The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
NC_021741	Serratia liquefaciens ATCC 27592, complete sequence	5238612	1858199	1896723	5238612	lysis,portal,terminase,holin,integrase,coat	Salmonella_phage(23.33%)	41	1861658:1861674	1900259:1900275
WP_020826250.1|1858199_1860140_-	MacB family efflux pump subunit	NA	G9BWD6	Planktothrix_phage	38.5	1.1e-34
WP_020826251.1|1860136_1861321_-	efflux RND transporter periplasmic adaptor subunit	NA	NA	NA	NA	NA
1861658:1861674	attL	TCCTGCATAGCGCGCCA	NA	NA	NA	NA
WP_020826252.1|1861830_1862997_+|integrase	tyrosine-type recombinase/integrase	integrase	Q7M297	Enterobacteria_phage	48.7	1.9e-109
WP_020826253.1|1862993_1863182_-	AlpA family phage regulatory protein	NA	NA	NA	NA	NA
WP_020826254.1|1863178_1864573_-	DEAD/DEAH box helicase	NA	Q3LZN8	Bacteriophage	76.3	1.1e-215
WP_020826255.1|1864580_1865213_-	HNH endonuclease	NA	A0A2I7RAW6	Vibrio_phage	63.6	1.4e-05
WP_020826256.1|1865209_1865440_-	hypothetical protein	NA	A0A2H4JCC5	uncultured_Caudovirales_phage	41.3	1.2e-07
WP_081667727.1|1865490_1866255_-	phage antirepressor KilAC domain-containing protein	NA	Q71TC0	Escherichia_phage	46.2	4.8e-37
WP_020826258.1|1866331_1866502_-	hypothetical protein	NA	NA	NA	NA	NA
WP_041414414.1|1866631_1867027_+	Arc family DNA-binding protein	NA	NA	NA	NA	NA
WP_020826260.1|1867023_1867164_-	Arc family DNA-binding protein	NA	NA	NA	NA	NA
WP_020826261.1|1867160_1867430_-	VRR-NUC domain-containing protein	NA	B6SD64	Bacteriophage	62.9	1.3e-26
WP_020826262.1|1867434_1869543_-	DNA polymerase	NA	Q775A3	Bordetella_phage	65.5	9.9e-266
WP_020826263.1|1869644_1869863_+	hypothetical protein	NA	NA	NA	NA	NA
WP_020826264.1|1869864_1870734_-	hypothetical protein	NA	K4F991	Cronobacter_phage	80.8	4.0e-104
WP_020826266.1|1870975_1871524_-	DUF2815 family protein	NA	Q775A5	Bordetella_phage	67.6	2.5e-67
WP_020826267.1|1871536_1872850_-	DUF2800 domain-containing protein	NA	B6SCX9	Bacteriophage	56.4	7.3e-134
WP_020826268.1|1872853_1873786_-	hypothetical protein	NA	NA	NA	NA	NA
WP_020826269.1|1874284_1874467_-	hypothetical protein	NA	NA	NA	NA	NA
WP_020826270.1|1874491_1874689_-	hypothetical protein	NA	NA	NA	NA	NA
WP_020826271.1|1874968_1875637_-	helix-turn-helix domain-containing protein	NA	Q9T1U7	Acyrthosiphon_pisum_secondary_endosymbiont_phage	48.3	6.9e-56
WP_020826272.1|1875770_1875971_+	transcriptional regulator	NA	K7ST61	Bacteriophage	46.7	1.0e-07
WP_020826273.1|1875974_1878131_+	bifunctional DNA primase/polymerase	NA	B6SD37	Bacteriophage	69.7	2.4e-166
WP_020826275.1|1879304_1879667_+	DUF4406 domain-containing protein	NA	A0A222YYT7	Escherichia_phage	56.6	1.1e-26
WP_041414418.1|1879641_1879995_+|holin	phage holin, lambda family	holin	Q8SBE1	Shigella_phage	53.2	1.7e-29
WP_020826277.1|1880000_1880612_+	glycoside hydrolase family 19 protein	NA	A0A192Y6G4	Salmonella_phage	58.4	3.2e-60
WP_041414420.1|1880608_1881070_+|lysis	lysis protein	lysis	M1FJ79	Enterobacteria_phage	42.3	1.8e-18
WP_020826279.1|1881066_1881432_+	hypothetical protein	NA	A0AR14	Salmonella_phage	68.3	1.1e-36
WP_020826280.1|1881501_1881726_+	DUF2560 family protein	NA	NA	NA	NA	NA
WP_020826281.1|1881734_1882268_+	hypothetical protein	NA	A0A192Y6U9	Salmonella_phage	31.0	3.5e-10
WP_020826282.1|1882299_1882860_+|terminase	terminase small subunit	terminase	A0A1W6JNT5	Morganella_phage	64.7	2.2e-55
WP_020826283.1|1882840_1884346_+	DNA packaging protein	NA	E7C9T5	Salmonella_phage	83.1	4.4e-260
WP_041415301.1|1884349_1886527_+|portal	portal protein	portal	A0A2D1GLJ6	Escherichia_phage	78.4	1.8e-307
WP_020826285.1|1886541_1887453_+	scaffold protein	NA	A0A0M3ULI9	Salmonella_phage	75.6	9.3e-120
WP_020826286.1|1887452_1888742_+|coat	coat protein	coat	A0A2D1GLV2	Escherichia_phage	74.9	1.2e-189
WP_020826288.1|1889090_1889594_+	packaged DNA stabilization protein p27	NA	A0A2D1GLR5	Escherichia_phage	63.6	7.3e-50
WP_020826289.1|1889571_1890993_+	Packaged DNA stabilization protein gp10	NA	I1TEJ1	Salmonella_phage	68.9	5.2e-202
WP_020826290.1|1890992_1891799_+	hypothetical protein	NA	Q9AYZ3	Salmonella_phage	41.5	2.6e-41
WP_020826292.1|1892180_1892846_+	hypothetical protein	NA	A0A0A0P253	Enterobacteria_phage	48.8	3.5e-44
WP_020826293.1|1892845_1894036_+	phage DNA ejection protein	NA	NA	NA	NA	NA
WP_020826294.1|1894035_1896723_+	lytic transglycosylase domain-containing protein	NA	A0A2D1GLK8	Escherichia_phage	33.5	2.0e-98
1900259:1900275	attR	TCCTGCATAGCGCGCCA	NA	NA	NA	NA
>prophage 2
NC_021741	Serratia liquefaciens ATCC 27592, complete sequence	5238612	2145452	2166502	5238612	protease,coat	Moraxella_phage(100.0%)	21	NA	NA
WP_041414489.1|2145452_2146883_+|protease	serralysin family metalloprotease	protease	NA	NA	NA	NA
WP_041414492.1|2147033_2147243_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017892602.1|2147609_2147747_-	hypothetical protein	NA	NA	NA	NA	NA
WP_020826536.1|2148201_2148594_+	ASCH domain-containing protein	NA	NA	NA	NA	NA
WP_020826537.1|2148595_2149198_+	hypothetical protein	NA	NA	NA	NA	NA
WP_020826538.1|2149252_2149492_-	YebV family protein	NA	NA	NA	NA	NA
WP_020826539.1|2149628_2150561_-|coat	spore coat U domain-containing protein	coat	NA	NA	NA	NA
WP_020826540.1|2150579_2152925_-	fimbrial biogenesis outer membrane usher protein	NA	NA	NA	NA	NA
WP_020826541.1|2152923_2153091_+	hypothetical protein	NA	NA	NA	NA	NA
WP_020826542.1|2153076_2153841_-	molecular chaperone	NA	NA	NA	NA	NA
WP_020826543.1|2153863_2154412_-|coat	spore coat protein U domain-containing protein	coat	NA	NA	NA	NA
WP_020826544.1|2154417_2154921_-|coat	spore coat protein U domain-containing protein	coat	NA	NA	NA	NA
WP_020826545.1|2154923_2155463_-|coat	spore coat protein U domain-containing protein	coat	NA	NA	NA	NA
WP_020826546.1|2155742_2157179_-	16S rRNA (cytosine(1407)-C(5))-methyltransferase RsmF	NA	NA	NA	NA	NA
WP_020826547.1|2157282_2159913_-	PqiB family protein	NA	NA	NA	NA	NA
WP_041415333.1|2159881_2161129_-	membrane integrity lipid transport subunit YebS	NA	NA	NA	NA	NA
WP_020826549.1|2161373_2161871_+	GAF domain-containing protein	NA	NA	NA	NA	NA
WP_020826550.1|2161966_2162677_+	RNA chaperone ProQ	NA	NA	NA	NA	NA
WP_020826551.1|2162696_2164733_+	carboxy terminal-processing peptidase	NA	A0A0R6PIZ1	Moraxella_phage	34.5	1.1e-85
WP_041414497.1|2164832_2165216_+	DUF4260 domain-containing protein	NA	NA	NA	NA	NA
WP_020826553.1|2165623_2166502_+|protease	protease HtpX	protease	NA	NA	NA	NA
>prophage 3
NC_021741	Serratia liquefaciens ATCC 27592, complete sequence	5238612	2202572	2229264	5238612	terminase,holin,tail,tRNA	Salmonella_phage(29.17%)	33	NA	NA
WP_020826592.1|2202572_2203217_-	helix-turn-helix transcriptional regulator	NA	Q8HAA0	Salmonella_phage	48.7	3.3e-39
WP_071846563.1|2203308_2203536_+	helix-turn-helix domain-containing protein	NA	A0A1W6JTD1	Pseudomonas_phage	49.0	3.2e-05
WP_020826593.1|2203551_2203875_+	hypothetical protein	NA	H6WRX6	Salmonella_phage	81.7	9.7e-40
WP_020826595.1|2204164_2204905_+	KilA-N domain-containing protein	NA	Q8HA92	Salmonella_phage	47.6	8.2e-34
WP_020826596.1|2204894_2205077_+	DUF4222 domain-containing protein	NA	A0A1W6JP38	Morganella_phage	47.1	7.2e-08
WP_020826597.1|2205073_2206096_+	helix-turn-helix domain-containing protein	NA	H9C164	Pectobacterium_phage	75.9	1.0e-42
WP_020826598.1|2206092_2207076_+	DUF968 domain-containing protein	NA	A0A291AWV9	Escherichia_phage	38.6	2.8e-61
WP_020826599.1|2207072_2207429_+	RusA family crossover junction endodeoxyribonuclease	NA	G8C7V6	Escherichia_phage	69.5	2.7e-43
WP_020826600.1|2207425_2208121_+	hypothetical protein	NA	Q5G8R6	Enterobacteria_phage	26.6	4.9e-12
WP_020826601.1|2208284_2208887_-	hypothetical protein	NA	NA	NA	NA	NA
WP_020826602.1|2208999_2209350_+|holin	phage holin, lambda family	holin	Q8SBE1	Shigella_phage	55.0	1.4e-28
WP_020826603.1|2209333_2209774_+	lysozyme	NA	A0A0M4R365	Salmonella_phage	67.1	1.7e-47
WP_041414509.1|2209770_2210154_+	DUF2570 family protein	NA	NA	NA	NA	NA
WP_144079310.1|2210541_2210775_+	hypothetical protein	NA	NA	NA	NA	NA
WP_020826606.1|2211073_2211310_+	hypothetical protein	NA	NA	NA	NA	NA
WP_020826607.1|2211580_2211880_-	hypothetical protein	NA	NA	NA	NA	NA
WP_020826608.1|2211911_2212133_+|terminase	terminase small subunit	terminase	I6PDJ6	Cronobacter_phage	81.9	3.3e-23
WP_020826610.1|2212378_2212765_+	hypothetical protein	NA	A0A0M4QWT0	Salmonella_phage	53.6	1.7e-30
WP_020826611.1|2212826_2215475_+	tape measure protein	NA	A0A291AXC6	Shigella_phage	37.2	3.0e-110
WP_020826612.1|2215515_2215983_+	hypothetical protein	NA	A0A173GC35	Salmonella_phage	63.2	8.5e-53
WP_020826613.1|2215983_2216454_+	DUF1833 family protein	NA	R9TPR6	Aeromonas_phage	62.1	4.7e-51
WP_051150525.1|2216473_2216878_+	C40 family peptidase	NA	F1C5F2	Cronobacter_phage	64.7	3.3e-45
WP_041414513.1|2216825_2219321_+|tail	phage tail protein	tail	A0A1B1W274	Salmonella_phage	55.1	2.1e-254
WP_020826616.1|2219321_2219774_+	hypothetical protein	NA	A0A2P1MXB7	Escherichia_phage	63.9	2.2e-13
WP_020826617.1|2219758_2221255_+	hypothetical protein	NA	B5TAB2	Burkholderia_phage	43.5	2.8e-97
WP_144079311.1|2221664_2222042_+	hypothetical protein	NA	NA	NA	NA	NA
WP_041414516.1|2222345_2224274_+|tRNA	threonine--tRNA ligase	tRNA	A0A2K9L297	Tupanvirus	37.7	4.5e-132
WP_013812633.1|2224277_2224829_+	translation initiation factor IF-3	NA	A0A2L0UZ54	Agrobacterium_phage	33.7	4.4e-16
WP_004931418.1|2224927_2225125_+	50S ribosomal protein L35	NA	NA	NA	NA	NA
WP_020826620.1|2225168_2225525_+	50S ribosomal protein L20	NA	NA	NA	NA	NA
WP_144079312.1|2225581_2225686_+	pheST operon leader peptide PheM	NA	NA	NA	NA	NA
WP_020826621.1|2225878_2226862_+|tRNA	phenylalanine--tRNA ligase subunit alpha	tRNA	A0A2K9L3A8	Tupanvirus	38.1	2.2e-34
WP_020826622.1|2226876_2229264_+|tRNA	phenylalanine--tRNA ligase subunit beta	tRNA	A0A1L3IZU3	BeAn_58058_virus	24.0	2.4e-05
>prophage 4
NC_021741	Serratia liquefaciens ATCC 27592, complete sequence	5238612	2998974	3046148	5238612	plate,head,protease,terminase,holin,integrase	Edwardsiella_phage(27.78%)	74	2997926:2997941	3045035:3045050
2997926:2997941	attL	TCCCGACACAGGAAGA	NA	NA	NA	NA
WP_144079316.1|2998974_3001179_-	hypothetical protein	NA	B5TAB2	Burkholderia_phage	40.9	1.5e-86
WP_041414663.1|3001237_3002527_-	hypothetical protein	NA	A0A077KC23	Edwardsiella_phage	34.1	8.8e-15
WP_041415446.1|3002528_3003116_-	DUF2612 domain-containing protein	NA	A0A2R3UAM9	Myoviridae_environmental_samples	39.2	7.7e-35
WP_020827323.1|3003115_3004354_-|plate	baseplate J/gp47 family protein	plate	A0A077KGW9	Edwardsiella_phage	52.7	6.3e-111
WP_020827324.1|3004361_3004721_-	hypothetical protein	NA	A0A077KCA1	Edwardsiella_phage	46.5	2.9e-24
WP_020827325.1|3004860_3005319_+	hypothetical protein	NA	NA	NA	NA	NA
WP_020827326.1|3005341_3005803_-	hypothetical protein	NA	NA	NA	NA	NA
WP_020827327.1|3005805_3006393_-	hypothetical protein	NA	A0A077KAY0	Edwardsiella_phage	42.3	1.9e-33
WP_020827328.1|3006392_3007250_-	hypothetical protein	NA	A0A077KC17	Edwardsiella_phage	39.2	4.0e-48
WP_020827329.1|3007246_3007558_-	hypothetical protein	NA	A0A077K9U4	Edwardsiella_phage	41.4	1.4e-19
WP_020827330.1|3007557_3008367_-	hypothetical protein	NA	A0A077KGW3	Edwardsiella_phage	43.1	1.2e-30
WP_020827331.1|3008369_3010196_-	hypothetical protein	NA	A0A0F6R8M6	Escherichia_coli_O157_typing_phage	37.4	4.3e-23
WP_020827333.1|3010410_3010818_-	hypothetical protein	NA	H9C0W7	Aeromonas_phage	44.6	7.3e-16
WP_041415448.1|3010826_3011168_-	hypothetical protein	NA	A0A077K9T0	Edwardsiella_phage	36.4	1.8e-12
WP_020827335.1|3011279_3012758_-	DUF3383 domain-containing protein	NA	H9C0W5	Aeromonas_phage	35.2	1.7e-70
WP_051150527.1|3012758_3013190_-	hypothetical protein	NA	A0A077KC88	Edwardsiella_phage	32.8	2.7e-13
WP_020827337.1|3013300_3013669_-	hypothetical protein	NA	A0A077KAW7	Edwardsiella_phage	53.3	1.0e-29
WP_020827338.1|3013668_3014115_-	hypothetical protein	NA	A0A077KC03	Edwardsiella_phage	63.0	9.3e-41
WP_020827339.1|3014115_3014511_-	DUF4054 domain-containing protein	NA	A0A068CGG9	Acinetobacter_phage	43.0	3.0e-14
WP_051150528.1|3014514_3014736_-	hypothetical protein	NA	NA	NA	NA	NA
WP_020827341.1|3014844_3015873_-	hypothetical protein	NA	A0A077KC85	Edwardsiella_phage	37.1	2.5e-60
WP_020827342.1|3015872_3016361_-	hypothetical protein	NA	A0A077KAW3	Edwardsiella_phage	45.9	3.5e-33
WP_020827343.1|3016362_3017484_-	DUF2213 domain-containing protein	NA	A0A219YBB9	Aeromonas_phage	38.4	4.9e-62
WP_041415451.1|3017533_3018229_-|head	phage head morphogenesis protein	head	A0A077KGU5	Edwardsiella_phage	47.4	4.2e-48
WP_020827345.1|3018281_3019706_-	DUF1073 domain-containing protein	NA	A0A077KC81	Edwardsiella_phage	35.7	1.4e-74
WP_020827346.1|3019702_3021229_-|terminase	phage terminase large subunit	terminase	Q7Y5U7	Haemophilus_phage	50.4	1.3e-134
WP_020827347.1|3021182_3021716_-|terminase	terminase small subunit	terminase	G0ZND3	Cronobacter_phage	41.0	1.1e-24
WP_071846586.1|3021777_3022053_-	hypothetical protein	NA	I3NL98	Bifidobacterium_phage	51.7	5.8e-09
WP_169534193.1|3022711_3023110_-	hypothetical protein	NA	NA	NA	NA	NA
WP_020827350.1|3023118_3023559_-	lysozyme	NA	A0A0M4R365	Salmonella_phage	69.8	6.4e-50
WP_020827351.1|3023572_3023893_-	hypothetical protein	NA	NA	NA	NA	NA
WP_020827352.1|3023885_3024221_-|holin	phage holin, lambda family	holin	A0A0M3ULK9	Salmonella_phage	45.9	6.0e-24
WP_020827354.1|3024742_3025357_-	hypothetical protein	NA	F1C5D0	Cronobacter_phage	56.5	1.1e-55
WP_020827356.1|3025550_3026084_-	HNH endonuclease	NA	R9TNJ4	Aeromonas_phage	40.1	2.7e-26
WP_041415459.1|3026080_3026704_-	recombination protein NinG	NA	H6WRY9	Salmonella_phage	45.3	1.8e-42
WP_020827358.1|3026696_3026816_-	hypothetical protein	NA	NA	NA	NA	NA
WP_041415461.1|3026967_3027306_-	DUF2591 family protein	NA	R9VYJ6	Serratia_phage	41.1	1.1e-12
WP_020827362.1|3027433_3027610_-	NinE family protein	NA	NA	NA	NA	NA
WP_020827363.1|3027609_3028077_-	recombination protein NinB	NA	I6R9D0	Salmonella_phage	52.1	8.3e-40
WP_020827364.1|3028079_3028421_-	hypothetical protein	NA	I6R980	Salmonella_phage	59.6	3.9e-31
WP_020827365.1|3028408_3028729_-	hypothetical protein	NA	NA	NA	NA	NA
WP_020827366.1|3028721_3029027_-	hypothetical protein	NA	E5AGF1	Erwinia_phage	55.6	2.1e-20
WP_081667704.1|3029019_3029187_-	hypothetical protein	NA	NA	NA	NA	NA
WP_020827367.1|3029186_3030590_-	AAA family ATPase	NA	F1C5C4	Cronobacter_phage	63.4	4.2e-164
WP_020827368.1|3030579_3031479_-	hypothetical protein	NA	F1C5C3	Cronobacter_phage	62.2	3.5e-103
WP_020827369.1|3031465_3031630_-	hypothetical protein	NA	Q76H53	Enterobacteria_phage	63.0	4.8e-11
WP_020827370.1|3031664_3032150_-	HNH endonuclease	NA	A0A0P0ICV0	Acinetobacter_phage	49.3	3.5e-33
WP_020827371.1|3032149_3032431_-	transcriptional regulator	NA	G8EYH8	Enterobacteria_phage	54.8	1.2e-20
WP_041415468.1|3032545_3032773_-	helix-turn-helix domain-containing protein	NA	A0A2H4FNF3	Salmonella_phage	73.3	5.8e-23
WP_020827373.1|3032890_3033625_+	helix-turn-helix transcriptional regulator	NA	A0A2H4FNG6	Salmonella_phage	69.5	1.7e-92
WP_020827375.1|3034080_3034356_+	hypothetical protein	NA	NA	NA	NA	NA
WP_020827376.1|3034360_3034855_-	hypothetical protein	NA	K7PK22	Enterobacteria_phage	63.4	1.9e-55
WP_020827377.1|3035084_3035654_+	pentapeptide repeat-containing protein	NA	A0A220NQW1	Salmonella_phage	59.3	1.0e-31
WP_020827379.1|3035778_3036006_+	hypothetical protein	NA	B5WZV1	Pseudomonas_phage	48.6	5.8e-07
WP_020827380.1|3036122_3036377_+	hypothetical protein	NA	NA	NA	NA	NA
WP_020827381.1|3036454_3036589_+|protease	protease FtsH-inhibitory lysogeny factor CIII	protease	NA	NA	NA	NA
WP_020827383.1|3036692_3036863_+	hypothetical protein	NA	A0A2H4JCE0	uncultured_Caudovirales_phage	55.4	2.5e-10
WP_020827384.1|3036871_3037477_+	ERF family protein	NA	I6RSN3	Salmonella_phage	75.1	1.3e-74
WP_020827385.1|3037476_3037875_+	hypothetical protein	NA	I6S1T0	Salmonella_phage	77.1	6.0e-47
WP_020827387.1|3038297_3039143_+	hypothetical protein	NA	NA	NA	NA	NA
WP_020827388.1|3039146_3039602_+	hypothetical protein	NA	NA	NA	NA	NA
WP_020827389.1|3039598_3040129_+	hypothetical protein	NA	J9Q748	Salmonella_phage	65.1	8.2e-60
WP_020827390.1|3040125_3040503_+	DUF5448 family protein	NA	T1SA95	Salmonella_phage	69.6	7.1e-42
WP_020827391.1|3040489_3040708_+	hypothetical protein	NA	NA	NA	NA	NA
WP_020827392.1|3040704_3040938_+	hypothetical protein	NA	R9VX58	Serratia_phage	62.2	1.8e-19
WP_020827393.1|3040927_3041551_+	hypothetical protein	NA	NA	NA	NA	NA
WP_020827394.1|3041608_3041869_+	hypothetical protein	NA	A0A1V0E5L9	Salmonella_phage	60.8	2.2e-18
WP_020827395.1|3041878_3042133_+	DNA polymerase III subunit theta	NA	H9C187	Pectobacterium_phage	71.4	1.1e-25
WP_020827396.1|3042156_3042435_+	hypothetical protein	NA	NA	NA	NA	NA
WP_020827397.1|3042503_3042665_+	hypothetical protein	NA	NA	NA	NA	NA
WP_020827398.1|3042685_3042865_+	hypothetical protein	NA	NA	NA	NA	NA
WP_041414676.1|3043389_3043644_+	excisionase Xis	NA	NA	NA	NA	NA
WP_020827401.1|3043615_3044839_-|integrase	site-specific integrase	integrase	H6WRW7	Salmonella_phage	52.7	3.6e-127
WP_164171190.1|3045068_3046148_-	porin	NA	Q1MVN1	Enterobacteria_phage	54.6	9.0e-106
3045035:3045050	attR	TCCCGACACAGGAAGA	NA	NA	NA	NA
>prophage 5
NC_021741	Serratia liquefaciens ATCC 27592, complete sequence	5238612	3711790	3721725	5238612		Planktothrix_phage(33.33%)	8	NA	NA
WP_020827991.1|3711790_3713518_+	phosphoenolpyruvate-protein phosphotransferase PtsI	NA	A0A1V0SGR7	Hokovirus	32.9	1.1e-17
WP_012146162.1|3713567_3714077_+	PTS glucose transporter subunit IIA	NA	NA	NA	NA	NA
WP_041415561.1|3714341_3715658_-	HAMP domain-containing protein	NA	W8CYF6	Bacillus_phage	25.6	3.2e-20
WP_020827993.1|3715663_3716344_-	response regulator transcription factor	NA	NA	NA	NA	NA
WP_041414805.1|3716518_3717712_+	efflux RND transporter periplasmic adaptor subunit	NA	A0A140XAI1	Dickeya_phage	69.7	1.3e-28
WP_041415563.1|3717714_3719667_+	MacB family efflux pump subunit	NA	G9BWD6	Planktothrix_phage	41.6	4.5e-39
WP_020827996.1|3719670_3720552_-	cysteine synthase CysM	NA	A0A1X9I5F1	Streptococcus_phage	40.3	1.1e-53
WP_020827997.1|3720636_3721725_-	sulfate/thiosulfate ABC transporter ATP-binding protein CysA	NA	G9BWD6	Planktothrix_phage	40.7	9.3e-34
>prophage 6
NC_021741	Serratia liquefaciens ATCC 27592, complete sequence	5238612	3794065	3801412	5238612		Salmonella_phage(33.33%)	11	NA	NA
WP_020828066.1|3794065_3794419_+	arsenate reductase (glutaredoxin)	NA	A0A2H4J8T1	uncultured_Caudovirales_phage	44.4	3.9e-18
WP_020828067.1|3794618_3794849_+	hypothetical protein	NA	J9Q735	Salmonella_phage	50.7	1.3e-14
WP_020828068.1|3794861_3795401_+	DNA-binding protein	NA	J9Q7G7	Salmonella_phage	56.2	2.5e-48
WP_041414814.1|3795417_3796119_-	DnaA inactivator Hda	NA	NA	NA	NA	NA
WP_153263174.1|3796088_3796238_+	hypothetical protein	NA	NA	NA	NA	NA
WP_020828070.1|3796347_3796863_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002487967.1|3796891_3797140_+	GlsB/YeaQ/YmgE family stress response membrane protein	NA	NA	NA	NA	NA
WP_020828071.1|3797355_3798645_-	uracil permease	NA	Q9KX94	Enterobacteria_phage	38.3	7.1e-65
WP_020828072.1|3798854_3799481_-	uracil phosphoribosyltransferase	NA	NA	NA	NA	NA
WP_020828073.1|3799736_3800777_+	phosphoribosylformylglycinamidine cyclo-ligase	NA	A0A1D7SE90	Cyanophage	41.9	2.6e-70
WP_020828074.1|3800773_3801412_+	phosphoribosylglycinamide formyltransferase	NA	E3SNR5	Prochlorococcus_phage	39.2	2.9e-27
>prophage 7
NC_021741	Serratia liquefaciens ATCC 27592, complete sequence	5238612	3903280	4001514	5238612	head,capsid,protease,portal,tRNA,terminase,holin,integrase,tail	Enterobacteria_phage(20.0%)	97	3958680:3958702	4001754:4001776
WP_020828155.1|3903280_3904477_-|tRNA	bifunctional tRNA (adenosine(37)-C2)-methyltransferase TrmG/ribosomal RNA large subunit methyltransferase RlmN	tRNA	NA	NA	NA	NA
WP_004952077.1|3904714_3905140_-	nucleoside-diphosphate kinase	NA	A0A0M5KH58	Mollivirus	38.8	1.6e-13
WP_020828156.1|3905510_3906548_+	LacI family DNA-binding transcriptional regulator	NA	NA	NA	NA	NA
WP_020828157.1|3906670_3908110_+	Na+/H+ antiporter NhaC	NA	NA	NA	NA	NA
WP_020828158.1|3908111_3909296_+	pyridoxal phosphate-dependent aminotransferase	NA	NA	NA	NA	NA
WP_020828159.1|3909353_3910184_-	enhanced serine sensitivity protein SseB	NA	NA	NA	NA	NA
WP_020828160.1|3910275_3911571_-	aminopeptidase PepB	NA	Q6GYZ8	Mycoplasma_phage	32.1	1.0e-34
WP_020828161.1|3911654_3911855_-	Fe-S cluster assembly protein IscX	NA	NA	NA	NA	NA
WP_004952086.1|3911887_3912223_-	ISC system 2Fe-2S type ferredoxin	NA	NA	NA	NA	NA
WP_041415599.1|3912225_3914076_-	Fe-S protein assembly chaperone HscA	NA	A0A0N9QXN8	Chrysochromulina_ericina_virus	41.5	3.3e-100
WP_020828163.1|3914226_3914748_-	co-chaperone HscB	NA	NA	NA	NA	NA
WP_004952089.1|3914810_3915134_-	iron-sulfur cluster assembly protein IscA	NA	A0A2H4N7N5	Lake_Baikal_phage	45.4	1.0e-20
WP_020828164.1|3915259_3915646_-	Fe-S cluster assembly scaffold IscU	NA	A0A218MKD1	uncultured_virus	78.1	1.4e-53
WP_020828165.1|3915670_3916885_-	IscS subfamily cysteine desulfurase	NA	A0A1X7C038	Faustovirus	32.2	4.7e-34
WP_020828166.1|3916940_3917435_-	Fe-S cluster assembly transcriptional regulator IscR	NA	NA	NA	NA	NA
WP_020828167.1|3917630_3918365_-|tRNA	tRNA (cytosine(32)/uridine(32)-2'-O)-methyltransferase TrmJ	tRNA	NA	NA	NA	NA
WP_020828168.1|3918484_3919288_+	inositol-1-monophosphatase	NA	NA	NA	NA	NA
WP_020828169.1|3919463_3920486_-	nickel/cobalt transporter	NA	NA	NA	NA	NA
WP_020828170.1|3920476_3921145_-	DUF1007 family protein	NA	NA	NA	NA	NA
WP_020828171.1|3921289_3922555_+	stationary phase inducible protein CsiE	NA	NA	NA	NA	NA
WP_020828172.1|3922551_3923703_-	3-phenylpropionate MFS transporter	NA	NA	NA	NA	NA
WP_020828173.1|3923858_3925112_-	serine hydroxymethyltransferase	NA	A0A240F3L3	Aeromonas_phage	53.2	6.0e-101
WP_020828174.1|3925485_3926676_+	NO-inducible flavohemoprotein	NA	NA	NA	NA	NA
WP_041414839.1|3926839_3928027_-	cytochrome c	NA	NA	NA	NA	NA
WP_020828176.1|3928023_3929934_-	NAD(P)/FAD-dependent oxidoreductase	NA	NA	NA	NA	NA
WP_020828177.1|3930020_3931445_-	aminobutyraldehyde dehydrogenase	NA	NA	NA	NA	NA
WP_020828178.1|3931617_3932424_-	ABC transporter permease	NA	NA	NA	NA	NA
WP_020828179.1|3932413_3933358_-	ABC transporter permease	NA	NA	NA	NA	NA
WP_020828180.1|3933359_3934388_-	ABC transporter ATP-binding protein	NA	G3M9Y6	Bacillus_virus	31.5	3.7e-24
WP_020828181.1|3934442_3935597_-	ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_020828182.1|3935845_3937309_-	gamma-aminobutyraldehyde dehydrogenase	NA	NA	NA	NA	NA
WP_020828183.1|3937425_3938349_-	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_004847623.1|3939018_3939357_-	nitrogen regulatory protein P-II	NA	NA	NA	NA	NA
WP_020828185.1|3939367_3940990_-	NAD+ synthase	NA	A0A2L0UZF5	Agrobacterium_phage	35.9	5.4e-94
WP_020828186.1|3941118_3942456_-	two-component system response regulator GlrR	NA	W8CYM9	Bacillus_phage	28.8	6.5e-13
WP_020828187.1|3942452_3943322_-	two-component system QseEF-associated lipoprotein QseG	NA	NA	NA	NA	NA
WP_020828188.1|3943324_3944761_-	HAMP domain-containing histidine kinase	NA	W8CYF6	Bacillus_phage	24.7	2.6e-15
WP_020828189.1|3945570_3949461_-	phosphoribosylformylglycinamidine synthase	NA	A9YX36	Burkholderia_phage	58.4	5.2e-127
WP_041415604.1|3949740_3951201_+	membrane-bound lytic murein transglycosylase MltF	NA	G0YQ82	Erwinia_phage	38.1	1.3e-09
WP_020828191.1|3951201_3951714_-|tRNA	tRNA adenosine(34) deaminase TadA	tRNA	S4VYT2	Pandoravirus	41.7	2.3e-06
WP_020828192.1|3951898_3952951_+	DUF2157 domain-containing protein	NA	NA	NA	NA	NA
WP_020828193.1|3953150_3954302_+	L-threonine dehydrogenase	NA	NA	NA	NA	NA
WP_020828194.1|3954342_3954999_-	phosphatidylglycerophosphatase C	NA	NA	NA	NA	NA
WP_020828195.1|3955002_3956370_-	PTS transporter subunit EIIC	NA	NA	NA	NA	NA
WP_020828196.1|3956388_3957282_-	N-acetylmuramic acid 6-phosphate etherase	NA	NA	NA	NA	NA
WP_041414843.1|3957450_3958299_+	MurR/RpiR family transcriptional regulator	NA	NA	NA	NA	NA
3958680:3958702	attL	TGCATCAACTGCGACATGTGCGA	NA	NA	NA	NA
WP_020828198.1|3958901_3959144_+	DinI family protein	NA	K7PKR6	Enterobacteria_phage	83.5	6.8e-30
WP_020828200.1|3959408_3960887_-|tail	prophage tail fiber N-terminal domain-containing protein	tail	A0A1I9SF20	Klebsiella_phage	39.4	2.9e-30
WP_041414844.1|3962334_3963324_-	hypothetical protein	NA	NA	NA	NA	NA
WP_041414846.1|3963325_3966541_-	host specificity protein J	NA	F1C571	Cronobacter_phage	61.8	0.0e+00
WP_020828202.1|3966714_3967002_+	hypothetical protein	NA	I6S632	Salmonella_phage	61.1	5.1e-24
WP_041415610.1|3967096_3967699_-|tail	tail assembly protein	tail	F1C572	Cronobacter_phage	66.0	7.6e-62
WP_169534195.1|3967758_3968220_-	hypothetical protein	NA	NA	NA	NA	NA
WP_020828205.1|3968299_3969001_-	C40 family peptidase	NA	A0A1W6JP31	Morganella_phage	55.0	1.6e-74
WP_020828206.1|3969003_3969756_-|tail	phage minor tail protein L	tail	A0A1W6JNX9	Morganella_phage	60.2	2.8e-90
WP_020828207.1|3969764_3970100_-|tail	phage tail protein	tail	Q6UAW6	Klebsiella_phage	39.3	8.3e-18
WP_020828208.1|3970096_3973414_-|tail	phage tail tape measure protein	tail	Q6UAW7	Klebsiella_phage	58.3	0.0e+00
WP_020828209.1|3973406_3973628_-	hypothetical protein	NA	Q6UAW9	Klebsiella_phage	55.6	2.6e-12
WP_020828210.1|3973645_3974011_-|tail	phage tail protein	tail	Q6UAW8	Klebsiella_phage	44.4	1.8e-21
WP_020828211.1|3974020_3974284_-	immunoglobulin domain-containing protein	NA	Q7Y402	Yersinia_phage	54.7	4.2e-17
WP_020828212.1|3974280_3974736_-	hypothetical protein	NA	Q7Y403	Yersinia_phage	74.1	9.5e-57
WP_020828213.1|3974770_3975163_-	HK97 gp10 family phage protein	NA	Q6UAX1	Klebsiella_phage	66.9	2.2e-41
WP_020828214.1|3975159_3975549_-	hypothetical protein	NA	Q7Y405	Yersinia_phage	51.6	1.1e-32
WP_020828215.1|3975535_3975874_-|head	phage head closure protein	head	Q7Y406	Yersinia_phage	50.9	1.5e-19
WP_020828216.1|3975870_3976197_-|head,tail	phage gp6-like head-tail connector protein	head,tail	K7PKT4	Enterobacteria_phage	56.5	1.5e-32
WP_020828217.1|3976205_3976463_-	hypothetical protein	NA	NA	NA	NA	NA
WP_020828218.1|3976511_3977732_-|capsid	phage major capsid protein	capsid	K7PM57	Enterobacteria_phage	79.8	1.8e-179
WP_020828219.1|3977744_3978599_-|protease	ATP-dependent Clp protease proteolytic subunit	protease	K7PH05	Enterobacteria_phage	78.2	1.3e-123
WP_020828220.1|3978612_3979917_-|portal	phage portal protein	portal	K7PJU5	Enterobacteria_phage	80.2	1.7e-204
WP_071846570.1|3979916_3981662_-|terminase	terminase large subunit	terminase	M4QNU0	Tetraselmis_viridis_virus	44.2	3.4e-139
WP_020828222.1|3981612_3982080_-|terminase	phage terminase small subunit P27 family	terminase	Q9B019	Phage_GMSE-1	62.7	5.7e-49
WP_020828223.1|3982204_3982534_-	HNH endonuclease	NA	K7PM05	Enterobacterial_phage	65.8	2.3e-36
WP_020828224.1|3982662_3982881_-	hypothetical protein	NA	NA	NA	NA	NA
WP_020828225.1|3983197_3983737_-	hypothetical protein	NA	K7P6W1	Enterobacteria_phage	54.1	9.6e-32
WP_020828226.1|3983733_3984168_-	lysozyme	NA	R9TMH8	Aeromonas_phage	59.4	9.4e-38
WP_041414854.1|3984154_3984502_-|holin	phage holin, lambda family	holin	Q8HA87	Salmonella_phage	66.7	2.2e-29
WP_020828227.1|3984576_3985605_-	site-specific DNA-methyltransferase	NA	Q8W637	Enterobacteria_phage	62.7	7.0e-124
WP_020828228.1|3985962_3986892_+	hypothetical protein	NA	NA	NA	NA	NA
WP_020828229.1|3987021_3987354_-	hypothetical protein	NA	NA	NA	NA	NA
WP_041415617.1|3987446_3987806_-	antitermination protein	NA	A0A0P0ZCW0	Stx2-converting_phage	60.2	4.3e-36
WP_020828231.1|3987805_3988384_-	recombination protein NinG	NA	A0A1P8DTE0	Proteus_phage	65.6	3.2e-41
WP_020828232.1|3988367_3989354_-	toprim domain-containing protein	NA	A0A286N2Q0	Klebsiella_phage	60.7	8.0e-109
WP_041415622.1|3989350_3990874_-	DEAD/DEAH box helicase	NA	A0A286N2P9	Klebsiella_phage	63.2	5.4e-197
WP_020828236.1|3991369_3991879_-	hypothetical protein	NA	S5FXP0	Shigella_phage	53.5	4.6e-44
WP_020828237.1|3991945_3992179_-	hypothetical protein	NA	O48419	Enterobacteria_phage	63.6	6.8e-19
WP_020828238.1|3992297_3993050_+	helix-turn-helix transcriptional regulator	NA	Q76H56	Enterobacteria_phage	34.4	1.7e-31
WP_041415624.1|3993646_3993853_+	hypothetical protein	NA	NA	NA	NA	NA
WP_071846572.1|3993812_3994259_-	hypothetical protein	NA	NA	NA	NA	NA
WP_020828241.1|3994377_3994689_-	hypothetical protein	NA	NA	NA	NA	NA
WP_020828242.1|3994874_3995237_+	hypothetical protein	NA	NA	NA	NA	NA
WP_020828243.1|3995272_3996085_+	DUF2303 family protein	NA	NA	NA	NA	NA
WP_020828244.1|3996177_3996993_+	hypothetical protein	NA	A0A2H4J902	uncultured_Caudovirales_phage	61.3	1.9e-87
WP_020828246.1|3997325_3998093_-	hypothetical protein	NA	NA	NA	NA	NA
WP_020828247.1|3998091_3998661_+	3'-5' exoribonuclease	NA	K7PLW7	Enterobacteria_phage	63.2	1.0e-63
WP_071846573.1|3998677_3998893_+	DNA-binding protein	NA	NA	NA	NA	NA
WP_020828248.1|3999021_3999954_-	hypothetical protein	NA	NA	NA	NA	NA
WP_020828249.1|4000116_4001514_-|integrase	tyrosine-type recombinase/integrase	integrase	NA	NA	NA	NA
4001754:4001776	attR	TGCATCAACTGCGACATGTGCGA	NA	NA	NA	NA
