The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
NZ_CP011989	Klebsiella pneumoniae UHKPC33 chromosome, complete genome	5329725	446291	479546	5329725	tail,tRNA,head,protease,terminase,portal,integrase,capsid	uncultured_Caudovirales_phage(73.33%)	33	463897:463914	479891:479908
WP_002919147.1|446291_447239_-|tRNA	methionyl-tRNA formyltransferase	tRNA	E3SNR5	Prochlorococcus_phage	37.2	2.2e-07
WP_002919144.1|447253_447763_-	peptide deformylase	NA	E3SLL2	Synechococcus_phage	40.3	2.6e-18
WP_002919139.1|447891_449016_+	DNA-protecting protein DprA	NA	NA	NA	NA	NA
WP_002919137.1|448987_449461_+	DUF494 domain-containing protein	NA	NA	NA	NA	NA
WP_004145330.1|449486_450029_+	topoisomerase DNA-binding C4 zinc finger domain-containing protein	NA	NA	NA	NA	NA
WP_002919132.1|450033_450606_+	L-threonylcarbamoyladenylate synthase type 1 TsaC	NA	NA	NA	NA	NA
WP_002919126.1|450609_451428_+	shikimate dehydrogenase	NA	NA	NA	NA	NA
WP_002919125.1|451424_451682_+	DUF1488 domain-containing protein	NA	NA	NA	NA	NA
WP_002919123.1|451657_452212_-	gamma carbonic anhydrase family protein	NA	NA	NA	NA	NA
WP_002919103.1|458005_458227_-	membrane protein	NA	NA	NA	NA	NA
WP_002919102.1|458520_461631_-	multidrug efflux RND transporter permease subunit	NA	NA	NA	NA	NA
WP_002919101.1|461643_462783_-	efflux RND transporter periplasmic adaptor subunit	NA	NA	NA	NA	NA
WP_004150972.1|463161_463812_+	acrEF/envCD operon transcriptional regulator	NA	NA	NA	NA	NA
463897:463914	attL	GTATCAGTTCATGCCGTA	NA	NA	NA	NA
WP_004150971.1|464087_465314_+|integrase	site-specific integrase	integrase	A0A2H4JB45	uncultured_Caudovirales_phage	62.2	1.8e-150
WP_004150970.1|465406_466348_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001547839.1|466529_466814_+	AlpA family phage regulatory protein	NA	NA	NA	NA	NA
WP_004150969.1|466824_467604_+	phage antirepressor KilAC domain-containing protein	NA	Q8HA02	Enterobacteria_phage	51.5	6.2e-40
WP_106918304.1|468055_468325_+	host cell division inhibitor Icd-like protein	NA	A0A2H4JGW3	uncultured_Caudovirales_phage	94.4	2.4e-44
WP_001549752.1|468317_468506_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004150967.1|468498_468813_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001549749.1|469173_469539_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004150965.1|469538_471674_+	DUF927 domain-containing protein	NA	A0A1W6JPG0	Morganella_phage	62.4	3.4e-205
WP_004150964.1|472016_472352_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004150963.1|472400_472913_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001549743.1|473176_474343_+|capsid	phage major capsid protein	capsid	A0A2H4JED2	uncultured_Caudovirales_phage	95.9	9.8e-207
WP_001547826.1|474394_474955_+|head,protease	HK97 family phage prohead protease	head,protease	A0A2H4JB68	uncultured_Caudovirales_phage	95.7	1.2e-98
WP_004150962.1|474956_476198_+|portal	phage portal protein	portal	A0A2H4JFJ9	uncultured_Caudovirales_phage	96.5	1.0e-230
WP_004150961.1|476194_476530_+|head	phage head closure protein	head	A0A2H4JHK5	uncultured_Caudovirales_phage	57.8	3.7e-26
WP_001547824.1|476526_476826_+|head,tail	phage gp6-like head-tail connector protein	head,tail	A0A2H4JD08	uncultured_Caudovirales_phage	80.8	3.4e-39
WP_004150959.1|476825_477269_+	HNH endonuclease	NA	A0A2H4JAS8	uncultured_Caudovirales_phage	91.8	2.8e-77
WP_004150957.1|477261_477414_+	hypothetical protein	NA	A0A2H4JCY9	uncultured_Caudovirales_phage	88.0	2.4e-17
WP_000113647.1|477544_477901_+|terminase	phage terminase small subunit P27 family	terminase	A0A2H4JHS3	uncultured_Caudovirales_phage	99.2	5.5e-60
WP_004150955.1|477884_479546_+|terminase	terminase large subunit	terminase	A0A2H4JB64	uncultured_Caudovirales_phage	98.0	0.0e+00
479891:479908	attR	GTATCAGTTCATGCCGTA	NA	NA	NA	NA
>prophage 2
NZ_CP011989	Klebsiella pneumoniae UHKPC33 chromosome, complete genome	5329725	1685453	1692360	5329725	tRNA	Planktothrix_phage(33.33%)	6	NA	NA
WP_004175147.1|1685453_1686317_+	ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	27.5	5.7e-10
WP_002912638.1|1686327_1687101_+	ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	36.3	1.5e-25
WP_004151134.1|1687343_1688240_-	lipid kinase YegS	NA	A0A1V0SBJ0	Catovirus	29.8	6.1e-15
WP_002912635.1|1688482_1689844_-|tRNA	tRNA 5-hydroxyuridine modification protein YegQ	tRNA	Q6DW11	Phage_TP	94.5	2.5e-206
WP_002912634.1|1690162_1690885_-	two-component system response regulator BaeR	NA	W8CYM9	Bacillus_phage	33.2	6.4e-31
WP_004151135.1|1690881_1692360_-	two-component system sensor histidine kinase BaeS	NA	W8CYF6	Bacillus_phage	28.3	1.1e-29
>prophage 3
NZ_CP011989	Klebsiella pneumoniae UHKPC33 chromosome, complete genome	5329725	1972703	2029188	5329725	transposase,plate,protease	Staphylococcus_phage(16.67%)	54	NA	NA
WP_002910830.1|1972703_1973450_+|protease	proteasome-type protease	protease	NA	NA	NA	NA
WP_002910809.1|1973888_1974875_+	fatty acid desaturase	NA	NA	NA	NA	NA
WP_004151439.1|1974867_1975668_+	PhnD/SsuA/transferrin family substrate-binding protein	NA	NA	NA	NA	NA
WP_002910767.1|1975654_1975828_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004219597.1|1976125_1976269_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002910764.1|1976445_1977387_+	transcriptional regulator TdcA	NA	NA	NA	NA	NA
WP_002910762.1|1977480_1978470_+	bifunctional threonine ammonia-lyase/L-serine ammonia-lyase TdcB	NA	NA	NA	NA	NA
WP_004145486.1|1978495_1979827_+	threonine/serine transporter TdcC	NA	NA	NA	NA	NA
WP_002910759.1|1979854_1981063_+	propionate kinase	NA	NA	NA	NA	NA
WP_004152312.1|1981091_1983386_+	formate C-acetyltransferase	NA	A0A2P0VNR5	Tetraselmis_virus	41.8	2.3e-159
WP_004225356.1|1983437_1983584_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002910729.1|1983873_1984932_+	branched-chain amino acid ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_002910727.1|1985041_1985956_+	branched-chain amino acid ABC transporter permease	NA	NA	NA	NA	NA
WP_002910725.1|1985965_1987243_+	high-affinity branched-chain amino acid ABC transporter permease LivM	NA	NA	NA	NA	NA
WP_002910722.1|1987239_1988115_+	ATP-binding cassette domain-containing protein	NA	W8CYL7	Bacillus_phage	41.5	9.5e-05
WP_002910721.1|1988111_1988831_+	ABC transporter ATP-binding protein	NA	A0A2H4PQG7	Staphylococcus_phage	26.0	2.5e-11
WP_002910720.1|1988836_1989730_-	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_002910719.1|1990013_1991657_+	phosphoenolpyruvate carboxykinase (ATP)	NA	A0A2H4PQN1	Staphylococcus_phage	50.4	9.8e-136
WP_002910717.1|1991706_1992183_-	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_002910715.1|1992281_1993208_+	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_004152313.1|1993511_1994807_+	MFS transporter	NA	Q6JIH2	Burkholderia_virus	36.8	1.3e-61
WP_004899032.1|1994818_1995628_+	substrate-binding domain-containing protein	NA	NA	NA	NA	NA
WP_004152315.1|1995602_1996502_-	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_002910657.1|1996611_1997094_-	cold shock domain-containing protein	NA	NA	NA	NA	NA
WP_002910654.1|1997284_1997983_+	RluA family pseudouridine synthase	NA	A0A2H4UV25	Bodo_saltans_virus	27.2	2.6e-05
WP_002910652.1|1998008_1998548_-	DUF2058 domain-containing protein	NA	NA	NA	NA	NA
WP_002910650.1|1998662_1998992_-	gamma-glutamylcyclotransferase	NA	NA	NA	NA	NA
WP_002910645.1|1999560_2000901_+|plate	type VI secretion system baseplate subunit TssK	plate	NA	NA	NA	NA
WP_004152316.1|2000897_2001551_+	DotU family type IV/VI secretion system protein	NA	NA	NA	NA	NA
WP_004152317.1|2001554_2003252_+	OmpA family protein	NA	NA	NA	NA	NA
WP_004152319.1|2006215_2007571_+	S-type pyocin domain-containing protein	NA	NA	NA	NA	NA
WP_002910593.1|2007571_2008081_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002910591.1|2008077_2008584_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002910589.1|2008678_2008831_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002910586.1|2008820_2009330_+	hypothetical protein	NA	NA	NA	NA	NA
WP_022644641.1|2010935_2011904_+|transposase	IS5 family transposase	transposase	A0A1B0VFY5	Salmonella_phage	96.3	6.5e-180
WP_004199326.1|2012045_2012228_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004153085.1|2012224_2012554_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002910551.1|2012550_2013057_+	hypothetical protein	NA	NA	NA	NA	NA
WP_072093244.1|2013516_2014548_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002910547.1|2014571_2014877_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002910544.1|2014898_2015792_+	SUMF1/EgtB/PvdO family nonheme iron enzyme	NA	A0A7H6	Microcystis_virus	30.5	6.7e-14
WP_004217423.1|2015837_2015954_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004152633.1|2015975_2016869_+	SUMF1/EgtB/PvdO family nonheme iron enzyme	NA	A0A075BSL8	Microcystis_phage	27.3	1.7e-12
WP_038435084.1|2016894_2017023_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002910539.1|2017044_2017938_+	SUMF1/EgtB/PvdO family nonheme iron enzyme	NA	A0A075BSL8	Microcystis_phage	27.1	2.8e-12
WP_004152632.1|2018113_2019004_+	SUMF1/EgtB/PvdO family nonheme iron enzyme	NA	A0A7H6	Microcystis_virus	29.8	4.1e-11
WP_000019473.1|2019340_2020321_+|transposase	IS5-like element ISKpn26 family transposase	transposase	Q38213	Escherichia_phage	99.1	8.9e-185
WP_072093174.1|2020940_2021126_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002910497.1|2021423_2021690_+	PAAR domain-containing protein	NA	NA	NA	NA	NA
WP_004198077.1|2021693_2022851_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004198071.1|2022834_2026245_+	intracellular multiplication and macrophage-killing family protein	NA	NA	NA	NA	NA
WP_002910495.1|2026378_2028142_+|plate	type VI secretion system baseplate subunit TssF	plate	NA	NA	NA	NA
WP_004152910.1|2028171_2029188_+|plate	type VI secretion system baseplate subunit TssG	plate	NA	NA	NA	NA
>prophage 4
NZ_CP011989	Klebsiella pneumoniae UHKPC33 chromosome, complete genome	5329725	2692363	2703250	5329725		Escherichia_phage(87.5%)	9	NA	NA
WP_004151613.1|2692363_2695471_+	beta-galactosidase	NA	L0N6M2	Herpes_simplex_virus	59.6	0.0e+00
WP_004151612.1|2695525_2696791_+	MFS transporter	NA	NA	NA	NA	NA
WP_001620097.1|2696821_2697910_-	AAA family ATPase	NA	A0A077SLJ9	Escherichia_phage	100.0	8.0e-211
WP_002904006.1|2697996_2698257_-	hypothetical protein	NA	A0A077SK33	Escherichia_phage	97.7	3.5e-40
WP_004176269.1|2698554_2699415_+	class A broad-spectrum beta-lactamase SHV-11	NA	A0A077SL40	Escherichia_phage	99.3	2.2e-155
WP_002210513.1|2699435_2700197_-	DeoR/GlpR transcriptional regulator	NA	A0A077SK06	Escherichia_phage	100.0	1.9e-134
WP_004151610.1|2700457_2701360_+	NAD(P)-dependent oxidoreductase	NA	A0A077SLF7	Escherichia_phage	99.3	7.7e-159
WP_004151609.1|2701371_2702637_+	four-carbon acid sugar kinase family protein	NA	A0A077SLJ7	Escherichia_phage	99.5	6.6e-233
WP_002210516.1|2702629_2703250_+	aldolase	NA	A0A077SK32	Escherichia_phage	100.0	8.0e-115
>prophage 5
NZ_CP011989	Klebsiella pneumoniae UHKPC33 chromosome, complete genome	5329725	2897712	2970513	5329725	holin,transposase,plate,terminase,integrase	uncultured_Caudovirales_phage(35.29%)	83	2961626:2961640	2967635:2967649
WP_002902268.1|2897712_2898798_-|plate	type VI secretion system baseplate subunit TssG	plate	NA	NA	NA	NA
WP_004151598.1|2898761_2900516_-|plate	type VI secretion system baseplate subunit TssF	plate	NA	NA	NA	NA
WP_004151599.1|2902187_2905613_-	type VI secretion protein VasK	NA	NA	NA	NA	NA
WP_002902254.1|2905596_2906736_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002902252.1|2906732_2906990_-	PAAR domain-containing protein	NA	NA	NA	NA	NA
WP_004151601.1|2907034_2909452_-	DUF2235 domain-containing protein	NA	NA	NA	NA	NA
WP_002902178.1|2910036_2910567_-	T6SS immunity phospholipase A1-binding lipoprotein Tli1-KP	NA	NA	NA	NA	NA
WP_002902176.1|2910635_2911166_-	T6SS immunity phospholipase A1-binding lipoprotein Tli1-KP	NA	NA	NA	NA	NA
WP_002902174.1|2911233_2911764_-	T6SS immunity phospholipase A1-binding lipoprotein Tli1-KP	NA	NA	NA	NA	NA
WP_002902172.1|2911832_2912363_-	T6SS immunity phospholipase A1-binding lipoprotein Tli1-KP	NA	NA	NA	NA	NA
WP_002902169.1|2912426_2913206_-	DUF4123 domain-containing protein	NA	NA	NA	NA	NA
WP_004228410.1|2913206_2915576_-	type VI secretion system tip protein VgrG	NA	A0A2H4JCD4	uncultured_Caudovirales_phage	33.8	9.1e-18
WP_002902163.1|2915577_2918232_-	type VI secretion system ATPase TssH	NA	K4FB40	Cronobacter_phage	33.4	2.5e-96
WP_002902160.1|2918496_2918988_-	type VI secretion system effector Hcp	NA	NA	NA	NA	NA
WP_004151602.1|2918992_2920699_-	OmpA family protein	NA	NA	NA	NA	NA
WP_004151603.1|2920695_2921385_-	DotU family type IV/VI secretion system protein	NA	NA	NA	NA	NA
WP_004218490.1|2921381_2922725_-|plate	type VI secretion system baseplate subunit TssK	plate	NA	NA	NA	NA
WP_002902148.1|2922734_2924279_-	type VI secretion system contractile sheath large subunit	NA	NA	NA	NA	NA
WP_002902144.1|2924321_2924813_-	type VI secretion system contractile sheath small subunit	NA	NA	NA	NA	NA
WP_002902136.1|2925658_2925907_+	DinI-like family protein	NA	S5MQI1	Escherichia_phage	70.4	1.4e-25
WP_002902133.1|2926129_2926414_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002902131.1|2926518_2926728_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002902128.1|2926724_2927456_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004218487.1|2927466_2928195_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004152577.1|2930545_2930743_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004152576.1|2930742_2931609_-	hypothetical protein	NA	A0A2H4IYR0	uncultured_Caudovirales_phage	64.5	1.9e-34
WP_004152575.1|2931608_2932382_-	DUF2612 domain-containing protein	NA	A0A2H4J1A9	uncultured_Caudovirales_phage	54.4	2.8e-77
WP_004152574.1|2932378_2933575_-|plate	baseplate J/gp47 family protein	plate	A0A0M4RD32	Salmonella_phage	72.9	3.9e-158
WP_004152573.1|2933574_2933928_-	hypothetical protein	NA	A0A2H4J629	uncultured_Caudovirales_phage	80.3	2.3e-50
WP_004152572.1|2933929_2934583_-	hypothetical protein	NA	A0A2H4J8H6	uncultured_Caudovirales_phage	63.5	1.0e-59
WP_004152571.1|2934636_2935203_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004199301.1|2935245_2935428_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004152570.1|2935477_2935819_-	hypothetical protein	NA	A0A2H4J1A5	uncultured_Caudovirales_phage	46.6	1.8e-23
WP_004152569.1|2935818_2936841_-	hypothetical protein	NA	A0A2H4J1B2	uncultured_Caudovirales_phage	54.2	9.2e-100
WP_004217362.1|2936843_2937071_-	hypothetical protein	NA	A0A2H4J495	uncultured_Caudovirales_phage	56.0	4.6e-20
WP_004152567.1|2937146_2937746_-	hypothetical protein	NA	A0A2H4J1B3	uncultured_Caudovirales_phage	57.6	9.9e-54
WP_004152566.1|2937745_2939749_-	lytic transglycosylase domain-containing protein	NA	A0A2H4J9N7	uncultured_Caudovirales_phage	63.6	1.2e-247
WP_004152565.1|2939738_2939891_-	hypothetical protein	NA	A0A2H4J1A2	uncultured_Caudovirales_phage	88.0	7.6e-19
WP_004152564.1|2939926_2940352_-	hypothetical protein	NA	A0A2H4J2V6	uncultured_Caudovirales_phage	63.4	2.6e-40
WP_085955245.1|2940678_2941870_+|transposase	IS3-like element ISKpn18 family transposase	transposase	U5P429	Shigella_phage	43.5	3.5e-50
WP_004152178.1|2941811_2942102_-	DUF3277 family protein	NA	A0A2H4J619	uncultured_Caudovirales_phage	85.5	2.6e-23
WP_004152177.1|2942112_2943258_-	DUF3383 domain-containing protein	NA	A0A2H4J8G4	uncultured_Caudovirales_phage	76.9	6.3e-166
WP_004152176.1|2943261_2943702_-	hypothetical protein	NA	A0A2H4J1A0	uncultured_Caudovirales_phage	51.7	1.6e-40
WP_001116156.1|2943796_2944183_-	hypothetical protein	NA	A0A2H4J1A4	uncultured_Caudovirales_phage	78.2	1.1e-48
WP_000834982.1|2944182_2944689_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000113538.1|2944685_2945105_-	DUF4054 domain-containing protein	NA	A0A0M5M3S2	Salmonella_phage	60.7	3.3e-40
WP_000725700.1|2945073_2945355_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001132269.1|2945394_2946336_-	DUF2184 domain-containing protein	NA	A0A2H4J191	uncultured_Caudovirales_phage	77.1	1.7e-137
WP_000528476.1|2946347_2946842_-	hypothetical protein	NA	A0A2H4JHM9	uncultured_Caudovirales_phage	62.7	4.2e-50
WP_004199270.1|2946845_2948048_-	DUF2213 domain-containing protein	NA	A0A0M4R5A6	Salmonella_phage	54.1	2.6e-106
WP_004152174.1|2948099_2948648_-	hypothetical protein	NA	A0A0M4REK0	Salmonella_phage	56.3	3.0e-49
WP_004152173.1|2948703_2950155_-	DUF1073 domain-containing protein	NA	A0A0M4S6U1	Salmonella_phage	68.8	3.8e-192
WP_004152172.1|2950392_2951793_-|terminase	PBSX family phage terminase large subunit	terminase	A0A077KAW0	Edwardsiella_phage	69.0	9.4e-188
WP_004218030.1|2951743_2952232_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004152170.1|2952597_2952918_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004153952.1|2953152_2953542_-	lipase chaperone	NA	A0A192Y6H8	Salmonella_phage	49.2	9.4e-21
WP_004152169.1|2953538_2954069_-	lysozyme	NA	K7PLY1	Enterobacteria_phage	77.1	2.7e-79
WP_004146526.1|2954071_2954320_-|holin	class II holin family protein	holin	NA	NA	NA	NA
WP_004152167.1|2954725_2955508_-	antitermination protein	NA	F1C595	Cronobacter_phage	76.8	7.2e-113
WP_004198239.1|2955504_2955981_-	hypothetical protein	NA	A0A286N2Q1	Klebsiella_phage	100.0	1.8e-90
WP_004198233.1|2955977_2956940_-	toprim domain-containing protein	NA	A0A286N2Q0	Klebsiella_phage	99.4	4.8e-183
WP_004198228.1|2956941_2958600_-	DEAD/DEAH box helicase	NA	A0A286N2P9	Klebsiella_phage	96.0	0.0e+00
WP_004152162.1|2959175_2959397_-	helix-turn-helix transcriptional regulator	NA	A0A286S2C1	Klebsiella_phage	100.0	3.0e-32
WP_004152161.1|2959494_2960163_+	LexA family transcriptional regulator	NA	A0A286S2B2	Klebsiella_phage	99.5	2.4e-125
WP_004152160.1|2960333_2960648_+	hypothetical protein	NA	A0A286S1T9	Klebsiella_phage	100.0	1.0e-49
WP_004152159.1|2960640_2960829_+	hypothetical protein	NA	A0A286S1P8	Klebsiella_phage	100.0	4.6e-26
WP_004152158.1|2960998_2961364_+	hypothetical protein	NA	A0A286S1Q6	Klebsiella_phage	99.2	6.9e-58
WP_004152157.1|2961356_2961611_+	hypothetical protein	NA	A0A286SGR4	Klebsiella_phage	97.6	3.1e-41
WP_004177208.1|2961582_2961801_+	hypothetical protein	NA	A0A286S1P6	Klebsiella_phage	98.6	6.6e-32
2961626:2961640	attL	AGGCGCTGCAGGTCC	NA	NA	NA	NA
WP_004152156.1|2961797_2962223_+	hypothetical protein	NA	A0A286S1S2	Klebsiella_phage	77.9	3.5e-53
WP_004152155.1|2962219_2962414_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004152154.1|2962410_2963238_+	hypothetical protein	NA	Q8W654	Enterobacteria_phage	84.0	5.5e-111
WP_004152153.1|2963342_2963861_+	hypothetical protein	NA	A0A286S1S7	Klebsiella_phage	98.8	1.7e-94
WP_004154298.1|2963866_2964577_+	Rha family transcriptional regulator	NA	A0A286S260	Klebsiella_phage	88.3	2.1e-111
WP_004152151.1|2964566_2964791_+	hypothetical protein	NA	A0A286S2B3	Klebsiella_phage	89.2	3.1e-29
WP_004152150.1|2964787_2965000_+	hypothetical protein	NA	A0A286S2B6	Klebsiella_phage	98.6	3.4e-33
WP_014343018.1|2965242_2965476_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004198245.1|2965548_2965695_+	hypothetical protein	NA	A0A1B5FPC2	Escherichia_phage	70.8	2.9e-15
WP_004152148.1|2965654_2965897_+	hypothetical protein	NA	A0A0M4RTZ2	Salmonella_phage	73.8	2.2e-20
WP_004152147.1|2965877_2967059_-|integrase	site-specific integrase	integrase	A0A0M4QX09	Salmonella_phage	84.2	5.6e-202
WP_016197745.1|2967255_2967804_+	DJ-1/PfpI family protein	NA	NA	NA	NA	NA
2967635:2967649	attR	GGACCTGCAGCGCCT	NA	NA	NA	NA
WP_004152145.1|2968002_2969535_-	HD domain-containing protein	NA	A0A1B1ISR1	uncultured_Mediterranean_phage	30.0	1.1e-21
WP_004152144.1|2969751_2970513_-	SDR family oxidoreductase	NA	Q06VL0	Trichoplusia_ni_ascovirus	32.5	2.4e-20
>prophage 6
NZ_CP011989	Klebsiella pneumoniae UHKPC33 chromosome, complete genome	5329725	3294884	3309937	5329725	holin	Enterobacteria_phage(33.33%)	13	NA	NA
WP_004199491.1|3294884_3295160_+	hypothetical protein	NA	A0A0M3ULK3	Salmonella_phage	60.9	1.9e-23
WP_004199521.1|3295133_3295703_-	recombinase family protein	NA	A0A286S1P7	Klebsiella_phage	86.8	3.9e-84
WP_016197598.1|3295793_3297305_+	hypothetical protein	NA	H6X4Y6	Enterobacteria_phage	33.7	9.8e-58
WP_004199475.1|3297315_3297510_+	hypothetical protein	NA	NA	NA	NA	NA
WP_020803012.1|3297708_3300144_-	hypothetical protein	NA	A0A0A8J9V7	Klebsiella_phage	35.2	5.2e-69
WP_004199504.1|3300235_3300388_-	DUF1378 family protein	NA	NA	NA	NA	NA
WP_004199533.1|3300384_3300915_-	hypothetical protein	NA	K7P6W1	Enterobacteria_phage	48.9	3.7e-36
WP_004199518.1|3300911_3301451_-	lysozyme	NA	H6WRZ4	Salmonella_phage	78.7	4.5e-82
WP_004199490.1|3301452_3301668_-|holin	class II holin family protein	holin	A5LH82	Enterobacteria_phage	61.0	1.1e-12
WP_123600138.1|3302175_3302580_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004199484.1|3302608_3305533_-	hypothetical protein	NA	W6MWW8	Pseudomonas_phage	41.3	1.8e-196
WP_016197574.1|3305532_3306915_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004199529.1|3307222_3309937_-	lytic transglycosylase domain-containing protein	NA	K4NWI2	Pseudomonas_phage	26.8	2.2e-31
>prophage 7
NZ_CP011989	Klebsiella pneumoniae UHKPC33 chromosome, complete genome	5329725	3314496	3340262	5329725	tail,protease,head,integrase	Pectobacterium_phage(28.0%)	37	3324196:3324210	3340747:3340761
WP_004191050.1|3314496_3314970_-	hypothetical protein	NA	K4NYY6	Pseudomonas_phage	46.3	1.8e-26
WP_004199478.1|3315008_3316004_-	bbp17	NA	W6MW28	Pseudomonas_phage	60.2	2.1e-104
WP_004199538.1|3316014_3316752_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004199528.1|3316738_3317062_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004141558.1|3317064_3318729_-|head,tail	head-tail connector protein	head,tail	A0A221SAN2	Ralstonia_phage	39.4	3.1e-105
WP_004199513.1|3318728_3320123_-	hypothetical protein	NA	A0A0E3JIA1	Rhodoferax_phage	36.4	2.4e-58
WP_004199526.1|3320207_3320660_-	DNA-packaging protein	NA	A3EYX3	Salmonella_phage	66.4	1.1e-49
WP_004199477.1|3320666_3320927_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004199520.1|3320910_3321144_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004199492.1|3321205_3321730_-	DUF2829 domain-containing protein	NA	A0A1B0VMG3	Pseudomonas_phage	54.1	2.5e-45
WP_004199525.1|3321770_3322211_-	phage family protein	NA	R9TRJ4	Aeromonas_phage	43.8	4.3e-14
WP_004199527.1|3322216_3322564_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_071570746.1|3322551_3322875_-	DUF968 domain-containing protein	NA	A0A1I9KFA7	Aeromonas_phage	55.8	6.8e-25
WP_004199500.1|3322864_3323458_-	DUF1367 family protein	NA	H9C173	Pectobacterium_phage	72.1	7.2e-81
WP_025712904.1|3323526_3323718_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004199485.1|3323898_3324237_-	hypothetical protein	NA	A0A193GYX4	Enterobacter_phage	81.1	1.5e-46
3324196:3324210	attL	CGCGCGCTGCGCGGC	NA	NA	NA	NA
WP_004199511.1|3324229_3324433_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004199524.1|3324432_3324648_-	hypothetical protein	NA	K7PKY3	Enterobacterial_phage	65.7	1.8e-21
WP_004199508.1|3324640_3325585_-	DUF551 domain-containing protein	NA	R9TQX3	Aeromonas_phage	68.0	2.1e-37
WP_004199474.1|3325581_3325971_-	hypothetical protein	NA	R9TME7	Aeromonas_phage	36.8	8.8e-11
WP_004199493.1|3326098_3326884_-	hypothetical protein	NA	C7BGF1	Burkholderia_phage	52.9	4.8e-64
WP_004191074.1|3326923_3327157_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016197575.1|3327160_3327811_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004199519.1|3327849_3329238_-	AAA family ATPase	NA	Q8HA30	Enterobacteria_phage	47.3	1.5e-105
WP_004199531.1|3329234_3330218_-	helix-turn-helix domain-containing protein	NA	H9C164	Pectobacterium_phage	73.8	1.3e-39
WP_016197573.1|3330220_3330379_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004199487.1|3330462_3330909_-	hypothetical protein	NA	H9C162	Pectobacterium_phage	56.1	7.4e-30
WP_029499131.1|3330969_3331203_-	helix-turn-helix transcriptional regulator	NA	A0A0U2S629	Escherichia_phage	44.4	5.8e-10
WP_004199482.1|3331309_3331765_+	helix-turn-helix domain-containing protein	NA	A0A0U2QW76	Escherichia_phage	50.0	6.2e-32
WP_020313637.1|3332775_3333009_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004199499.1|3333053_3335186_+	hypothetical protein	NA	H9C157	Pectobacterium_phage	34.6	1.7e-95
WP_004199473.1|3335185_3335752_+	siphovirus Gp157 family protein	NA	H9C156	Pectobacterium_phage	61.5	2.5e-51
WP_004141609.1|3335753_3335939_+	hypothetical protein	NA	H9C155	Pectobacterium_phage	44.3	8.1e-07
WP_004199480.1|3336148_3336373_+	DUF4224 domain-containing protein	NA	H9C153	Pectobacterium_phage	68.1	4.5e-20
WP_016197576.1|3336376_3337405_+|integrase	tyrosine-type recombinase/integrase	integrase	A0A192Y7M7	Salmonella_phage	54.1	4.4e-94
WP_004150834.1|3337680_3339333_-	ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_002898458.1|3339602_3340262_+|protease	FtsH protease modulator YccA	protease	A0A2H4JFM9	uncultured_Caudovirales_phage	46.6	3.2e-37
3340747:3340761	attR	CGCGCGCTGCGCGGC	NA	NA	NA	NA
>prophage 8
NZ_CP011989	Klebsiella pneumoniae UHKPC33 chromosome, complete genome	5329725	3425054	3519207	5329725	tail,transposase,tRNA,head,lysis,plate,protease,terminase,portal,integrase,capsid	Salmonella_phage(57.63%)	94	3480582:3480600	3519282:3519300
WP_002898139.1|3425054_3426347_-|tRNA	serine--tRNA ligase	tRNA	A0A1B1IVT2	uncultured_Mediterranean_phage	44.7	7.3e-94
WP_002898137.1|3426437_3427781_-	replication-associated recombination protein RarA	NA	G3MBE0	Bacillus_virus	40.8	7.3e-81
WP_002898132.1|3427789_3428401_-	outer membrane lipoprotein chaperone LolA	NA	NA	NA	NA	NA
WP_004150846.1|3428523_3432777_-	DNA translocase FtsK	NA	S5VNE3	Mycobacterium_phage	49.2	5.2e-88
WP_000228469.1|3432912_3433407_-	leucine-responsive transcriptional regulator Lrp	NA	NA	NA	NA	NA
WP_002898019.1|3433939_3434908_+	thioredoxin-disulfide reductase	NA	A0A2I2L5E1	Orpheovirus	44.0	3.2e-62
WP_002898017.1|3435022_3436789_+	cysteine/glutathione ABC transporter permease/ATP-binding protein CydD	NA	W8CYL7	Bacillus_phage	25.9	2.3e-21
WP_004150847.1|3436789_3438511_+	cysteine/glutathione ABC transporter ATP-binding protein/permease CydC	NA	A0A2R8FG22	Brazilian_cedratvirus	34.3	1.5e-14
WP_002898014.1|3438555_3439257_+|tRNA	leucyl/phenylalanyl-tRNA--protein transferase	tRNA	NA	NA	NA	NA
WP_001040187.1|3439610_3439829_+	translation initiation factor IF-1	NA	NA	NA	NA	NA
WP_002896522.1|3439949_3442229_-|protease	ATP-dependent Clp protease ATP-binding subunit ClpA	protease	A0A223W0B1	Agrobacterium_phage	42.0	1.6e-165
WP_002896520.1|3442259_3442577_-|protease	ATP-dependent Clp protease adapter ClpS	protease	A0A1B1IT64	uncultured_Mediterranean_phage	45.7	2.0e-13
WP_002896516.1|3442902_3443124_+	cold shock-like protein CspD	NA	A0A2H4N7Y6	Lake_Baikal_phage	61.2	1.3e-16
WP_004150848.1|3443200_3445141_-	macrolide ABC transporter ATP-binding protein/permease MacB	NA	G9BWD6	Planktothrix_phage	40.5	1.9e-37
WP_002896440.1|3445137_3446253_-	macrolide transporter subunit MacA	NA	A0A140XAI1	Dickeya_phage	52.7	1.3e-06
WP_002896437.1|3446399_3448058_-	ATP-dependent endonuclease	NA	NA	NA	NA	NA
WP_002896434.1|3448477_3449173_+	aquaporin Z	NA	NA	NA	NA	NA
WP_004147773.1|3449288_3450188_+	lysine exporter LysO family protein	NA	NA	NA	NA	NA
WP_002896412.1|3450331_3451984_+	hydroxylamine reductase	NA	NA	NA	NA	NA
WP_002896410.1|3451994_3452963_+	NADH oxidoreductase	NA	NA	NA	NA	NA
WP_002896408.1|3453174_3453609_-	DoxX family protein	NA	NA	NA	NA	NA
WP_002896406.1|3453760_3455479_+	ubiquinone-dependent pyruvate dehydrogenase	NA	NA	NA	NA	NA
WP_002896404.1|3455517_3456519_+	low-specificity L-threonine aldolase	NA	NA	NA	NA	NA
WP_002896401.1|3456529_3457972_+	SDR family oxidoreductase	NA	NA	NA	NA	NA
WP_002896399.1|3458059_3459073_+	NAD(P)-dependent oxidoreductase	NA	NA	NA	NA	NA
WP_002896397.1|3459069_3459900_-	N-acetylmuramoyl-L-alanine amidase	NA	A0A1B0UZW5	Roseobacter_phage	31.6	4.1e-05
WP_004150851.1|3459931_3461071_-	GGDEF domain-containing protein	NA	NA	NA	NA	NA
WP_002896394.1|3461948_3462464_+	lipoprotein	NA	NA	NA	NA	NA
WP_002896392.1|3462690_3463419_+	arginine ABC transporter ATP-binding protein ArtP	NA	G9BWD6	Planktothrix_phage	37.1	1.2e-29
WP_002896390.1|3463439_3464171_+	arginine ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_002896386.1|3464177_3464894_+	arginine ABC transporter permease ArtQ	NA	NA	NA	NA	NA
WP_004150852.1|3464893_3465562_+	arginine ABC transporter permease ArtM	NA	NA	NA	NA	NA
WP_002896384.1|3465745_3466477_+	ABC transporter substrate-binding protein ArtJ	NA	NA	NA	NA	NA
WP_002896382.1|3466519_3467992_-	two-component sensor histidine kinase	NA	W8CYF6	Bacillus_phage	31.8	7.9e-28
WP_002896380.1|3467988_3468705_-	response regulator transcription factor	NA	W8CYM9	Bacillus_phage	36.9	2.1e-34
WP_002896378.1|3468783_3469911_-	23S rRNA (uracil(747)-C(5))-methyltransferase RlmC	NA	A0A2K5B251	Erysipelothrix_phage	25.6	1.3e-19
WP_002896372.1|3470500_3471346_-	putrescine ABC transporter permease PotI	NA	NA	NA	NA	NA
WP_002896371.1|3471342_3472296_-	putrescine ABC transporter permease PotH	NA	NA	NA	NA	NA
WP_002896370.1|3472306_3473440_-	putrescine ABC transporter ATP-binding subunit PotG	NA	G3M9Y6	Bacillus_virus	34.9	2.2e-30
WP_002896368.1|3473603_3474716_-	spermidine/putrescine ABC transporter substrate-binding protein PotF	NA	NA	NA	NA	NA
WP_002896365.1|3475064_3475544_-	YbjN domain-containing protein	NA	NA	NA	NA	NA
WP_002896363.1|3475632_3476535_-	30S ribosomal protein S6--L-glutamate ligase	NA	A0A1D7SR78	Cyanophage	35.3	2.0e-34
WP_002896354.1|3477356_3477644_-	YbjC family protein	NA	NA	NA	NA	NA
WP_002896352.1|3477846_3478110_+	GrxA family glutaredoxin	NA	A0A2I7SAE2	Vibrio_phage	73.1	1.6e-27
WP_002896351.1|3478116_3478500_-	inner membrane protein YbjM	NA	NA	NA	NA	NA
WP_004179131.1|3478766_3480452_+	aspartate:alanine antiporter	NA	NA	NA	NA	NA
3480582:3480600	attL	ATGGGTTTTTTGTTGCCTG	NA	NA	NA	NA
WP_000972391.1|3480671_3480890_-	ogr/Delta-like zinc finger family protein	NA	Q53ZE7	Salmonella_virus	69.0	7.5e-20
WP_002896225.1|3480981_3482082_-	phage late control D family protein	NA	A0A1S6KZZ5	Salmonella_phage	87.4	4.9e-176
WP_002896224.1|3482078_3482564_-|tail	phage tail protein	tail	E5G6Q2	Salmonella_phage	75.6	7.2e-63
WP_002896222.1|3482560_3485188_-|tail	phage tail tape measure protein	tail	E5FFG5	Burkholderia_phage	42.0	5.6e-117
WP_002896220.1|3485180_3485300_-|tail	GpE family phage tail protein	tail	E5G6Q0	Salmonella_phage	87.2	2.2e-13
WP_002896204.1|3485314_3485614_-|tail	phage tail assembly protein	tail	E5G6P9	Salmonella_phage	79.0	3.7e-33
WP_002896201.1|3485666_3486182_-|tail	phage major tail tube protein	tail	E5G6P8	Salmonella_phage	85.4	1.3e-81
WP_002896193.1|3486191_3487364_-|tail	phage tail sheath protein	tail	A0A1S6KZY7	Salmonella_phage	93.3	1.9e-210
WP_002896191.1|3487502_3488579_-|tail	phage tail protein	tail	Q37842	Escherichia_phage	44.8	1.2e-25
WP_002896188.1|3488608_3488812_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002896186.1|3488808_3489540_-	hypothetical protein	NA	NA	NA	NA	NA
WP_019724930.1|3489543_3490278_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004150856.1|3492496_3493096_-|tail	phage tail protein I	tail	A0A1S6L000	Salmonella_phage	60.5	1.3e-58
WP_002896182.1|3493088_3493997_-|plate	baseplate assembly protein	plate	E5G6N8	Salmonella_phage	66.9	7.6e-106
WP_002896179.1|3493983_3494346_-	GPW/gp25 family protein	NA	A0A1S6KZZ4	Salmonella_phage	84.7	5.8e-49
WP_002896177.1|3494342_3494915_-|plate	phage baseplate assembly protein V	plate	E5G6N6	Salmonella_phage	72.3	4.7e-77
WP_004150857.1|3495009_3495702_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002896175.1|3495698_3496145_-	phage virion morphogenesis protein	NA	A0A1S6L001	Salmonella_phage	71.2	2.2e-50
WP_002896172.1|3496137_3496569_-|tail	phage tail protein	tail	A0A1S6KZY0	Salmonella_phage	82.5	9.9e-64
WP_002896170.1|3496531_3496678_-	hypothetical protein	NA	A0A1S6KZX6	Salmonella_phage	76.1	6.0e-13
WP_002896168.1|3496664_3497093_-|lysis	LysB family phage lysis regulatory protein	lysis	A0A1S6KZX8	Salmonella_phage	77.9	9.6e-51
WP_002896163.1|3497089_3497473_-	hypothetical protein	NA	A0A1S6KZZ2	Salmonella_phage	42.0	2.1e-17
WP_002896161.1|3497477_3497987_-	lysozyme	NA	E5G6N1	Salmonella_phage	83.4	2.1e-81
WP_002896158.1|3497967_3498183_-	hypothetical protein	NA	E5G6N0	Salmonella_phage	90.1	3.6e-30
WP_002896155.1|3498186_3498390_-|tail	tail protein X	tail	A0A1S6KZY4	Salmonella_phage	88.1	1.3e-29
WP_002896151.1|3498389_3498854_-|head	head completion/stabilization protein	head	A0A1S6KZW8	Salmonella_phage	89.0	8.4e-77
WP_000059191.1|3498949_3499600_-|terminase	terminase endonuclease subunit	terminase	E5G6M7	Salmonella_phage	96.3	8.7e-112
WP_002895972.1|3499603_3500662_-|capsid	phage major capsid protein, P2 family	capsid	E5G6M6	Salmonella_phage	93.1	1.1e-180
WP_002895967.1|3500678_3501512_-|capsid	GPO family capsid scaffolding protein	capsid	A0A1S6KZW9	Salmonella_phage	88.8	6.3e-123
WP_004150858.1|3501654_3503421_+|terminase	terminase ATPase subunit family protein	terminase	A0A1S6KZW3	Salmonella_phage	99.0	0.0e+00
WP_002895959.1|3503420_3504446_+|portal	phage portal protein	portal	A0A1S6KZW5	Salmonella_phage	86.7	7.6e-171
WP_000019473.1|3504654_3505635_-|transposase	IS5-like element ISKpn26 family transposase	transposase	Q38213	Escherichia_phage	99.1	8.9e-185
WP_004199124.1|3505707_3507450_-	AIPR family protein	NA	NA	NA	NA	NA
WP_000700647.1|3507725_3508403_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001217575.1|3508517_3508751_-	DinI family protein	NA	E5G6M1	Salmonella_phage	100.0	4.7e-36
WP_001154434.1|3508761_3508950_-	hypothetical protein	NA	E5G6M0	Salmonella_phage	98.4	5.5e-27
WP_004150862.1|3509103_3511518_-	replication endonuclease	NA	E5G6L9	Salmonella_phage	97.5	0.0e+00
WP_004150863.1|3511514_3512372_-	DNA adenine methylase	NA	E5G6L8	Salmonella_phage	95.4	2.0e-156
WP_000752622.1|3512368_3512596_-	TraR/DksA family transcriptional regulator	NA	E5G6L7	Salmonella_phage	98.7	6.0e-36
WP_004150864.1|3512595_3512829_-	DUF2732 family protein	NA	E5G6L6	Salmonella_phage	96.1	4.1e-32
WP_000963473.1|3512896_3513238_-	DUF5347 domain-containing protein	NA	E5G6L5	Salmonella_phage	99.1	4.6e-56
WP_000956179.1|3513201_3513402_-	DUF2724 domain-containing protein	NA	E5G6L4	Salmonella_phage	97.0	1.6e-32
WP_000460893.1|3513409_3513919_-	phage regulatory CII family protein	NA	E5G6L3	Salmonella_phage	98.8	5.8e-87
WP_000188448.1|3513951_3514173_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004152885.1|3514318_3515197_+	phage repressor protein CI	NA	A0A1S6KZZ7	Salmonella_phage	39.9	1.7e-30
WP_004150866.1|3515208_3516153_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004178082.1|3516251_3517739_-	group II intron reverse transcriptase/maturase	NA	A0A0U4J920	Pseudomonas_phage	35.5	1.2e-31
WP_014342959.1|3518226_3519207_+|integrase	tyrosine-type recombinase/integrase	integrase	A0A218M4I3	Erwinia_phage	57.2	1.4e-97
3519282:3519300	attR	ATGGGTTTTTTGTTGCCTG	NA	NA	NA	NA
>prophage 9
NZ_CP011989	Klebsiella pneumoniae UHKPC33 chromosome, complete genome	5329725	3964314	4009589	5329725	holin,tRNA,head,lysis	Cronobacter_phage(25.0%)	65	NA	NA
WP_004151249.1|3964314_3966792_-	MoaD/ThiS family protein	NA	F1C5A7	Cronobacter_phage	45.6	2.7e-198
WP_004151250.1|3966778_3967174_-	C40 family peptidase	NA	F1C5F2	Cronobacter_phage	54.0	8.0e-36
WP_004199076.1|3967170_3967641_-	hypothetical protein	NA	R9TPR6	Aeromonas_phage	41.0	2.5e-28
WP_004151252.1|3967640_3968117_-	hypothetical protein	NA	A0A2P1MXB5	Escherichia_phage	49.7	3.0e-37
WP_004151253.1|3968159_3971606_-	tape measure protein	NA	Q5G8W8	Enterobacteria_phage	48.6	1.4e-163
WP_004151254.1|3971698_3972202_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004151255.1|3972329_3973115_-	phage repressor protein	NA	A0A2L1IV39	Escherichia_phage	59.7	1.9e-84
WP_004151256.1|3973180_3973894_-	hypothetical protein	NA	H6WRU8	Salmonella_phage	50.2	3.9e-49
WP_004151257.1|3973883_3974054_-	Arc family DNA-binding protein	NA	I6R9A8	Salmonella_phage	87.0	6.1e-17
WP_004151258.1|3974153_3974513_+	Arc family DNA-binding protein	NA	A0A0P0ZBD1	Stx2-converting_phage	47.5	3.8e-16
WP_004151259.1|3974529_3975000_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004151260.1|3975293_3975548_-	hypothetical protein	NA	K7PM89	Enterobacteria_phage	73.0	6.7e-20
WP_004151261.1|3975550_3976306_-	KilA-N domain-containing protein	NA	K7PGT4	Enterobacteria_phage	51.0	2.4e-60
WP_004151262.1|3976481_3977159_-	hypothetical protein	NA	F1C5E8	Cronobacter_phage	57.9	4.8e-73
WP_004151263.1|3977211_3977964_-	Ig domain-containing protein	NA	G0ZNE6	Cronobacter_phage	42.1	5.8e-43
WP_004151264.1|3978032_3978425_-	hypothetical protein	NA	G0ZNE4	Cronobacter_phage	52.7	5.1e-35
WP_004151265.1|3978421_3978847_-	hypothetical protein	NA	R9TPP7	Aeromonas_phage	47.9	5.1e-28
WP_004151266.1|3978849_3979212_-	hypothetical protein	NA	A0A173GCE0	Salmonella_phage	45.0	1.8e-18
WP_004151267.1|3979211_3979385_-	hypothetical protein	NA	I6R0P9	Salmonella_phage	56.1	1.4e-13
WP_004151268.1|3979384_3979765_-	hypothetical protein	NA	F1C5E2	Cronobacter_phage	55.3	5.3e-29
WP_004151269.1|3979767_3980007_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004151270.1|3980017_3981112_-	hypothetical protein	NA	F1C5E1	Cronobacter_phage	62.8	1.7e-123
WP_004151271.1|3981123_3981552_-	hypothetical protein	NA	F1C5E0	Cronobacter_phage	60.8	1.6e-42
WP_004151272.1|3981555_3982941_-	DUF2213 domain-containing protein	NA	F1C5D9	Cronobacter_phage	60.0	2.3e-154
WP_004151273.1|3983013_3983490_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004151274.1|3983531_3984536_-|head	phage head morphogenesis protein	head	F1C5D8	Cronobacter_phage	69.7	9.0e-116
WP_004151275.1|3984510_3985932_-	DUF1073 domain-containing protein	NA	F1C5D7	Cronobacter_phage	57.1	9.6e-148
WP_004151276.1|3985944_3987417_-	hypothetical protein	NA	A0A1W6JNY3	Morganella_phage	82.5	1.3e-248
WP_004151277.1|3987416_3988019_-	hypothetical protein	NA	G8C7P2	Escherichia_phage	80.9	5.4e-76
WP_004151279.1|3988389_3988719_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004151280.1|3988824_3989289_-|lysis	lysis protein	lysis	Q76H63	Enterobacteria_phage	73.2	2.4e-55
WP_004151281.1|3989285_3989816_-	lysozyme	NA	G9L6J6	Escherichia_phage	78.5	6.0e-79
WP_004151282.1|3989818_3990067_-|holin	class II holin family protein	holin	NA	NA	NA	NA
WP_004151283.1|3990976_3991666_-	antitermination protein	NA	I6PDF8	Cronobacter_phage	54.5	1.4e-56
WP_004151284.1|3991662_3992193_-	HNH endonuclease	NA	A0A193GYW9	Enterobacter_phage	43.1	5.2e-30
WP_004151285.1|3992185_3992323_-	YlcG family protein	NA	NA	NA	NA	NA
WP_004151286.1|3992319_3992955_-	recombination protein NinG	NA	M9NYX8	Enterobacteria_phage	77.9	2.7e-81
WP_004151287.1|3992947_3993118_-	NinE family protein	NA	G8C7V4	Escherichia_phage	73.2	1.3e-14
WP_004151288.1|3993117_3993573_-	YbcN family protein	NA	K7P7B8	Enterobacteria_phage	69.5	8.0e-56
WP_004151291.1|3994073_3994721_-	DUF551 domain-containing protein	NA	A5LH60	Enterobacteria_phage	32.6	4.5e-12
WP_004151292.1|3994717_3994894_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004151293.1|3994893_3995736_-	ead/Ea22-like family protein	NA	A0A2H4FRZ0	Salmonella_phage	60.8	1.8e-29
WP_004151294.1|3995842_3996349_-	hypothetical protein	NA	A0A0A6Z565	Enterobacter_phage	59.6	3.0e-27
WP_004151295.1|3996345_3996639_-	protein ren	NA	O48423	Enterobacteria_phage	65.6	3.3e-26
WP_004230547.1|3996638_3998054_-	AAA family ATPase	NA	Q9MCT4	Escherichia_phage	67.1	1.8e-183
WP_004230546.1|3998058_3998910_-	hypothetical protein	NA	F1C5C3	Cronobacter_phage	56.3	5.3e-85
WP_004151298.1|3998950_3999097_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001548453.1|3999182_3999404_-	hypothetical protein	NA	G8EYH8	Enterobacteria_phage	41.7	6.9e-05
WP_004151299.1|3999444_3999678_-	helix-turn-helix domain-containing protein	NA	G8C7U2	Escherichia_phage	50.7	4.3e-13
WP_004151300.1|3999805_4000495_+	helix-turn-helix transcriptional regulator	NA	G8C7U1	Escherichia_phage	52.2	4.3e-61
WP_004151301.1|4000845_4001061_+	hypothetical protein	NA	B5WZV1	Pseudomonas_phage	48.6	1.6e-09
WP_004151302.1|4001057_4001168_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004151303.1|4001160_4001355_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004151304.1|4001443_4001728_+	host nuclease inhibitor GamL	NA	G8C7T1	Escherichia_phage	62.8	8.0e-30
WP_004151305.1|4001743_4002589_+	phage recombination protein Bet	NA	A0A1I9KF88	Aeromonas_phage	59.2	6.9e-69
WP_004151306.1|4002585_4003266_+	YqaJ viral recombinase family protein	NA	A0A0M3ULE0	Salmonella_phage	93.4	7.9e-124
WP_004151308.1|4003262_4003421_+	DUF1317 family protein	NA	A0A0N7CHV0	Escherichia_phage	60.8	3.0e-10
WP_004151310.1|4003417_4004074_+	DNA methyltransferase	NA	G8C7S6	Escherichia_phage	87.5	2.7e-113
WP_004151312.1|4004070_4004838_+	hypothetical protein	NA	D5LH17	Escherichia_phage	53.4	1.7e-66
WP_004151314.1|4004834_4005053_+	hypothetical protein	NA	A0A1I9LJM7	Stx_converting_phage	47.2	1.2e-09
WP_004151316.1|4005054_4005270_+	TraR/DksA family transcriptional regulator	NA	A0A0K2FI84	Escherichia_phage	52.9	4.0e-13
WP_004151317.1|4005271_4005607_+	excisionase family DNA-binding protein	NA	NA	NA	NA	NA
WP_004143017.1|4007077_4007944_+	bifunctional methylenetetrahydrofolate dehydrogenase/methenyltetrahydrofolate cyclohydrolase FolD	NA	A0A249XZQ2	Enterococcus_phage	34.8	1.3e-30
WP_004143016.1|4007945_4008158_+	ribosome-associated protein YbcJ	NA	NA	NA	NA	NA
WP_004143010.1|4008203_4009589_-|tRNA	cysteine--tRNA ligase	tRNA	M1PG92	Moumouvirus	35.4	3.5e-46
>prophage 10
NZ_CP011989	Klebsiella pneumoniae UHKPC33 chromosome, complete genome	5329725	4219142	4230796	5329725	integrase	Enterobacteria_phage(70.0%)	13	4219592:4219606	4242649:4242663
WP_004144574.1|4219142_4220246_+	glutamate 5-kinase	NA	A0A1X9I5D0	Streptococcus_phage	40.5	4.8e-62
4219592:4219606	attL	CAATCTCTCCGCGCT	NA	NA	NA	NA
WP_002889940.1|4220256_4221510_+	glutamate-5-semialdehyde dehydrogenase	NA	A0A1X9I5D4	Streptococcus_phage	44.9	8.9e-89
WP_002889938.1|4221862_4223053_+|integrase	tyrosine-type recombinase/integrase	integrase	Q7M297	Enterobacteria_phage	62.7	6.4e-145
WP_004152029.1|4223040_4223991_+	AAA family ATPase	NA	A0A1X9IGI7	Lactococcus_phage	27.1	1.2e-13
WP_004152979.1|4223990_4224416_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002889930.1|4224984_4225551_-	phage polarity suppression protein	NA	Q7M2A1	Enterobacteria_phage	64.3	1.5e-59
WP_002889919.1|4225568_4225814_-	ogr/Delta-like zinc finger family protein	NA	Q7M294	Enterobacteria_phage	58.0	1.9e-19
WP_002889917.1|4225810_4226548_-	hypothetical protein	NA	Q7M2A2	Enterobacteria_phage	60.7	9.0e-73
WP_002889915.1|4227089_4227356_+	AlpA family transcriptional regulator	NA	Q7M299	Enterobacteria_phage	71.6	2.6e-30
WP_024940872.1|4227352_4227910_+	ash family protein	NA	Q7M2A7	Enterobacteria_phage	70.4	1.8e-33
WP_002889911.1|4227906_4228134_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002889897.1|4228130_4228451_+	DUF5375 domain-containing protein	NA	NA	NA	NA	NA
WP_002889890.1|4228462_4230796_+	toprim domain-containing protein	NA	Q7M2A8	Enterobacteria_phage	82.2	0.0e+00
4242649:4242663	attR	CAATCTCTCCGCGCT	NA	NA	NA	NA
>prophage 11
NZ_CP011989	Klebsiella pneumoniae UHKPC33 chromosome, complete genome	5329725	4699037	4704862	5329725		Enterobacteria_phage(100.0%)	8	NA	NA
WP_004152207.1|4699037_4701371_-	toprim domain-containing protein	NA	Q7M2A8	Enterobacteria_phage	83.9	0.0e+00
WP_004152206.1|4701385_4701706_-	DUF5375 domain-containing protein	NA	NA	NA	NA	NA
WP_004152205.1|4701702_4701930_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004153681.1|4701926_4702475_-	host cell division inhibitor Icd-like protein	NA	Q7M2A7	Enterobacteria_phage	69.4	1.1e-30
WP_000556592.1|4702471_4702738_-	AlpA family transcriptional regulator	NA	Q7M299	Enterobacteria_phage	71.6	2.0e-30
WP_004152204.1|4703298_4704036_+	hypothetical protein	NA	Q7M2A2	Enterobacteria_phage	59.4	1.1e-70
WP_004152203.1|4704032_4704278_+	ogr/Delta-like zinc finger family protein	NA	Q7M294	Enterobacteria_phage	56.8	5.5e-19
WP_004152202.1|4704295_4704862_+	phage polarity suppression protein	NA	Q7M2A1	Enterobacteria_phage	63.8	9.7e-59
>prophage 1
NZ_CP011991	Klebsiella pneumoniae UHKPC33 plasmid pUHKPC33-113.638kb, complete sequence	113638	0	14720	113638		Enterobacteria_phage(22.22%)	18	NA	NA
WP_004227314.1|963_1179_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004152347.1|1403_1736_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004152348.1|2112_3087_-	ParB/RepB/Spo0J family partition protein	NA	Q1MVJ4	Enterobacteria_phage	62.3	1.4e-105
WP_004152349.1|3083_4289_-	AAA family ATPase	NA	Q1MVJ3	Enterobacteria_phage	89.0	7.3e-205
WP_004152350.1|4610_5507_-	replication initiation protein	NA	Q71TL8	Escherichia_phage	53.8	3.3e-69
WP_004152351.1|5907_7179_-	Y-family DNA polymerase	NA	F1C5A5	Cronobacter_phage	63.7	3.6e-154
WP_004152352.1|7178_7610_-	translesion error-prone DNA polymerase V autoproteolytic subunit	NA	A0A1W6JNS2	Morganella_phage	52.5	1.0e-28
WP_004152353.1|7841_8813_+	mediator of plasmid stability	NA	A0A222YXF2	Escherichia_phage	46.8	1.1e-73
WP_004152354.1|8815_9487_+	plasmid partitioning/stability family protein	NA	NA	NA	NA	NA
WP_001568040.1|9547_9778_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004152355.1|10214_10916_+	DNA methylase	NA	A0A2I7RE86	Vibrio_phage	36.7	7.1e-27
WP_001568042.1|10915_11137_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001568043.1|11146_11566_+	DUF1380 domain-containing protein	NA	NA	NA	NA	NA
WP_001568044.1|11619_12387_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004152356.1|13066_13495_+	antirestriction protein	NA	NA	NA	NA	NA
WP_001568046.1|13537_14044_+	antirestriction protein ArdA	NA	G9FHQ1	Rhodococcus_virus	31.4	4.1e-08
WP_001568047.1|14086_14278_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004152357.1|14465_14720_+	DNA polymerase III subunit theta	NA	H9C187	Pectobacterium_phage	50.0	4.0e-12
>prophage 2
NZ_CP011991	Klebsiella pneumoniae UHKPC33 plasmid pUHKPC33-113.638kb, complete sequence	113638	17859	28947	113638		Vibrio_phage(14.29%)	15	NA	NA
WP_004152756.1|17859_18423_+	methyltransferase	NA	M4M9L8	Vibrio_phage	42.0	1.7e-18
WP_004152654.1|19253_19766_+	single-stranded DNA-binding protein	NA	A0A0A0P1Q9	Enterobacteria_phage	84.7	8.5e-54
WP_004152655.1|19813_20056_+	DUF905 domain-containing protein	NA	NA	NA	NA	NA
WP_004152656.1|20124_22134_+	ParB/RepB/Spo0J family partition protein	NA	G8DH78	Emiliania_huxleyi_virus	27.4	1.5e-24
WP_004152657.1|22179_22611_+	conjugation system SOS inhibitor PsiB	NA	NA	NA	NA	NA
WP_004152658.1|22607_23330_+	plasmid SOS inhibition protein A	NA	NA	NA	NA	NA
WP_004199367.1|23333_23657_+	hypothetical protein	NA	I3UM57	Rhodobacter_phage	34.2	2.3e-09
WP_004152660.1|23767_24127_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004152661.1|24174_24447_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004153414.1|24443_24794_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004152748.1|25423_25777_+	hypothetical protein	NA	A0A248SL90	Klebsiella_phage	64.2	5.0e-29
WP_004152749.1|25833_26181_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004152750.1|26275_26422_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004152751.1|26472_27306_+	N-6 DNA methylase	NA	A0A2K9V411	Faecalibacterium_phage	33.5	1.8e-21
WP_004152492.1|28125_28947_+	DUF945 domain-containing protein	NA	K4F5L3	Cronobacter_phage	40.1	1.2e-44
>prophage 3
NZ_CP011991	Klebsiella pneumoniae UHKPC33 plasmid pUHKPC33-113.638kb, complete sequence	113638	63679	68193	113638		Xanthomonas_phage(33.33%)	7	NA	NA
WP_004152379.1|63679_64405_+	type-F conjugative transfer system pilin acetylase TraX	NA	A0A1D6ZIU7	Xanthomonas_phage	28.8	7.1e-06
WP_004152380.1|64476_65070_+	fertility inhibition protein FinO	NA	NA	NA	NA	NA
WP_015060010.1|65230_65833_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004153014.1|65882_66527_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004152382.1|66582_67233_+	DUF2726 domain-containing protein	NA	NA	NA	NA	NA
WP_004152383.1|67229_67538_+	hypothetical protein	NA	K7PKY8	Enterobacterial_phage	31.7	1.1e-08
WP_014343478.1|67713_68193_+	phospholipase D family protein	NA	A0A1B2LRT6	Wolbachia_phage	31.7	2.7e-17
>prophage 4
NZ_CP011991	Klebsiella pneumoniae UHKPC33 plasmid pUHKPC33-113.638kb, complete sequence	113638	75828	93981	113638	transposase	Escherichia_phage(33.33%)	12	NA	NA
WP_004152392.1|75828_78858_+|transposase	Tn3-like element Tn4401 family transposase	transposase	NA	NA	NA	NA
WP_004199214.1|78964_79990_+|transposase	IS21 family transposase	transposase	A0A2L1IVA1	Escherichia_phage	50.3	1.4e-87
WP_004152394.1|79986_80766_+	IS21-like element ISKpn7 family helper ATPase IstB	NA	A0A2L1IVB6	Escherichia_phage	61.8	2.5e-89
WP_004199234.1|81053_81935_+	carbapenem-hydrolyzing class A beta-lactamase KPC-2	NA	A0A1B0VBP7	Salmonella_phage	52.2	2.2e-73
WP_004152397.1|82184_83504_-|transposase	IS1182-like element ISKpn6 family transposase	transposase	Q9MBP7	Staphylococcus_prophage	24.2	1.9e-12
WP_004152398.1|83780_84965_-|transposase	ISAs1-like element ISKpn31 family transposase	transposase	NA	NA	NA	NA
WP_004152400.1|85468_85828_+	DUF305 domain-containing protein	NA	A0A218MND9	uncultured_virus	62.0	3.6e-19
WP_004152401.1|86484_86895_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004152402.1|86993_87614_-	recombinase family protein	NA	A0A219Y912	Aeromonas_phage	31.5	2.0e-09
WP_004152403.1|87702_90600_-|transposase	Tn3-like element Tn5403 family transposase	transposase	A0A1B0V7H9	Salmonella_phage	37.7	2.7e-181
WP_001067855.1|90672_91377_+|transposase	IS6-like element IS26 family transposase	transposase	A0A077SL39	Escherichia_phage	100.0	1.8e-139
WP_000027057.1|93120_93981_+	class A broad-spectrum beta-lactamase TEM-1	NA	Q1MVP3	Enterobacteria_phage	100.0	4.6e-161
>prophage 5
NZ_CP011991	Klebsiella pneumoniae UHKPC33 plasmid pUHKPC33-113.638kb, complete sequence	113638	97208	98903	113638		Erysipelothrix_phage(100.0%)	1	NA	NA
WP_000105636.1|97208_98903_-	mercury(II) reductase	NA	A0A2K5B2C5	Erysipelothrix_phage	27.6	8.8e-39
>prophage 6
NZ_CP011991	Klebsiella pneumoniae UHKPC33 plasmid pUHKPC33-113.638kb, complete sequence	113638	104029	107887	113638	integrase,transposase	Macacine_betaherpesvirus(50.0%)	3	100982:100995	106029:106042
100982:100995	attL	TTTTATTCCTTTAT	NA	NA	NA	NA
WP_004152340.1|104029_104812_+|integrase	phage integrase family protein	integrase	I3WFA4	Macacine_betaherpesvirus	90.2	4.6e-51
WP_004152341.1|106025_106499_-	YkgJ family cysteine cluster protein	NA	NA	NA	NA	NA
106029:106042	attR	TTTTATTCCTTTAT	NA	NA	NA	NA
WP_004152342.1|106618_107887_-|transposase	ISL3-like element ISKpn25 family transposase	transposase	Q6V7R1	Burkholderia_virus	34.7	5.2e-60
>prophage 1
NZ_CP011990	Klebsiella pneumoniae UHKPC33 plasmid pUHKPC33-162.533kb, complete sequence	162533	0	3336	162533		Shigella_phage(33.33%)	6	NA	NA
WP_004152718.1|150_363_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004152719.1|373_598_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004152720.1|678_999_+	type II toxin-antitoxin system RelE/ParE family toxin	NA	A0A088CBP5	Shigella_phage	39.5	6.8e-09
WP_004152721.1|988_1267_+	helix-turn-helix transcriptional regulator	NA	O64356	Escherichia_phage	39.4	2.5e-07
WP_004152722.1|1267_1681_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_004178064.1|2514_3336_+	DUF945 domain-containing protein	NA	K4F5L3	Cronobacter_phage	40.4	2.6e-44
>prophage 2
NZ_CP011990	Klebsiella pneumoniae UHKPC33 plasmid pUHKPC33-162.533kb, complete sequence	162533	37489	38215	162533		Xanthomonas_phage(100.0%)	1	NA	NA
WP_004152303.1|37489_38215_+	type-F conjugative transfer system pilin acetylase TraX	NA	A0A1D6ZIU7	Xanthomonas_phage	29.4	5.5e-06
>prophage 3
NZ_CP011990	Klebsiella pneumoniae UHKPC33 plasmid pUHKPC33-162.533kb, complete sequence	162533	42774	102062	162533	bacteriocin,transposase,integrase	Stx2-converting_phage(16.67%)	51	45494:45510	104512:104528
WP_004152296.1|42774_43053_+|bacteriocin	bacteriocin immunity protein	bacteriocin	NA	NA	NA	NA
WP_009485932.1|43393_43873_+	phospholipase D family protein	NA	A0A1B2LRT6	Wolbachia_phage	35.2	9.8e-20
WP_004199332.1|44193_44472_+	replication regulatory protein RepA	NA	NA	NA	NA	NA
WP_004171457.1|44688_44766_+	RepA leader peptide Tap	NA	NA	NA	NA	NA
WP_004152292.1|44758_45616_+	incFII family plasmid replication initiator RepA	NA	NA	NA	NA	NA
45494:45510	attL	GCCACCGGCCGCTTCAT	NA	NA	NA	NA
WP_000093087.1|47062_49258_-	DEAD/DEAH box helicase	NA	NA	NA	NA	NA
WP_004152291.1|49254_50571_-	ATP-binding protein	NA	NA	NA	NA	NA
WP_004152290.1|50574_52884_-	TerB N-terminal domain-containing protein	NA	NA	NA	NA	NA
WP_003846917.1|54589_55843_-	lactose permease	NA	NA	NA	NA	NA
WP_004152287.1|55894_58969_-	beta-galactosidase	NA	L0N6M2	Herpes_simplex_virus	96.7	0.0e+00
WP_004152286.1|59090_60173_-	DNA-binding transcriptional repressor LacI	NA	C6ZCU4	Enterobacteria_phage	96.4	6.8e-186
WP_004152284.1|60633_61644_+	zinc-binding alcohol dehydrogenase family protein	NA	NA	NA	NA	NA
WP_165765869.1|61977_62265_+	EAL domain-containing protein	NA	NA	NA	NA	NA
WP_004118251.1|62595_62889_-	IS66 family insertion sequence element accessory protein TnpB	NA	A0A0P0ZDM8	Stx2-converting_phage	96.9	2.7e-49
WP_004152282.1|62987_63755_-	Fe(3+) dicitrate ABC transporter ATP-binding protein FecE	NA	G3M9Y6	Bacillus_virus	25.2	9.8e-14
WP_004152281.1|63755_64712_-	Fe(3+) dicitrate ABC transporter permease subunit FecD	NA	NA	NA	NA	NA
WP_004118243.1|64708_65707_-	iron-dicitrate ABC transporter permease FecC	NA	NA	NA	NA	NA
WP_004118241.1|65703_66606_-	Fe(3+) dicitrate ABC transporter substrate-binding protein FecB	NA	NA	NA	NA	NA
WP_004152280.1|66650_68975_-	Fe(3+) dicitrate transport protein FecA	NA	NA	NA	NA	NA
WP_004118237.1|69060_70014_-	fec operon regulator FecR	NA	NA	NA	NA	NA
WP_004118235.1|70010_70532_-	RNA polymerase sigma factor FecI	NA	NA	NA	NA	NA
WP_161989521.1|71493_71706_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004118231.1|71634_71802_+|integrase	integrase	integrase	NA	NA	NA	NA
WP_004118840.1|72086_73214_+	transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_004118229.1|73210_73804_+	ANTAR domain-containing protein	NA	NA	NA	NA	NA
WP_004152279.1|73800_74649_+	ABC transporter permease	NA	NA	NA	NA	NA
WP_004118227.1|74648_75569_+	ABC transporter permease	NA	NA	NA	NA	NA
WP_004152278.1|75581_77186_+	ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_004118225.1|77230_78178_+	acetamidase/formamidase family protein	NA	A0A1V0S8X7	Catovirus	22.7	9.6e-11
WP_004118832.1|78185_79919_+	ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	29.6	6.9e-15
WP_004152557.1|83741_84089_-	IS66 family insertion sequence element accessory protein TnpB	NA	A0A0P0ZDM8	Stx2-converting_phage	95.7	2.0e-59
WP_020956879.1|84085_84472_-|transposase	transposase	transposase	B6DZU5	Stx2-converting_phage	90.7	1.1e-58
WP_004118217.1|85019_85655_-	His-Xaa-Ser repeat protein HxsA	NA	NA	NA	NA	NA
WP_000005560.1|85651_86764_-	His-Xaa-Ser system radical SAM maturase HxsC	NA	S5WIP3	Leptospira_phage	33.8	1.5e-47
WP_004118216.1|86756_88145_-	His-Xaa-Ser system radical SAM maturase HxsB	NA	S5VT21	Leptospira_phage	29.0	6.3e-51
WP_176716597.1|88144_88384_-	His-Xaa-Ser system protein HxsD	NA	NA	NA	NA	NA
WP_000412211.1|89352_90012_+	type A-1 chloramphenicol O-acetyltransferase	NA	G3CFL0	Escherichia_phage	100.0	8.4e-131
WP_000656305.1|90212_90590_-	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_001138064.1|90656_93623_-|transposase	Tn3-like element TnAs3 family transposase	transposase	A0A1B0V7H9	Salmonella_phage	73.6	0.0e+00
WP_000147567.1|93625_94186_-	recombinase family protein	NA	A0A1B0V7I5	Salmonella_phage	86.2	4.0e-49
WP_000454193.1|94311_94662_-	DUF3330 domain-containing protein	NA	NA	NA	NA	NA
WP_000845048.1|94864_95878_-|integrase	class 1 integron integrase IntI1	integrase	A0A1P8DJJ6	Virus_Rctr41k	45.5	1.0e-71
WP_001083725.1|96022_96520_+	trimethoprim-resistant dihydrofolate reductase DfrA12	NA	A0A0A0PL85	Bacillus_phage	40.9	7.5e-23
WP_001336345.1|96631_96922_+	DUF1010 domain-containing protein	NA	NA	NA	NA	NA
WP_001206356.1|96927_97719_+	ANT(3'')-Ia family aminoglycoside nucleotidyltransferase AadA2	NA	NA	NA	NA	NA
WP_000679427.1|97882_98230_+	quaternary ammonium compound efflux SMR transporter QacE delta 1	NA	NA	NA	NA	NA
WP_000259031.1|98223_99063_+	sulfonamide-resistant dihydropteroate synthase Sul1	NA	A0A0B5J4J5	Pandoravirus	27.2	5.0e-11
WP_000376616.1|99190_99394_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000184001.1|99549_100755_+	chromate efflux transporter	NA	NA	NA	NA	NA
WP_000130000.1|100765_101071_+	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_001389365.1|101297_102062_+|transposase	IS6-like element IS6100 family transposase	transposase	A0A077SL39	Escherichia_phage	65.7	4.3e-86
104512:104528	attR	GCCACCGGCCGCTTCAT	NA	NA	NA	NA
>prophage 4
NZ_CP011990	Klebsiella pneumoniae UHKPC33 plasmid pUHKPC33-162.533kb, complete sequence	162533	105400	160079	162533	integrase,transposase,protease	Escherichia_phage(33.33%)	57	107394:107453	138040:138775
WP_004217321.1|105400_106105_-|transposase	IS6-like element IS26 family transposase	transposase	A0A077SL39	Escherichia_phage	99.6	1.2e-138
107394:107453	attL	CATTTTCAGCGTGACATCATTCTGTGGGCCGTACGCTGGTACTGCAAATACGGCATCAGT	NA	NA	NA	NA
WP_044117068.1|107408_108077_+|transposase	IS6 family transposase	transposase	A0A077SL39	Escherichia_phage	99.5	1.9e-130
WP_004153729.1|108932_109760_+	phosphonate ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	37.6	2.6e-20
WP_004152695.1|109756_110620_+	phosphate/phosphite/phosphonate ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_004152694.1|110628_111456_+	phosphonate ABC transporter, permease protein PhnE	NA	NA	NA	NA	NA
WP_004152693.1|111464_112475_+	phosphonate dehydrogenase PtxD	NA	A0A1V0SBV6	Catovirus	25.1	1.4e-15
WP_004152692.1|112468_113338_+	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_000019473.1|114546_115527_-|transposase	IS5-like element ISKpn26 family transposase	transposase	Q38213	Escherichia_phage	99.1	8.9e-185
WP_004118209.1|116728_116992_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_004118208.1|117006_117270_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004152118.1|117513_117795_+	helix-turn-helix domain-containing protein	NA	A0A1B1IUF9	uncultured_Mediterranean_phage	38.2	5.2e-05
WP_004152117.1|117829_118399_+	small heat shock protein sHSP20	NA	NA	NA	NA	NA
WP_004152116.1|118513_121309_+	heat shock survival AAA family ATPase ClpK	NA	K4FB40	Cronobacter_phage	41.0	5.2e-129
WP_004152115.1|121308_121506_+	hypothetical protein	NA	NA	NA	NA	NA
WP_009483782.1|121743_122493_+	phosphate-starvation-inducible PsiE family protein	NA	NA	NA	NA	NA
WP_004152113.1|122479_123442_+|protease	M48 family metalloprotease	protease	NA	NA	NA	NA
WP_020314316.1|125284_126631_-|transposase	ISNCY family transposase	transposase	NA	NA	NA	NA
WP_003026803.1|126842_127325_-	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_003026799.1|127312_127579_-	DUF1778 domain-containing protein	NA	NA	NA	NA	NA
WP_004152108.1|127754_128009_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004152107.1|128084_128342_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004152106.1|128390_128594_-	hemolysin expression modulator Hha	NA	NA	NA	NA	NA
WP_004152105.1|128627_128996_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004152104.1|129039_129534_-	DNA-binding protein	NA	NA	NA	NA	NA
WP_004152103.1|129564_130140_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004152102.1|130127_130397_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000493378.1|130966_131317_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000129823.1|131367_132111_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000015958.1|132107_132884_+|integrase	phage integrase family protein	integrase	I3WFA4	Macacine_betaherpesvirus	92.9	6.4e-53
WP_001143775.1|133155_136161_-|transposase	Tn3-like element Tn3 family transposase	transposase	Q1MVP5	Enterobacteria_phage	99.3	0.0e+00
WP_001217881.1|136322_136880_+	recombinase family protein	NA	Q1MVP4	Enterobacteria_phage	98.4	2.0e-93
WP_063840280.1|137113_137668_+	AAC(6')-Ib family aminoglycoside 6'-N-acetyltransferase	NA	NA	NA	NA	NA
WP_001067855.1|138018_138723_+|transposase	IS6-like element IS26 family transposase	transposase	A0A077SL39	Escherichia_phage	100.0	1.8e-139
WP_032409716.1|139305_139410_-	hypothetical protein	NA	NA	NA	NA	NA
138040:138775	attR	CATTTTCAGCGTGACATCATTCTGTGGGCCGTACGCTGGTACTGCAAATACGGCATCAGTTACCGTGAGCTGCAGGAGATGCTGGCTGAACGCGGAGTGAATGTCGATCACTCCACGATTTACCGCTGGGTTCAGCGTTATGCGCCTGAAATGGAAAAACGGCTGCGCTGGTACTGGCGTAACCCTTCCGATCTTTGCCCGTGGCACATGGATGAAACCTACGTGAAGGTCAATGGCCGCTGGGCGTATCTGTACCGGGCCGTCGACAGCCGGGGCCGCACTGTCGATTTTTATCTCTCCTCCCGTCGTAACAGCAAAGCTGCATACCGGTTTCTGGGTAAAATCCTCAACAACGTGAAGAAGTGGCAGATCCCGCGATTCATCAACACGGATAAAGCGCCCGCCTATGGTCGCGCGCTTGCTCTGCTCAAACGCGAAGGCCGGTGCCCGTCTGACGTTGAACACCGACAGATTAAGTACCGGAACAACGTGATTGAATGCGATCATGGCAAACTGAAACGGATAATCGGCGCCACGCTGGGATTTAAATCCATGAAGACGGCTTACGCCACCATCAAAGGTATTGAGGTGATGCGTGCACTACGCAAAGGCCAGGCCTCAGCATTTTATTATGGTGATCCCCTGGGCGAAATGCGCCTGGTAAGCAGAGTTTTTGAAATGTAAGGCCTTTGAATAAGACAAAAGGCTGCCTCATCGCTAACTTTGCAACAGTGCC	NA	NA	NA	NA
WP_004118283.1|139939_140806_+	replication initiation protein	NA	A0A222YYK1	Escherichia_phage	31.1	1.5e-23
WP_000339857.1|140982_141252_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000368714.1|141666_142872_+	AAA family ATPase	NA	A0A077SL49	Escherichia_phage	69.6	2.4e-163
WP_000064119.1|142871_143846_+	ParB/RepB/Spo0J family partition protein	NA	Q38420	Escherichia_phage	54.1	5.0e-87
WP_001754953.1|143927_145199_-	Y-family DNA polymerase	NA	F1C5A5	Cronobacter_phage	63.7	5.4e-150
WP_000776034.1|145198_145630_-	translesion error-prone DNA polymerase V autoproteolytic subunit	NA	A0A1W6JNS2	Morganella_phage	53.3	1.6e-29
WP_004178082.1|146035_147523_+	group II intron reverse transcriptase/maturase	NA	A0A0U4J920	Pseudomonas_phage	35.5	1.2e-31
WP_004152753.1|147756_147987_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004118478.1|148507_148933_+	antirestriction protein	NA	NA	NA	NA	NA
WP_004152754.1|149169_149424_+	DNA polymerase III subunit theta	NA	H9C187	Pectobacterium_phage	50.0	1.2e-11
WP_004118473.1|149458_149776_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004178072.1|150557_150785_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004198570.1|150876_151107_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004178068.1|151158_152514_+	DUF3560 domain-containing protein	NA	NA	NA	NA	NA
WP_004152645.1|152561_153125_+	methyltransferase	NA	A8HNV9	Thalassomonas_phage	34.1	1.3e-18
WP_004152644.1|153900_154443_+	single-stranded DNA-binding protein	NA	A0A0A0P1Q9	Enterobacteria_phage	76.7	6.0e-50
WP_004152643.1|154491_154740_+	DUF905 domain-containing protein	NA	NA	NA	NA	NA
WP_004178066.1|154809_156846_+	ParB/RepB/Spo0J family partition protein	NA	G8DH78	Emiliania_huxleyi_virus	26.0	9.0e-22
WP_004152641.1|156912_157344_+	conjugation system SOS inhibitor PsiB	NA	NA	NA	NA	NA
WP_004152640.1|157340_158069_+	plasmid SOS inhibition protein A	NA	NA	NA	NA	NA
WP_004199358.1|158065_158392_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004152638.1|158447_158822_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004220208.1|158999_160079_-|transposase	IS481-like element ISKpn28 family transposase	transposase	NA	NA	NA	NA
>prophage 1
NZ_CP011992	Klebsiella pneumoniae UHKPC33 plasmid pUHKPC33-43.380kb, complete sequence	43380	3248	13546	43380	transposase	Escherichia_phage(50.0%)	8	NA	NA
WP_000516402.1|3248_3911_-	peptidyl-arginine deiminase	NA	E5FFJ3	Burkholderia_phage	25.2	2.6e-07
WP_001549893.1|4291_4954_+	recombinase family protein	NA	M9Q1K0	Clostridium_phage	29.1	9.7e-10
WP_001549892.1|5040_5280_+	hypothetical protein	NA	I6PD82	Cronobacter_phage	55.1	4.4e-21
WP_001067855.1|5672_6377_-|transposase	IS6-like element IS26 family transposase	transposase	A0A077SL39	Escherichia_phage	100.0	1.8e-139
WP_002904004.1|6513_7374_+	class A extended-spectrum beta-lactamase SHV-12	NA	A0A077SL40	Escherichia_phage	99.3	2.2e-155
WP_002210513.1|7394_8156_-	DeoR/GlpR transcriptional regulator	NA	A0A077SK06	Escherichia_phage	100.0	1.9e-134
WP_002903955.1|8417_9320_+	NAD(P)-dependent oxidoreductase	NA	A0A077SLF7	Escherichia_phage	99.7	2.6e-159
WP_004199413.1|10528_13546_-|transposase	Tn3-like element IS3000 family transposase	transposase	A0A125RQ78	Bacillus_phage	24.7	5.5e-52
