The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
NC_021740	Mycobacterium tuberculosis EAI5, complete sequence	4391174	2928974	2967248	4391174	head,protease,terminase,integrase,capsid,tRNA	Mycobacterium_phage(30.0%)	48	2957774:2957801	2967401:2967428
WP_003413486.1|2928974_2931053_-|tRNA	threonine--tRNA ligase	tRNA	A0A2K9L6B6	Tupanvirus	34.9	2.5e-104
WP_003413487.1|2931161_2931389_+	hypothetical protein	NA	NA	NA	NA	NA
WP_009938541.1|2931385_2932771_-	PE family protein	NA	NA	NA	NA	NA
WP_003413569.1|2933115_2933616_+	DUF1990 family protein	NA	NA	NA	NA	NA
WP_003413574.1|2933632_2934073_-	DoxX family membrane protein	NA	NA	NA	NA	NA
WP_003901437.1|2934219_2934897_+	transcriptional regulator	NA	NA	NA	NA	NA
WP_003413583.1|2934881_2935235_-	cupin domain-containing protein	NA	NA	NA	NA	NA
WP_003413586.1|2935247_2935673_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003413588.1|2935669_2936344_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_003413589.1|2936421_2937243_+	class I SAM-dependent methyltransferase	NA	NA	NA	NA	NA
WP_003413592.1|2937378_2938272_+	universal stress protein	NA	NA	NA	NA	NA
WP_003413594.1|2938274_2939093_-	universal stress protein	NA	NA	NA	NA	NA
WP_003899401.1|2939107_2940289_-|protease	site-2 protease family protein	protease	NA	NA	NA	NA
WP_003413598.1|2940347_2940779_-	hypoxic response protein Hrp1	NA	A0A2I6B2H4	Macacine_betaherpesvirus	100.0	1.9e-75
WP_003899402.1|2941292_2942534_-	alpha/beta hydrolase	NA	NA	NA	NA	NA
WP_003413600.1|2942843_2943206_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003413610.1|2943552_2944677_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003413614.1|2944678_2945218_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003413616.1|2945356_2946655_+	RtcB family protein	NA	A2RQD0	Archaeal_BJ1_virus	43.3	3.8e-90
WP_003413619.1|2946693_2946975_-	DUF1876 domain-containing protein	NA	NA	NA	NA	NA
WP_003413625.1|2947119_2947605_-	hemerythrin domain-containing protein	NA	NA	NA	NA	NA
WP_003902325.1|2947631_2947889_-	hypothetical protein	NA	NA	NA	NA	NA
WP_009938544.1|2947889_2950226_-	PE family protein	NA	NA	NA	NA	NA
WP_003899405.1|2950254_2950497_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003899406.1|2950497_2951175_+	membrane protein	NA	NA	NA	NA	NA
WP_003904900.1|2951370_2952027_+	DedA family protein	NA	NA	NA	NA	NA
WP_003413657.1|2952189_2952636_+	anti-sigma factor antagonist	NA	NA	NA	NA	NA
WP_003413663.1|2952810_2953143_-	YnfA family protein	NA	NA	NA	NA	NA
WP_003413665.1|2953262_2953622_-	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_003413675.1|2953723_2954182_+	glyoxalase/bleomycin resistance/dioxygenase family protein	NA	NA	NA	NA	NA
WP_003899407.1|2954317_2954698_+	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_003413686.1|2954694_2956191_+	ACR3 family arsenite efflux transporter	NA	A0A2H4PQT9	Staphylococcus_phage	39.7	5.1e-14
WP_003912823.1|2956425_2956617_+	antitoxin MazE family protein	NA	NA	NA	NA	NA
WP_077365235.1|2956689_2956863_+	hypothetical protein	NA	NA	NA	NA	NA
2957774:2957801	attL	ACTGGTTCAATCCCAGTATCGCGCACCA	NA	NA	NA	NA
WP_003899409.1|2957907_2958339_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003900538.1|2958335_2959334_+|integrase	tyrosine-type recombinase/integrase	integrase	A0A2D1G8E2	Mycobacterium_phage	47.8	7.4e-62
WP_003900539.1|2959347_2959812_+	ParB N-terminal domain-containing protein	NA	NA	NA	NA	NA
WP_015631465.1|2959799_2960054_+	hypothetical protein	NA	NA	NA	NA	NA
WP_009935349.1|2960224_2961664_-|capsid	phage major capsid protein	capsid	A0A1B3AYS4	Gordonia_phage	40.6	1.4e-66
WP_003899412.1|2961671_2962205_-|head,protease	HK97 family phage prohead protease	head,protease	A0A2H4JB68	uncultured_Caudovirales_phage	32.9	3.1e-06
WP_003899413.1|2962357_2962984_-|terminase	phage terminase small subunit P27 family	terminase	V9H0V4	Actinophage	47.2	1.6e-17
WP_003899414.1|2963015_2963339_-	type II toxin-antitoxin system toxin	NA	NA	NA	NA	NA
WP_003899415.1|2963418_2963664_-	type II toxin-antitoxin system antitoxin	NA	NA	NA	NA	NA
WP_003899416.1|2963660_2965088_-	DUF3631 domain-containing protein	NA	NA	NA	NA	NA
WP_003899417.1|2965089_2965482_-	DUF2742 domain-containing protein	NA	NA	NA	NA	NA
WP_003899418.1|2965478_2965739_-	helix-turn-helix domain-containing protein	NA	A0A2P1CHK7	Mycobacterium_phage	64.6	3.0e-15
WP_003900543.1|2965755_2966118_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003899420.1|2966120_2967248_-|integrase	site-specific integrase	integrase	A0A1X9SFC1	Mycobacterium_phage	40.4	1.5e-66
2967401:2967428	attR	ACTGGTTCAATCCCAGTATCGCGCACCA	NA	NA	NA	NA
