGTT	NA	NA	NA	NA
WP_003629004.1|1463942_1465097_-	molecular chaperone DnaJ	NA	A0A0P0YNN4	Yellowstone_lake_phycodnavirus	29.9	2.8e-20
WP_003627506.1|1465178_1467005_-	molecular chaperone DnaK	NA	A0A0N9QXN8	Chrysochromulina_ericina_virus	49.3	5.4e-143
WP_020829280.1|1467022_1467640_-	nucleotide exchange factor GrpE	NA	NA	NA	NA	NA
WP_003627509.1|1467655_1468705_-	heat-inducible transcriptional repressor HrcA	NA	NA	NA	NA	NA
WP_003629011.1|1468874_1469837_-	riboflavin biosynthesis protein RibF	NA	A0A1V0SD03	Indivirus	30.1	6.1e-05
WP_003629013.1|1469842_1470736_-|tRNA	tRNA pseudouridine(55) synthase TruB	tRNA	NA	NA	NA	NA
WP_003627512.1|1470787_1471153_-	ribosome-binding factor A	NA	NA	NA	NA	NA
WP_020829281.1|1471172_1473785_-	translation initiation factor IF-2	NA	A0A2H4UTS4	Bodo_saltans_virus	24.5	9.7e-21
WP_003627514.1|1473789_1474101_-	ribosomal L7Ae/L30e/S12e/Gadd45 family protein	NA	NA	NA	NA	NA
WP_003629016.1|1474103_1474400_-	YlxR family protein	NA	NA	NA	NA	NA
WP_020829283.1|1474409_1475591_-	transcription termination/antitermination protein NusA	NA	NA	NA	NA	NA
WP_003629018.1|1475610_1476087_-	ribosome maturation factor RimP	NA	NA	NA	NA	NA
WP_041806186.1|1476258_1477665_-|transposase	ISLre2-like element ISLhe10 family transposase	transposase	NA	NA	NA	NA
>prophage 15
NC_021744	Lactobacillus helveticus CNRZ32, complete sequence	2225962	1482119	1545400	2225962	tRNA,transposase,protease	Prochlorococcus_phage(13.33%)	52	NA	NA
WP_003627521.1|1482119_1483817_-|tRNA	proline--tRNA ligase	tRNA	NA	NA	NA	NA
WP_020829285.1|1483859_1485116_-|protease	RIP metalloprotease RseP	protease	NA	NA	NA	NA
WP_003629019.1|1485126_1485942_-	phosphatidate cytidylyltransferase	NA	NA	NA	NA	NA
WP_003627524.1|1485943_1486678_-	isoprenyl transferase	NA	R9W0U9	Flavobacterium_phage	39.0	2.5e-22
WP_003627525.1|1486680_1487238_-	ribosome recycling factor	NA	NA	NA	NA	NA
WP_003629020.1|1487237_1487963_-	UMP kinase	NA	NA	NA	NA	NA
WP_003627529.1|1488101_1489127_-	elongation factor Ts	NA	NA	NA	NA	NA
WP_003627530.1|1489160_1489934_-	30S ribosomal protein S2	NA	NA	NA	NA	NA
WP_003629021.1|1490095_1491127_-	GIY-YIG nuclease family protein	NA	NA	NA	NA	NA
WP_003629022.1|1491192_1491807_+	1-acyl-sn-glycerol-3-phosphate acyltransferase	NA	NA	NA	NA	NA
WP_020829286.1|1491861_1493043_+	class I SAM-dependent methyltransferase	NA	A0A2K9L4K8	Tupanvirus	36.1	4.7e-47
WP_003629024.1|1493101_1495045_-	M13 family metallopeptidase	NA	E3T4I7	Cafeteria_roenbergensis_virus	28.4	1.2e-60
WP_080669031.1|1496624_1497890_-|transposase	IS3 family transposase	transposase	A0A1B1P773	Bacillus_phage	43.0	5.2e-52
WP_096001374.1|1499454_1500684_-|transposase	IS200/IS605 family element transposase accessory protein TnpB	transposase	Q5ULQ4	Lactobacillus_virus	57.7	3.5e-122
WP_096001375.1|1503240_1504470_+|transposase	IS110 family transposase	transposase	A0A1X9I619	Streptococcus_phage	37.9	1.5e-64
WP_003627540.1|1504768_1504987_-	YneF family protein	NA	NA	NA	NA	NA
WP_003627541.1|1505049_1505313_-	DUF896 domain-containing protein	NA	NA	NA	NA	NA
WP_020829287.1|1505464_1506091_+	transcriptional repressor LexA	NA	A0A1B2APZ1	Phage_Wrath	53.6	8.9e-13
WP_020829288.1|1506119_1506905_-	SGNH/GDSL hydrolase family protein	NA	Q6SEC0	Lactobacillus_prophage	24.0	2.0e-06
WP_003629071.1|1507945_1508293_-	50S ribosomal protein L19	NA	NA	NA	NA	NA
WP_003629072.1|1508405_1509125_-|tRNA	tRNA (guanosine(37)-N1)-methyltransferase TrmD	tRNA	NA	NA	NA	NA
WP_003629074.1|1509114_1509630_-	ribosome maturation factor RimM	NA	NA	NA	NA	NA
WP_003627549.1|1509698_1509971_-	30S ribosomal protein S16	NA	NA	NA	NA	NA
WP_003627550.1|1510061_1511492_-	signal recognition particle protein	NA	NA	NA	NA	NA
WP_003627552.1|1511496_1511838_-	transcriptional regulator	NA	NA	NA	NA	NA
WP_080516431.1|1511952_1512909_-|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	32.0	8.2e-26
WP_020829289.1|1513034_1514462_+	amino acid permease	NA	NA	NA	NA	NA
WP_025283681.1|1514528_1514819_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003627558.1|1515015_1516437_-	C69 family dipeptidase	NA	NA	NA	NA	NA
WP_003627559.1|1516479_1517772_-	signal recognition particle-docking protein FtsY	NA	NA	NA	NA	NA
WP_020829290.1|1517772_1521342_-	chromosome segregation protein SMC	NA	NA	NA	NA	NA
WP_003627561.1|1521357_1522044_-	ribonuclease III	NA	M1HR51	Paramecium_bursaria_Chlorella_virus	30.6	8.2e-20
WP_035504770.1|1522153_1523917_-	oligopeptide ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_020829291.1|1524128_1525880_-	oligopeptide ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_003627565.1|1526084_1527014_-	ABC transporter permease	NA	NA	NA	NA	NA
WP_012212411.1|1527028_1527988_-	ABC transporter permease	NA	NA	NA	NA	NA
WP_003629095.1|1527990_1528977_-	ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	28.1	3.7e-13
WP_020829292.1|1528980_1530015_-	ABC transporter ATP-binding protein	NA	G3M9Y6	Bacillus_virus	28.2	6.0e-14
WP_003627571.1|1530135_1530378_-	acyl carrier protein	NA	E3SSM9	Prochlorococcus_phage	56.1	8.1e-07
WP_020829293.1|1530408_1531410_-	phosphate acyltransferase PlsX	NA	NA	NA	NA	NA
WP_012212019.1|1531430_1533461_-	ATP-dependent DNA helicase RecG	NA	NA	NA	NA	NA
WP_003627574.1|1533462_1535124_-	DAK2 domain-containing protein	NA	NA	NA	NA	NA
WP_003547910.1|1535145_1535508_-	Asp23/Gls24 family envelope stress response protein	NA	NA	NA	NA	NA
WP_003627575.1|1536523_1536709_+	50S ribosomal protein L28	NA	NA	NA	NA	NA
WP_003627577.1|1536815_1537121_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003627578.1|1537162_1537849_-	thiamine diphosphokinase	NA	NA	NA	NA	NA
WP_003627579.1|1537848_1538499_-	ribulose-phosphate 3-epimerase	NA	NA	NA	NA	NA
WP_003627580.1|1538511_1539402_-	ribosome small subunit-dependent GTPase A	NA	NA	NA	NA	NA
WP_003627581.1|1539402_1541418_-	Stk1 family PASTA domain-containing Ser/Thr kinase	NA	Q8QNG7	Ectocarpus_siliculosus_virus	29.2	1.8e-19
WP_003629102.1|1541407_1542163_-	Stp1/IreP family PP2C-type Ser/Thr phosphatase	NA	NA	NA	NA	NA
WP_041806167.1|1543086_1543944_-|transposase	IS982 family transposase	transposase	NA	NA	NA	NA
WP_020829295.1|1544455_1545400_-|tRNA	methionyl-tRNA formyltransferase	tRNA	E3SNR5	Prochlorococcus_phage	30.2	6.2e-10
>prophage 16
NC_021744	Lactobacillus helveticus CNRZ32, complete sequence	2225962	1555204	1617559	2225962	transposase	unidentified_phage(14.29%)	53	NA	NA
WP_041806207.1|1555204_1556254_-|transposase	IS30 family transposase	transposase	H7BWC8	unidentified_phage	36.0	5.8e-49
WP_003627597.1|1556391_1557240_-	bifunctional methylenetetrahydrofolate dehydrogenase/methenyltetrahydrofolate cyclohydrolase	NA	A0A249XZQ2	Enterococcus_phage	43.1	1.9e-42
WP_020829298.1|1557298_1557691_-	transcription antitermination factor NusB	NA	NA	NA	NA	NA
WP_003629148.1|1557698_1558124_-	Asp23/Gls24 family envelope stress response protein	NA	NA	NA	NA	NA
WP_003627601.1|1558141_1558711_-	elongation factor P	NA	NA	NA	NA	NA
WP_003629150.1|1558794_1559904_-	aminopeptidase P family protein	NA	NA	NA	NA	NA
WP_003629151.1|1560013_1560304_-	50S ribosomal protein L27	NA	NA	NA	NA	NA
WP_003629152.1|1560322_1560634_-	50S ribosomal protein L21	NA	NA	NA	NA	NA
WP_020829299.1|1560800_1562168_-	DUF2325 domain-containing protein	NA	NA	NA	NA	NA
WP_003629154.1|1562306_1563332_+	branched-chain amino acid aminotransferase	NA	NA	NA	NA	NA
WP_003627607.1|1563375_1564053_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003547962.1|1564118_1564298_-	4-oxalocrotonate tautomerase	NA	NA	NA	NA	NA
WP_023192520.1|1566809_1567025_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003629190.1|1568827_1569724_+	alpha/beta hydrolase	NA	L7RDF8	Acanthamoeba_polyphaga_moumouvirus	26.6	1.8e-11
WP_003627613.1|1569732_1570089_+	arsenate reductase family protein	NA	M1PLC0	Streptococcus_phage	38.6	5.0e-13
WP_003629197.1|1570803_1573185_+	Xaa-Pro dipeptidyl-peptidase	NA	NA	NA	NA	NA
WP_003627616.1|1573236_1573662_-	peptide-methionine (R)-S-oxide reductase MsrB	NA	NA	NA	NA	NA
WP_003627617.1|1573654_1573936_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003629199.1|1574050_1574914_-	sugar transporter	NA	NA	NA	NA	NA
WP_003627621.1|1575087_1575258_-	LPXTG cell wall anchor domain-containing protein	NA	NA	NA	NA	NA
WP_003627622.1|1575236_1576199_-	mucus-binding protein	NA	NA	NA	NA	NA
WP_020829301.1|1577560_1580749_-	carbamoyl-phosphate synthase large subunit	NA	NA	NA	NA	NA
WP_003627625.1|1580741_1581827_-	glutamine-hydrolyzing carbamoyl-phosphate synthase small subunit	NA	R4TGJ8	Halovirus	35.5	2.5e-55
WP_003623962.1|1581826_1583104_-	dihydroorotase	NA	NA	NA	NA	NA
WP_020829302.1|1583103_1584060_-	aspartate carbamoyltransferase catalytic subunit	NA	M1HGA5	Paramecium_bursaria_Chlorella_virus	34.1	1.6e-26
WP_003627628.1|1584204_1584747_-	bifunctional pyr operon transcriptional regulator/uracil phosphoribosyltransferase PyrR	NA	NA	NA	NA	NA
WP_003627629.1|1584913_1585837_-	dihydroorotate dehydrogenase	NA	NA	NA	NA	NA
WP_003629217.1|1586091_1586796_+	orotidine-5'-phosphate decarboxylase	NA	NA	NA	NA	NA
WP_003627631.1|1586797_1587421_+	orotate phosphoribosyltransferase	NA	A0A0B5IW17	Pandoravirus	32.9	9.1e-26
WP_023191716.1|1587645_1587924_-	type II toxin-antitoxin system RelB/DinJ family antitoxin	NA	NA	NA	NA	NA
WP_003627637.1|1589837_1592474_+	cation-translocating P-type ATPase	NA	M1IAU8	Acanthocystis_turfacea_Chlorella_virus	30.0	1.1e-83
WP_041806208.1|1592668_1593928_+|transposase	ISL3 family transposase	transposase	A0A2D1GQC1	Lysinibacillus_phage	21.3	1.1e-09
WP_096001376.1|1594165_1595395_+|transposase	IS110 family transposase	transposase	A0A1X9I619	Streptococcus_phage	38.6	4.7e-66
WP_023192018.1|1595670_1596903_-	MFS transporter	NA	NA	NA	NA	NA
WP_041806210.1|1597274_1598600_-|transposase	IS200/IS605 family element transposase accessory protein TnpB	transposase	G3MB42	Bacillus_virus	36.3	1.2e-56
WP_003627960.1|1598629_1599238_-|transposase	IS607 family transposase	transposase	A0A1V0SJI5	Klosneuvirus	43.2	1.5e-33
WP_044000222.1|1600783_1601440_-	hypothetical protein	NA	NA	NA	NA	NA
WP_041806212.1|1604135_1604993_-|transposase	IS982 family transposase	transposase	NA	NA	NA	NA
WP_096001393.1|1605087_1605183_+|transposase	IS3 family transposase	transposase	NA	NA	NA	NA
WP_035509557.1|1607290_1607587_+	metal-sulfur cluster assembly factor	NA	NA	NA	NA	NA
WP_003627897.1|1607633_1608494_-	transporter substrate-binding domain-containing protein	NA	NA	NA	NA	NA
WP_020829309.1|1608506_1609247_-	amino acid ABC transporter ATP-binding protein	NA	G3M9Y6	Bacillus_virus	30.8	9.1e-25
WP_014563318.1|1609256_1609931_-	amino acid ABC transporter permease	NA	NA	NA	NA	NA
WP_003627894.1|1609911_1610571_-	amino acid ABC transporter permease	NA	NA	NA	NA	NA
WP_014918531.1|1610723_1610957_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004561246.1|1611344_1611512_-	hypothetical protein	NA	NA	NA	NA	NA
WP_014918530.1|1611610_1613356_-	oligopeptide ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_003627889.1|1613704_1614214_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003627890.1|1614253_1614601_-	SLAP domain-containing protein	NA	NA	NA	NA	NA
WP_146211640.1|1614673_1614889_-	IS66 family insertion sequence element accessory protein TnpB	NA	NA	NA	NA	NA
WP_003633334.1|1614882_1615059_-	hypothetical protein	NA	NA	NA	NA	NA
WP_096001377.1|1615137_1616307_-	MFS transporter	NA	NA	NA	NA	NA
WP_041806214.1|1616533_1617559_+|transposase	IS30 family transposase	transposase	H7BWC8	unidentified_phage	34.3	6.5e-45
>prophage 17
NC_021744	Lactobacillus helveticus CNRZ32, complete sequence	2225962	1628152	1783097	2225962	tRNA,bacteriocin,transposase,protease	Lactobacillus_phage(12.12%)	111	NA	NA
WP_041806162.1|1628152_1629322_-|transposase	IS256 family transposase	transposase	NA	NA	NA	NA
WP_003629407.1|1629666_1630173_+	hypothetical protein	NA	NA	NA	NA	NA
WP_041806215.1|1632231_1633626_-|transposase	ISLre2 family transposase	transposase	NA	NA	NA	NA
WP_020829317.1|1633751_1634462_-	oxidoreductase	NA	NA	NA	NA	NA
WP_003629414.1|1634481_1634889_-	OsmC family protein	NA	NA	NA	NA	NA
WP_020829318.1|1634907_1636080_-	MFS transporter	NA	NA	NA	NA	NA
WP_020829319.1|1638620_1639220_-	SLAP domain-containing protein	NA	NA	NA	NA	NA
WP_020829320.1|1639276_1639759_-	SLAP domain-containing protein	NA	NA	NA	NA	NA
WP_020829321.1|1639879_1640875_-	galactose mutarotase	NA	NA	NA	NA	NA
WP_020829322.1|1640994_1642458_-	UDP-glucose--hexose-1-phosphate uridylyltransferase	NA	NA	NA	NA	NA
WP_020829323.1|1642479_1643646_-	galactokinase	NA	NA	NA	NA	NA
WP_020829324.1|1651811_1653041_-	MFS transporter	NA	NA	NA	NA	NA
WP_110549469.1|1655031_1655118_+	type I toxin-antitoxin system Fst family toxin	NA	NA	NA	NA	NA
WP_020829325.1|1657850_1658936_+	BMP family protein	NA	A0A0A7DN02	Lactobacillus_phage	49.0	4.0e-77
WP_020829326.1|1659004_1660549_+	ABC transporter ATP-binding protein	NA	G3M9Y6	Bacillus_virus	26.9	4.0e-14
WP_020829327.1|1660529_1661693_+	ABC transporter permease	NA	NA	NA	NA	NA
WP_003627726.1|1661682_1662639_+	ABC transporter permease	NA	NA	NA	NA	NA
WP_023192402.1|1663794_1664844_+|transposase	IS30 family transposase	transposase	H7BWC8	unidentified_phage	35.9	4.7e-51
WP_041806216.1|1664909_1666187_+|transposase	ISL3 family transposase	transposase	Q6V7R1	Burkholderia_virus	23.2	1.7e-10
WP_003627020.1|1666389_1667646_-	phosphoribosylamine--glycine ligase	NA	NA	NA	NA	NA
WP_012212085.1|1667658_1669794_-	bifunctional phosphoribosylaminoimidazolecarboxamide formyltransferase/IMP cyclohydrolase	NA	Q58MG4	Prochlorococcus_phage	46.3	5.6e-75
WP_003627023.1|1669790_1670840_-	phosphoribosylformylglycinamidine cyclo-ligase	NA	A0A0E3F0L1	Synechococcus_phage	43.9	9.2e-63
WP_003627024.1|1670871_1672305_-	amidophosphoribosyltransferase	NA	A0A0M3SGR2	Mollivirus	35.1	5.3e-61
WP_012212086.1|1672280_1674512_-	phosphoribosylformylglycinamidine synthase subunit PurL	NA	A6N228	Microbacterium_phage	38.9	7.8e-144
WP_003627026.1|1674508_1675180_-	phosphoribosylformylglycinamidine synthase subunit PurQ	NA	NA	NA	NA	NA
WP_003627027.1|1675179_1675431_-	phosphoribosylformylglycinamidine synthase subunit PurS	NA	NA	NA	NA	NA
WP_003629554.1|1675430_1676147_-	phosphoribosylaminoimidazolesuccinocarboxamide synthase	NA	A0A1D7SPE1	Cyanophage	38.7	3.7e-39
WP_023060818.1|1676351_1676528_+	hypothetical protein	NA	NA	NA	NA	NA
WP_143441508.1|1676521_1676872_+	IS66 family insertion sequence element accessory protein TnpB	NA	NA	NA	NA	NA
WP_003627958.1|1676911_1677142_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_003627959.1|1677116_1678454_+|transposase	IS66 family transposase	transposase	S5VTD3	Leptospira_phage	34.4	7.4e-49
WP_003629555.1|1678614_1679751_-	5-(carboxyamino)imidazole ribonucleotide synthase	NA	NA	NA	NA	NA
WP_003627031.1|1679743_1680232_-	5-(carboxyamino)imidazole ribonucleotide mutase	NA	A0A2P0VNU7	Tetraselmis_virus	45.1	4.8e-22
WP_020829328.1|1680242_1681904_-	formate--tetrahydrofolate ligase	NA	NA	NA	NA	NA
WP_003627036.1|1682293_1683052_-	type I 3-dehydroquinate dehydratase	NA	W6LP76	Streptococcus_phage	29.7	2.2e-21
WP_020829329.1|1683067_1684213_-	MFS transporter	NA	NA	NA	NA	NA
WP_035508929.1|1684349_1685222_-	shikimate dehydrogenase	NA	NA	NA	NA	NA
WP_041806217.1|1687459_1688695_+|transposase	IS3 family transposase	transposase	A0A1B1P773	Bacillus_phage	47.7	1.5e-56
WP_003627055.1|1694982_1695990_-	LacI family DNA-binding transcriptional regulator	NA	NA	NA	NA	NA
WP_003627056.1|1696216_1698103_+	beta-galactosidase	NA	L0N6M2	Herpes_simplex_virus	33.6	4.8e-94
WP_003629579.1|1698086_1699043_+	beta-galactosidase	NA	NA	NA	NA	NA
WP_003627059.1|1699147_1700140_+	UDP-glucose 4-epimerase GalE	NA	A0A2K9L5H6	Tupanvirus	38.4	5.3e-52
WP_035509062.1|1701713_1702712_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003629591.1|1702808_1703714_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003627065.1|1703851_1704571_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003627067.1|1704826_1706164_-	type I glutamate--ammonia ligase	NA	NA	NA	NA	NA
WP_003627072.1|1707924_1708845_-|tRNA	tRNA (adenosine(37)-N6)-dimethylallyltransferase MiaA	tRNA	NA	NA	NA	NA
WP_003627073.1|1708923_1709325_-	rhodanese-like domain-containing protein	NA	NA	NA	NA	NA
WP_003627075.1|1709383_1709611_-	YqgQ family protein	NA	NA	NA	NA	NA
WP_003629612.1|1709611_1710292_-|protease	rhomboid family intramembrane serine protease	protease	NA	NA	NA	NA
WP_003627079.1|1710312_1710873_-	5-formyltetrahydrofolate cyclo-ligase	NA	NA	NA	NA	NA
WP_003548272.1|1710935_1711085_-	50S ribosomal protein L33	NA	NA	NA	NA	NA
WP_003629615.1|1711160_1713269_-	penicillin-binding protein 2	NA	NA	NA	NA	NA
WP_020829334.1|1713359_1715951_+	YfhO family protein	NA	NA	NA	NA	NA
WP_003627087.1|1716058_1716982_+	N-acetylglucosamine kinase	NA	NA	NA	NA	NA
WP_096001395.1|1717194_1718460_+|transposase	IS3 family transposase	transposase	A0A1B1P773	Bacillus_phage	43.4	1.8e-52
WP_003627088.1|1718515_1718812_-	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_020829335.1|1718780_1719122_-	type II toxin-antitoxin system RelE/ParE family toxin	NA	NA	NA	NA	NA
WP_003627090.1|1719308_1720223_-	L-lactate dehydrogenase	NA	NA	NA	NA	NA
WP_003627091.1|1720286_1720763_-	transcription elongation factor GreA	NA	NA	NA	NA	NA
WP_003627092.1|1720839_1723254_-|tRNA	phenylalanine--tRNA ligase subunit beta	tRNA	NA	NA	NA	NA
WP_003627093.1|1723257_1724307_-|tRNA	phenylalanine--tRNA ligase subunit alpha	tRNA	A0A2K9L3A8	Tupanvirus	37.3	5.3e-34
WP_003629630.1|1724591_1724942_-	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_003627096.1|1725053_1725821_-	RNA methyltransferase	NA	NA	NA	NA	NA
WP_003627098.1|1725918_1726191_+	acylphosphatase	NA	NA	NA	NA	NA
WP_023192386.1|1726237_1727200_+	membrane protein insertase YidC	NA	NA	NA	NA	NA
WP_012212116.1|1727247_1727736_+|tRNA	aminoacyl-tRNA deacylase	tRNA	NA	NA	NA	NA
WP_012212117.1|1727772_1729341_-	HAMP domain-containing protein	NA	NA	NA	NA	NA
WP_003627105.1|1729318_1730035_-	response regulator transcription factor	NA	NA	NA	NA	NA
WP_041806219.1|1730197_1730728_-	DUF177 domain-containing protein	NA	NA	NA	NA	NA
WP_003627109.1|1731613_1732765_-	nucleotidyltransferase	NA	NA	NA	NA	NA
WP_003627111.1|1732770_1733118_-	ribosome silencing factor	NA	NA	NA	NA	NA
WP_003627112.1|1733139_1733733_-	bis(5'-nucleosyl)-tetraphosphatase (symmetrical) YqeK	NA	NA	NA	NA	NA
WP_003627113.1|1733713_1734370_-	nicotinate-nucleotide adenylyltransferase	NA	NA	NA	NA	NA
WP_003627114.1|1734380_1735490_-	ribosome biogenesis GTPase YqeH	NA	NA	NA	NA	NA
WP_003627115.1|1735482_1736007_-	YqeG family HAD IIIA-type phosphatase	NA	NA	NA	NA	NA
WP_003627118.1|1736152_1736509_-	50S ribosomal protein L20	NA	NA	NA	NA	NA
WP_003627120.1|1736552_1736753_-	50S ribosomal protein L35	NA	NA	NA	NA	NA
WP_080543081.1|1736774_1737308_-	translation initiation factor IF-3	NA	A0A2L0UZ54	Agrobacterium_phage	37.8	5.2e-14
WP_003627127.1|1739283_1740534_-	DUF389 domain-containing protein	NA	NA	NA	NA	NA
WP_012212124.1|1740540_1740834_-	ACT domain-containing protein	NA	NA	NA	NA	NA
WP_012212288.1|1742041_1743367_-|transposase	IS200/IS605 family element transposase accessory protein TnpB	transposase	G3MB42	Bacillus_virus	36.3	2.1e-56
WP_003627960.1|1743396_1744005_-|transposase	IS607 family transposase	transposase	A0A1V0SJI5	Klosneuvirus	43.2	1.5e-33
WP_023192349.1|1744195_1744726_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003627133.1|1744877_1745399_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003627134.1|1745556_1747491_-|tRNA	threonine--tRNA ligase	tRNA	A0A2K9L297	Tupanvirus	33.4	1.6e-97
WP_012212130.1|1747781_1748690_-	primosomal protein DnaI	NA	S5MU12	Brevibacillus_phage	28.1	9.2e-27
WP_003627136.1|1748721_1750053_-	DnaD domain protein	NA	NA	NA	NA	NA
WP_003627138.1|1750055_1750523_-	transcriptional repressor NrdR	NA	NA	NA	NA	NA
WP_003627139.1|1750525_1751128_-	dephospho-CoA kinase	NA	NA	NA	NA	NA
WP_003627142.1|1751124_1751955_-	DNA-formamidopyrimidine glycosylase	NA	A0A127AWE5	Bacillus_phage	25.9	7.1e-18
WP_020829340.1|1751963_1754627_-	DNA polymerase I	NA	F8WQ35	Bacillus_phage	31.0	2.9e-60
WP_023192420.1|1755100_1756150_+|transposase	IS30 family transposase	transposase	H7BWC8	unidentified_phage	35.1	6.0e-46
WP_006351611.1|1756198_1756666_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003630969.1|1758638_1760114_-	FAD-dependent oxidoreductase	NA	A0A2P0ZL82	Lactobacillus_phage	24.2	1.2e-20
WP_051356297.1|1760131_1760812_-	FMN-binding protein	NA	A0A2P0ZL82	Lactobacillus_phage	33.0	9.7e-05
WP_158648811.1|1760804_1761593_-	FAD-binding protein	NA	NA	NA	NA	NA
WP_003630977.1|1761546_1761963_-	FAD-binding protein	NA	NA	NA	NA	NA
WP_020829343.1|1761975_1763796_-	FAD-dependent oxidoreductase	NA	M1HTN0	Paramecium_bursaria_Chlorella_virus	23.0	4.9e-11
WP_080669027.1|1763902_1764340_-	LysR family transcriptional regulator substrate-binding protein	NA	NA	NA	NA	NA
WP_003630753.1|1764356_1764764_-	LysR family transcriptional regulator	NA	A0A2P0ZL89	Lactobacillus_phage	35.1	3.9e-09
WP_020829345.1|1764807_1768260_-	DEAD/DEAH box helicase family protein	NA	A0A2K5B2B9	Erysipelothrix_phage	24.5	1.6e-34
WP_023192424.1|1768259_1771736_-	hypothetical protein	NA	A0A1B1IUC6	uncultured_Mediterranean_phage	21.5	3.7e-15
WP_006351623.1|1771871_1773233_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003631453.1|1773306_1773636_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003629695.1|1776227_1776881_-	flavodoxin	NA	NA	NA	NA	NA
WP_041806220.1|1776973_1778680_-|transposase	IS1182 family transposase	transposase	A0ZS58	Staphylococcus_virus	36.9	4.6e-88
WP_013854585.1|1779003_1780233_+|transposase	IS110-like element ISLhe4 family transposase	transposase	A0A1X9I619	Streptococcus_phage	38.4	1.8e-65
WP_003629702.1|1780499_1781381_-	SPFH domain-containing protein	NA	NA	NA	NA	NA
WP_003629705.1|1781398_1781713_-	type II toxin-antitoxin system RelB/DinJ family antitoxin	NA	NA	NA	NA	NA
WP_003627170.1|1782119_1783097_-|bacteriocin	class III bacteriocin	bacteriocin	NA	NA	NA	NA
>prophage 18
NC_021744	Lactobacillus helveticus CNRZ32, complete sequence	2225962	1833610	1906473	2225962	tRNA,transposase	Staphylococcus_phage(26.67%)	56	NA	NA
WP_041806265.1|1833610_1834780_-|transposase	IS256 family transposase	transposase	NA	NA	NA	NA
WP_012212173.1|1834990_1835791_-	ABC-2 family transporter protein	NA	NA	NA	NA	NA
WP_080669039.1|1835771_1836470_-	ABC-2 family transporter protein	NA	NA	NA	NA	NA
WP_041806223.1|1836588_1837767_+|transposase	IS256 family transposase	transposase	NA	NA	NA	NA
WP_003629872.1|1837944_1838928_-	ATP-binding cassette domain-containing protein	NA	A0A2H4PQG7	Staphylococcus_phage	26.8	4.8e-13
WP_020829361.1|1838927_1839539_-	WbqC family protein	NA	NA	NA	NA	NA
WP_003629876.1|1839528_1839801_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003629878.1|1839948_1840218_-	hypothetical protein	NA	NA	NA	NA	NA
WP_020829363.1|1840220_1840739_-	NUDIX hydrolase	NA	NA	NA	NA	NA
WP_003627244.1|1840811_1841723_-	class II fructose-bisphosphate aldolase family protein	NA	NA	NA	NA	NA
WP_020829364.1|1841833_1843519_-|tRNA	arginine--tRNA ligase	tRNA	A0A2I2L3K1	Orpheovirus	31.4	3.5e-72
WP_003629886.1|1843858_1844038_-	hypothetical protein	NA	NA	NA	NA	NA
WP_020829365.1|1844050_1844662_-|transposase	Rpn family recombination-promoting nuclease/putative transposase	transposase	NA	NA	NA	NA
WP_035509258.1|1844729_1845284_+	phenolic acid decarboxylase	NA	NA	NA	NA	NA
WP_020829367.1|1845330_1845828_+	PadR family transcriptional regulator	NA	NA	NA	NA	NA
WP_003627252.1|1845901_1846576_-	L,D-transpeptidase	NA	NA	NA	NA	NA
WP_003627254.1|1846702_1847551_-	NAD(P)H-hydrate dehydratase	NA	NA	NA	NA	NA
WP_003627256.1|1847552_1848848_-	D-alanyl-D-alanine carboxypeptidase	NA	B6DZZ7	Stx2-converting_phage	28.0	2.5e-17
WP_003629897.1|1849147_1849456_+	PspC domain-containing protein	NA	NA	NA	NA	NA
WP_003629909.1|1850004_1850304_+	hypothetical protein	NA	NA	NA	NA	NA
WP_023192483.1|1850364_1850718_-	DsbA family protein	NA	NA	NA	NA	NA
WP_080543082.1|1851025_1851973_-	thioredoxin-disulfide reductase	NA	G3MA85	Bacillus_virus	49.2	5.7e-80
WP_035164034.1|1852101_1852959_+|transposase	IS982 family transposase	transposase	NA	NA	NA	NA
WP_003627267.1|1853033_1853684_-	metalloregulator ArsR/SmtB family transcription factor	NA	NA	NA	NA	NA
WP_003629914.1|1853673_1854006_-	thiol reductase thioredoxin	NA	NA	NA	NA	NA
WP_012212186.1|1853992_1854145_-	hypothetical protein	NA	NA	NA	NA	NA
WP_023192452.1|1854305_1854980_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003627272.1|1855016_1855640_-	hypothetical protein	NA	NA	NA	NA	NA
WP_023192453.1|1855782_1856466_-	hypothetical protein	NA	NA	NA	NA	NA
WP_172412565.1|1856538_1856934_-	hypothetical protein	NA	NA	NA	NA	NA
WP_023192454.1|1857845_1858301_-	SLAP domain-containing protein	NA	NA	NA	NA	NA
WP_020829370.1|1859568_1861215_-	polysaccharide biosynthesis protein	NA	NA	NA	NA	NA
WP_172644374.1|1861308_1863726_-|tRNA	leucine--tRNA ligase	tRNA	A0A2H4PQS0	Staphylococcus_phage	65.9	0.0e+00
WP_003627284.1|1864011_1864674_+	phosphatase PAP2 family protein	NA	NA	NA	NA	NA
WP_041806224.1|1865342_1866584_-|transposase	IS200/IS605 family element transposase accessory protein TnpB	transposase	A0A0P0IJS6	Lactobacillus_phage	57.5	1.7e-119
WP_020829372.1|1867352_1868813_-	MFS transporter	NA	S4TR35	Salmonella_phage	24.2	4.9e-06
WP_003629925.1|1868831_1870031_-	methionine adenosyltransferase	NA	A0A2H4PQS6	Staphylococcus_phage	67.0	1.8e-139
WP_020829373.1|1870447_1871371_-	zinc ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_187289108.1|1876918_1877089_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003627921.1|1877340_1877799_-	SsrA-binding protein SmpB	NA	W5RAM5	Staphylococcus_phage	57.4	2.1e-43
WP_003627920.1|1877811_1880151_-	ribonuclease R	NA	Q0GXV6	Lactococcus_phage	35.6	2.1e-83
WP_003632304.1|1880225_1880459_-	preprotein translocase subunit SecG	NA	NA	NA	NA	NA
WP_003627918.1|1880525_1882583_-	LTA synthase family protein	NA	W6LM83	Streptococcus_phage	45.7	7.9e-143
WP_020829374.1|1882658_1883702_-	flippase-like domain-containing protein	NA	NA	NA	NA	NA
WP_003632302.1|1883701_1884745_-	glycosyltransferase family 4 protein	NA	NA	NA	NA	NA
WP_003627915.1|1884758_1885922_-	glycosyltransferase family 4 protein	NA	NA	NA	NA	NA
WP_080669028.1|1895462_1896416_+	NAD(P)/FAD-dependent oxidoreductase	NA	A0A2K9L162	Tupanvirus	28.6	2.0e-16
WP_012211470.1|1896424_1897075_+	VTT domain-containing protein	NA	NA	NA	NA	NA
WP_003632181.1|1897088_1897697_-	TIGR01906 family membrane protein	NA	NA	NA	NA	NA
WP_003632178.1|1897693_1898473_-	TIGR01457 family HAD-type hydrolase	NA	NA	NA	NA	NA
WP_003627734.1|1898469_1899096_-	YutD family protein	NA	NA	NA	NA	NA
WP_003627735.1|1899079_1900471_-	bifunctional metallophosphatase/5'-nucleotidase	NA	S4VPC4	Pandoravirus	22.6	9.5e-07
WP_003632174.1|1900485_1900806_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003627739.1|1902349_1903351_-	substrate-binding domain-containing protein	NA	C6ZCU4	Enterobacteria_phage	26.3	1.8e-20
WP_003627740.1|1903497_1904604_+	aminopeptidase P family protein	NA	NA	NA	NA	NA
WP_041806225.1|1904769_1906473_+|transposase	IS1182 family transposase	transposase	A0ZS58	Staphylococcus_virus	36.7	1.3e-87
>prophage 19
NC_021744	Lactobacillus helveticus CNRZ32, complete sequence	2225962	1927177	2003549	2225962	integrase,tRNA,transposase	uncultured_virus(11.11%)	63	1928303:1928319	1976570:1976586
WP_003627765.1|1927177_1928194_-	Holliday junction branch migration DNA helicase RuvB	NA	B3GAM6	uncultured_virus	32.5	7.4e-09
WP_003627766.1|1928242_1928833_-	Holliday junction branch migration protein RuvA	NA	NA	NA	NA	NA
1928303:1928319	attL	AACTTCTTCAAGCTTAG	NA	NA	NA	NA
WP_020829378.1|1928833_1930744_-	DNA mismatch repair endonuclease MutL	NA	A0A1B2LRQ5	Wolbachia_phage	29.7	3.4e-55
WP_003627768.1|1930743_1933341_-	DNA mismatch repair protein MutS	NA	F2QAF7	Pyramimonas_orientalis_virus	25.2	7.1e-40
WP_003627769.1|1933501_1935124_-	chaperonin GroEL	NA	A0A240F766	uncultured_virus	53.8	2.9e-156
WP_003627770.1|1935177_1935462_-	co-chaperone GroES	NA	A0A221S304	uncultured_virus	40.7	1.2e-12
WP_080669033.1|1935698_1936307_-|integrase	site-specific integrase	integrase	Q938N9	Temperate_phage	41.8	5.9e-30
WP_035509739.1|1937395_1938151_-	hypothetical protein	NA	NA	NA	NA	NA
WP_020829381.1|1938537_1943514_-	S8 family serine peptidase	NA	A0A1B0T6A2	Bacillus_phage	27.5	6.6e-18
WP_044000225.1|1945474_1946491_+|transposase	IS30 family transposase	transposase	H7BWC8	unidentified_phage	35.2	1.3e-45
WP_035509743.1|1946712_1947252_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003631549.1|1947787_1948081_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003631547.1|1950263_1951010_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003631546.1|1951006_1951465_-	LytTR family transcriptional regulator	NA	NA	NA	NA	NA
WP_003625963.1|1951604_1952252_-	redox-sensing transcriptional repressor Rex	NA	NA	NA	NA	NA
WP_020829385.1|1952426_1954340_+	ATP-binding cassette domain-containing protein	NA	A0A2K9L0W2	Tupanvirus	30.7	3.5e-60
WP_003630831.1|1957508_1958696_+	CoA transferase	NA	NA	NA	NA	NA
WP_003625939.1|1960764_1961475_-	GntR family transcriptional regulator	NA	A0A291LID1	Streptomyces_phage	39.4	6.3e-07
WP_003631340.1|1961467_1962439_-	Gfo/Idh/MocA family oxidoreductase	NA	NA	NA	NA	NA
WP_023191613.1|1962448_1962637_-	deoxyribose-phosphate aldolase	NA	NA	NA	NA	NA
WP_096001379.1|1962774_1963788_-|transposase	IS200/IS605 family element transposase accessory protein TnpB	transposase	Q5ULQ4	Lactobacillus_virus	45.4	1.1e-84
WP_023061461.1|1964489_1965539_-|tRNA	tRNA (adenosine(37)-N6)-threonylcarbamoyltransferase complex transferase subunit TsaD	tRNA	A0A0R6PI74	Moraxella_phage	35.2	1.1e-50
WP_003631539.1|1965562_1966135_-	ribosomal protein S18-alanine N-acetyltransferase	NA	NA	NA	NA	NA
WP_003625928.1|1966118_1966853_-|tRNA	tRNA (adenosine(37)-N6)-threonylcarbamoyltransferase complex dimerization subunit type 1 TsaB	tRNA	NA	NA	NA	NA
WP_003625927.1|1966877_1967396_-	folate family ECF transporter S component	NA	NA	NA	NA	NA
WP_003625925.1|1967437_1968172_-	acyl-ACP thioesterase	NA	NA	NA	NA	NA
WP_003625923.1|1968174_1969029_-	16S rRNA (cytidine(1402)-2'-O)-methyltransferase	NA	M1PLC5	Streptococcus_phage	47.7	2.3e-64
WP_012211424.1|1969030_1969381_-	DNA replication initiation control protein YabA	NA	NA	NA	NA	NA
WP_003625921.1|1969391_1970249_-	DNA polymerase III subunit delta	NA	M1NSC1	Streptococcus_phage	29.2	3.9e-19
WP_003631537.1|1970249_1970570_-	cyclic-di-AMP receptor	NA	NA	NA	NA	NA
WP_003631536.1|1970581_1971220_-	dTMP kinase	NA	M1PSC7	Streptococcus_phage	51.0	3.6e-54
WP_003631535.1|1971323_1971569_-	YaaL family protein	NA	NA	NA	NA	NA
WP_003631534.1|1971568_1972168_-	recombination protein RecR	NA	NA	NA	NA	NA
WP_003625916.1|1972168_1972504_-	YbaB/EbfC family nucleoid-associated protein	NA	NA	NA	NA	NA
WP_020829387.1|1972536_1974324_-	DNA polymerase III subunit gamma/tau	NA	A0A1U9WR94	Streptococcus_virus	39.7	2.0e-49
WP_003631532.1|1974518_1975025_-	nucleoside deaminase	NA	S4VYZ2	Pandoravirus	39.5	1.2e-07
WP_003631531.1|1975014_1975644_-	class I SAM-dependent methyltransferase	NA	NA	NA	NA	NA
WP_003625909.1|1976545_1976908_-	50S ribosomal protein L7/L12	NA	NA	NA	NA	NA
1976570:1976586	attR	AACTTCTTCAAGCTTAG	NA	NA	NA	NA
WP_003625908.1|1976958_1977471_-	50S ribosomal protein L10	NA	NA	NA	NA	NA
WP_003625900.1|1979065_1979743_-	phosphate signaling complex protein PhoU	NA	NA	NA	NA	NA
WP_003625899.1|1979759_1980515_-	phosphate ABC transporter ATP-binding protein	NA	G3M9Y6	Bacillus_virus	27.5	3.0e-15
WP_003625897.1|1980516_1981311_-	phosphate ABC transporter ATP-binding protein	NA	F2Y302	Organic_Lake_phycodnavirus	33.5	1.0e-13
WP_003625895.1|1981321_1982209_-	phosphate ABC transporter permease PstA	NA	NA	NA	NA	NA
WP_003625892.1|1982210_1983206_-	phosphate ABC transporter permease subunit PstC	NA	NA	NA	NA	NA
WP_012211417.1|1983209_1984076_-	phosphate ABC transporter substrate-binding protein	NA	M1PR58	Cyanophage	22.6	4.2e-05
WP_041806228.1|1985159_1986413_+|transposase	ISL3 family transposase	transposase	A0A2D1GQC1	Lysinibacillus_phage	21.6	2.0e-08
WP_003625887.1|1986554_1987247_-	50S ribosomal protein L1	NA	NA	NA	NA	NA
WP_003625885.1|1987329_1987755_-	50S ribosomal protein L11	NA	NA	NA	NA	NA
WP_003625883.1|1987882_1988440_-	transcription termination/antitermination protein NusG	NA	F5B3X4	Synechococcus_phage	31.3	2.3e-12
WP_003625881.1|1988547_1988715_-	preprotein translocase subunit SecE	NA	NA	NA	NA	NA
WP_012211413.1|1988722_1988872_-	50S ribosomal protein L33	NA	NA	NA	NA	NA
WP_003625869.1|1990797_1992294_-	gluconokinase	NA	NA	NA	NA	NA
WP_003549087.1|1992405_1992624_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003631508.1|1992698_1993244_-	sigma-70 family RNA polymerase sigma factor	NA	NA	NA	NA	NA
WP_003631507.1|1993386_1994139_-	23S rRNA (guanosine(2251)-2'-O)-methyltransferase RlmB	NA	NA	NA	NA	NA
WP_003625863.1|1994125_1994569_-	hypothetical protein	NA	NA	NA	NA	NA
WP_020829388.1|1994561_1995992_-|tRNA	cysteine--tRNA ligase	tRNA	M1PG92	Moumouvirus	29.2	1.1e-45
WP_020829389.1|1996084_1997584_-|tRNA	glutamate--tRNA ligase	tRNA	NA	NA	NA	NA
WP_003631505.1|1997659_1999036_-	DNA repair protein RadA	NA	A0A2I7QPS8	Vibrio_phage	24.6	8.8e-05
WP_003625858.1|1999035_1999587_-	dUTP diphosphatase	NA	J9PV85	Bacillus_phage	48.6	3.1e-38
WP_003625857.1|1999721_2000024_+	hypothetical protein	NA	NA	NA	NA	NA
WP_187289101.1|2000168_2001428_+|transposase	IS200/IS605 family element transposase accessory protein TnpB	transposase	Q5ULQ4	Lactobacillus_virus	56.2	1.7e-119
WP_041806230.1|2001791_2003549_+|transposase	IS1182 family transposase	transposase	A0ZS58	Staphylococcus_virus	37.1	1.3e-88
>prophage 20
NC_021744	Lactobacillus helveticus CNRZ32, complete sequence	2225962	2057731	2149970	2225962	tRNA,bacteriocin,transposase,protease	Lactobacillus_virus(13.64%)	76	NA	NA
WP_003625768.1|2057731_2060212_-|protease	ATP-dependent Clp protease ATP-binding subunit	protease	A0A223W0B1	Agrobacterium_phage	33.4	1.6e-118
WP_003625767.1|2060316_2060772_-	GAF domain-containing protein	NA	NA	NA	NA	NA
WP_003625766.1|2061137_2061620_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003631243.1|2061931_2063482_-|tRNA	lysine--tRNA ligase	tRNA	A0A2K9L3L6	Tupanvirus	35.6	1.2e-82
WP_003625761.1|2063497_2064523_-|tRNA	tRNA dihydrouridine synthase DusB	tRNA	NA	NA	NA	NA
WP_003625760.1|2064600_2065491_-	Hsp33 family molecular chaperone HslO	NA	NA	NA	NA	NA
WP_003631240.1|2065543_2067709_-|protease	ATP-dependent zinc metalloprotease FtsH	protease	A0A0P0BXI2	Ostreococcus_lucimarinus_virus	41.0	1.1e-107
WP_003631238.1|2067803_2069060_-|tRNA	tRNA lysidine(34) synthetase TilS	tRNA	NA	NA	NA	NA
WP_003625754.1|2069100_2069463_-	S1 RNA-binding domain-containing protein	NA	NA	NA	NA	NA
WP_003631236.1|2069462_2069840_-	septum formation initiator family protein	NA	NA	NA	NA	NA
WP_003625749.1|2069905_2070148_-	RNA-binding S4 domain-containing protein	NA	NA	NA	NA	NA
WP_003625747.1|2070159_2073657_-	transcription-repair coupling factor	NA	NA	NA	NA	NA
WP_003625746.1|2073658_2074216_-|tRNA	aminoacyl-tRNA hydrolase	tRNA	NA	NA	NA	NA
WP_003625743.1|2074350_2075322_+	L-lactate dehydrogenase	NA	NA	NA	NA	NA
WP_020829408.1|2075499_2076198_+	CBS domain-containing protein	NA	NA	NA	NA	NA
WP_023060818.1|2076276_2076453_+	hypothetical protein	NA	NA	NA	NA	NA
WP_143441508.1|2076446_2076797_+	IS66 family insertion sequence element accessory protein TnpB	NA	NA	NA	NA	NA
WP_003627958.1|2076836_2077067_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_003627959.1|2077041_2078379_+|transposase	IS66 family transposase	transposase	S5VTD3	Leptospira_phage	34.4	7.4e-49
WP_035509290.1|2078528_2079014_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003631231.1|2079259_2080390_-	alanine racemase	NA	A0A0P0YM39	Yellowstone_lake_mimivirus	27.7	1.6e-28
WP_003625735.1|2080392_2080749_-	holo-ACP synthase	NA	NA	NA	NA	NA
WP_003625732.1|2080831_2082343_-	DEAD/DEAH box helicase	NA	Q5GF26	Diachasmimorpha_longicaudata_entomopoxvirus	39.1	8.6e-70
WP_003625729.1|2082356_2083724_-	UDP-N-acetylmuramoyl-tripeptide--D-alanyl-D- alanine ligase	NA	NA	NA	NA	NA
WP_003625728.1|2083850_2084096_-	type B 50S ribosomal protein L31	NA	NA	NA	NA	NA
WP_014562912.1|2084258_2085665_-|transposase	ISLre2 family transposase	transposase	NA	NA	NA	NA
WP_003625726.1|2085888_2086719_+	HAD family hydrolase	NA	NA	NA	NA	NA
WP_096001381.1|2086905_2088135_-|transposase	IS200/IS605 family element transposase accessory protein TnpB	transposase	Q5ULQ4	Lactobacillus_virus	56.2	4.3e-120
WP_023192599.1|2088434_2089511_-	SLAP domain-containing protein	NA	NA	NA	NA	NA
WP_158648612.1|2089606_2090563_-|bacteriocin	bacteriocin	bacteriocin	NA	NA	NA	NA
WP_035509730.1|2090951_2091815_+	Rgg/GadR/MutR family transcriptional regulator	NA	NA	NA	NA	NA
WP_187289102.1|2091822_2091975_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003625618.1|2095161_2096397_-	serine hydroxymethyltransferase	NA	A0A240F3L3	Aeromonas_phage	53.2	1.2e-101
WP_041806233.1|2096767_2097625_+|transposase	IS982 family transposase	transposase	NA	NA	NA	NA
WP_013854585.1|2097720_2098950_-|transposase	IS110-like element ISLhe4 family transposase	transposase	A0A1X9I619	Streptococcus_phage	38.4	1.8e-65
WP_041806234.1|2099273_2100980_+|transposase	IS1182 family transposase	transposase	A0ZS58	Staphylococcus_virus	37.1	1.2e-88
WP_020829412.1|2101259_2102285_-	hypothetical protein	NA	NA	NA	NA	NA
WP_020829413.1|2102899_2103532_-	hypothetical protein	NA	NA	NA	NA	NA
WP_041806235.1|2103642_2104500_+|transposase	IS982 family transposase	transposase	NA	NA	NA	NA
WP_020829414.1|2104617_2110149_-	S8 family serine peptidase	NA	A0A217EQY2	Bacillus_phage	31.9	1.3e-09
WP_020829415.1|2110500_2111406_+	peptidylprolyl isomerase	NA	NA	NA	NA	NA
WP_003625614.1|2112789_2114367_-	glutamine-hydrolyzing GMP synthase	NA	A0A1V0SH76	Hokovirus	34.1	6.3e-23
WP_003625612.1|2114563_2114716_+	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_003625610.1|2114758_2115052_+	hypothetical protein	NA	NA	NA	NA	NA
WP_096001382.1|2115551_2116811_-|transposase	IS200/IS605 family element transposase accessory protein TnpB	transposase	Q5ULQ4	Lactobacillus_virus	57.9	2.7e-125
WP_035504367.1|2117096_2117699_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003625603.1|2117972_2118551_+	xanthine phosphoribosyltransferase	NA	NA	NA	NA	NA
WP_020829418.1|2118554_2119829_+	purine permease	NA	Q9KX94	Enterobacteria_phage	27.9	1.1e-28
WP_012211345.1|2119928_2120753_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_003630880.1|2120833_2122258_+	C69 family dipeptidase	NA	NA	NA	NA	NA
WP_080669042.1|2122313_2122703_-	HAD-IA family hydrolase	NA	NA	NA	NA	NA
WP_023191958.1|2122709_2122931_-	HAD hydrolase-like protein	NA	NA	NA	NA	NA
WP_020829419.1|2123054_2124350_-	UDP-N-acetylglucosamine 1-carboxyvinyltransferase	NA	NA	NA	NA	NA
WP_003625589.1|2124479_2126099_-	CTP synthase	NA	A0A1J0FA14	Only_Syngen_Nebraska_virus	47.2	5.6e-136
WP_003625588.1|2126216_2126774_-	DNA-directed RNA polymerase subunit delta	NA	NA	NA	NA	NA
WP_003625587.1|2126820_2127222_-	DUF1934 domain-containing protein	NA	NA	NA	NA	NA
WP_003625586.1|2127335_2128700_+	HD domain-containing protein	NA	A0A1B1ISR1	uncultured_Mediterranean_phage	33.1	1.4e-31
WP_003630873.1|2128727_2129003_+	hypothetical protein	NA	NA	NA	NA	NA
WP_020829420.1|2130031_2131006_-	ribose-phosphate diphosphokinase	NA	A0A2K9L2G2	Tupanvirus	36.8	6.6e-47
WP_003630871.1|2131246_2132641_-	SLAP domain-containing protein	NA	NA	NA	NA	NA
WP_020829421.1|2132776_2133793_-	SLAP domain-containing protein	NA	NA	NA	NA	NA
WP_096001383.1|2134110_2135106_-|transposase	IS200/IS605 family element transposase accessory protein TnpB	transposase	Q5ULQ4	Lactobacillus_virus	48.9	6.2e-93
WP_023191386.1|2135161_2135593_-	SLAP domain-containing protein	NA	NA	NA	NA	NA
WP_003625577.1|2136381_2137767_-	bifunctional UDP-N-acetylglucosamine diphosphorylase/glucosamine-1-phosphate N-acetyltransferase GlmU	NA	A0A0G2Y8M0	Acanthamoeba_polyphaga_mimivirus	34.0	7.9e-30
WP_003625576.1|2137813_2138644_-	pur operon repressor	NA	NA	NA	NA	NA
WP_003625575.1|2138744_2139002_-	Veg family protein	NA	NA	NA	NA	NA
WP_020829424.1|2139082_2139958_-	16S rRNA (adenine(1518)-N(6)/adenine(1519)-N(6))- dimethyltransferase RsmA	NA	NA	NA	NA	NA
WP_003625573.1|2139947_2140514_-	ribonuclease M5	NA	NA	NA	NA	NA
WP_003625572.1|2140500_2141268_-	TatD family hydrolase	NA	NA	NA	NA	NA
WP_003625571.1|2141267_2143244_-|tRNA	methionine--tRNA ligase	tRNA	A0A1V0SHR2	Klosneuvirus	39.0	1.1e-98
WP_020829425.1|2143336_2146000_-	magnesium-translocating P-type ATPase	NA	M1HXH2	Paramecium_bursaria_Chlorella_virus	24.6	6.8e-38
WP_020829426.1|2146298_2146907_-	TPM domain-containing protein	NA	NA	NA	NA	NA
WP_003625568.1|2146896_2147376_-	hypothetical protein	NA	A7KUY9	Bacillus_phage	59.0	5.2e-37
WP_003625567.1|2147400_2148423_-|tRNA	tryptophan--tRNA ligase	tRNA	NA	NA	NA	NA
WP_003630784.1|2148547_2149147_+	SOS response-associated peptidase family protein	NA	NA	NA	NA	NA
WP_020829427.1|2149307_2149970_-|protease	CPBP family intramembrane metalloprotease	protease	NA	NA	NA	NA
