The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
NC_021494	Lactobacillus reuteri I5007, complete sequence	1947706	19221	72365	1947706	transposase,protease	Bacillus_phage(33.33%)	41	NA	NA
WP_016496345.1|19221_20442_-|transposase	IS21 family transposase	transposase	A0A059NT83	Lactococcus_phage	43.3	4.2e-83
WP_016496347.1|21062_21497_+	MarR family transcriptional regulator	NA	NA	NA	NA	NA
WP_016496348.1|21584_23306_+	ABC transporter ATP-binding protein	NA	W8CYL7	Bacillus_phage	44.6	1.4e-113
WP_003675551.1|23650_24358_+	response regulator transcription factor	NA	W8CYM9	Bacillus_phage	39.6	4.3e-40
WP_041821547.1|24371_26237_+	cell wall metabolism sensor histidine kinase WalK	NA	W8CYF6	Bacillus_phage	34.7	5.5e-34
WP_016496350.1|26214_27510_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016496351.1|27522_28365_+	two-component system regulatory protein YycI	NA	NA	NA	NA	NA
WP_016496352.1|28382_29189_+	MBL fold metallo-hydrolase	NA	A0A2H4J3R0	uncultured_Caudovirales_phage	31.6	6.4e-32
WP_016496353.1|29292_30573_+	trypsin-like peptidase domain-containing protein	NA	A0A1B1IT49	uncultured_Mediterranean_phage	29.6	2.8e-21
WP_003669518.1|30664_31174_+	phosphatidylglycerophosphatase A	NA	A0A291I9Q0	Lactobacillus_phage	51.9	8.2e-41
WP_016496354.1|31481_32456_+	ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_011953354.1|32924_33404_+	23S rRNA (pseudouridine(1915)-N(3))-methyltransferase RlmH	NA	NA	NA	NA	NA
WP_035170446.1|33546_33765_+	hypothetical protein	NA	NA	NA	NA	NA
WP_019251837.1|33832_34375_+	NAD(P)H-dependent oxidoreductase	NA	NA	NA	NA	NA
WP_016496357.1|34593_35766_+	iron-containing alcohol dehydrogenase	NA	NA	NA	NA	NA
WP_003665279.1|36009_36873_+	sugar transporter	NA	NA	NA	NA	NA
WP_016496358.1|36987_37764_-	VOC family protein	NA	NA	NA	NA	NA
WP_016496359.1|37765_38578_-	NAD(P)-binding domain-containing protein	NA	A0A1X9I6T5	Streptococcus_phage	33.0	1.1e-20
WP_016496361.1|39074_40034_+|transposase	IS30 family transposase	transposase	NA	NA	NA	NA
WP_016496362.1|40166_41249_+	efflux RND transporter periplasmic adaptor subunit	NA	NA	NA	NA	NA
WP_016496363.1|41250_41949_+	ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	38.4	2.0e-37
WP_016496364.1|41935_43171_+	ABC transporter permease	NA	NA	NA	NA	NA
WP_016496365.1|43310_43970_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003668074.1|44034_45003_-|transposase	IS30 family transposase	transposase	NA	NA	NA	NA
WP_041821552.1|45235_46630_+	L,D-transpeptidase family protein	NA	NA	NA	NA	NA
WP_051111508.1|46919_47435_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016496368.1|47455_48406_-|transposase	IS30 family transposase	transposase	NA	NA	NA	NA
WP_016496369.1|48402_48543_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003669548.1|48550_48979_-	OsmC family protein	NA	NA	NA	NA	NA
WP_016496370.1|49046_50042_-	D-2-hydroxyacid dehydrogenase	NA	M1HKI4	Acanthocystis_turfacea_Chlorella_virus	31.1	6.5e-34
WP_016496371.1|50043_51231_-	aminotransferase class I/II-fold pyridoxal phosphate-dependent enzyme	NA	NA	NA	NA	NA
WP_003670244.1|51736_51958_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016496372.1|52075_54313_+|protease	ATP-dependent Clp protease ATP-binding subunit	protease	H6X3M6	Enterobacteria_phage	39.4	8.4e-122
WP_003675510.1|55226_58121_+	hypothetical protein	NA	NA	NA	NA	NA
WP_079375840.1|58205_58832_-	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_016496373.1|58929_60393_+	cardiolipin synthase	NA	NA	NA	NA	NA
WP_016496374.1|60507_64290_+	PD-(D/E)XK nuclease family protein	NA	NA	NA	NA	NA
WP_016496375.1|64289_68468_+	helicase-exonuclease AddAB subunit AddA	NA	A7KV33	Bacillus_phage	24.2	1.2e-17
WP_003675501.1|68468_69404_+	LacI family DNA-binding transcriptional regulator	NA	NA	NA	NA	NA
WP_016496376.1|69467_70646_+	acetyl-CoA C-acetyltransferase	NA	NA	NA	NA	NA
WP_013924000.1|70946_72365_+|transposase	ISLre2-like element ISLre2 family transposase	transposase	NA	NA	NA	NA
>prophage 2
NC_021494	Lactobacillus reuteri I5007, complete sequence	1947706	117101	232479	1947706	transposase,tRNA	unidentified_phage(13.33%)	101	NA	NA
WP_016496393.1|117101_118232_+|transposase	IS30 family transposase	transposase	H7BUM7	unidentified_phage	31.9	2.7e-36
WP_003668074.1|118866_119835_-|transposase	IS30 family transposase	transposase	NA	NA	NA	NA
WP_003675442.1|120117_120369_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003675440.1|120465_121146_+	response regulator transcription factor	NA	W8CYM9	Bacillus_phage	33.8	2.5e-29
WP_016496396.1|121142_122474_+	HAMP domain-containing histidine kinase	NA	W8CYF6	Bacillus_phage	27.3	3.4e-22
WP_016496397.1|122578_123229_+	PepSY domain-containing protein	NA	NA	NA	NA	NA
WP_003669426.1|125389_125710_-	carboxymuconolactone decarboxylase family protein	NA	NA	NA	NA	NA
WP_003675433.1|125835_126429_-	TetR/AcrR family transcriptional regulator	NA	NA	NA	NA	NA
WP_003675432.1|126578_127259_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003675431.1|127260_128235_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003675430.1|128468_129341_+	aldo/keto reductase	NA	A0A2H4PQR8	Staphylococcus_phage	40.2	2.1e-52
WP_003675429.1|129443_129929_+	NAD(P)H-dependent oxidoreductase	NA	NA	NA	NA	NA
WP_003675428.1|129987_130857_-	LysR family transcriptional regulator	NA	A0A2P0ZL89	Lactobacillus_phage	31.0	7.0e-08
WP_016496401.1|130973_131504_+	acetyltransferase	NA	NA	NA	NA	NA
WP_003665145.1|131512_131716_+	alpha/beta hydrolase	NA	NA	NA	NA	NA
WP_003675425.1|131716_132577_+	alpha/beta hydrolase	NA	NA	NA	NA	NA
WP_016496402.1|132683_133223_+	phenolic acid decarboxylase	NA	NA	NA	NA	NA
WP_003675423.1|133265_133796_+	PadR family transcriptional regulator	NA	NA	NA	NA	NA
WP_035161721.1|133798_134398_+	NAD(P)H-binding protein	NA	NA	NA	NA	NA
WP_003670156.1|134497_135499_+	DUF1002 domain-containing protein	NA	NA	NA	NA	NA
WP_003675421.1|135557_136547_-	asparaginase	NA	NA	NA	NA	NA
WP_003675420.1|137618_138497_+	aldo/keto reductase	NA	A0A2H4PQR8	Staphylococcus_phage	40.9	8.0e-52
WP_016496405.1|138597_139176_-	TetR/AcrR family transcriptional regulator	NA	NA	NA	NA	NA
WP_016496408.1|140408_141053_+	SDR family oxidoreductase	NA	NA	NA	NA	NA
WP_003669411.1|141158_141530_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003669410.1|141631_142303_+	type 1 glutamine amidotransferase	NA	NA	NA	NA	NA
WP_016496409.1|142375_143176_-	EAL domain-containing protein	NA	NA	NA	NA	NA
WP_016496411.1|143586_144510_+|transposase	IS30 family transposase	transposase	H7BUM7	unidentified_phage	31.7	5.1e-33
WP_003668074.1|145075_146044_-|transposase	IS30 family transposase	transposase	NA	NA	NA	NA
WP_003675410.1|146744_147425_+	EAL domain-containing protein	NA	NA	NA	NA	NA
WP_003675409.1|147493_148792_-|tRNA	asparagine--tRNA ligase	tRNA	A0A2P1EMB4	Moumouvirus	31.5	1.3e-55
WP_016496414.1|148811_149822_-	aspartate--ammonia ligase	NA	A0A1C9C5F0	Heterosigma_akashiwo_virus	43.4	5.5e-65
WP_016496415.1|150198_150759_-	folate family ECF transporter S component	NA	NA	NA	NA	NA
WP_016496416.1|150981_153513_-	M1 family metallopeptidase	NA	A0A0P0IY26	Acinetobacter_phage	25.2	2.4e-64
WP_003675401.1|153659_154301_-	SDR family oxidoreductase	NA	NA	NA	NA	NA
WP_003675399.1|154517_155840_+	C1 family peptidase	NA	R4TV59	Phaeocystis_globosa_virus	31.0	1.5e-65
WP_003675396.1|155989_157165_+	MFS transporter	NA	NA	NA	NA	NA
WP_016496417.1|157176_158490_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016496420.1|159000_159603_-	nitroreductase family protein	NA	NA	NA	NA	NA
WP_016496421.1|159700_160012_+	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_003675390.1|160139_160796_+	NAD(P)H-binding protein	NA	NA	NA	NA	NA
WP_016496422.1|160976_161414_+	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_003669379.1|161542_161776_+	cytochrome b5	NA	NA	NA	NA	NA
WP_016496423.1|161947_162916_+|transposase	IS30 family transposase	transposase	NA	NA	NA	NA
WP_003665104.1|162990_163209_+	cytochrome b5	NA	NA	NA	NA	NA
WP_003675383.1|163221_163467_+	cytochrome b5	NA	NA	NA	NA	NA
WP_016496424.1|163524_164661_-	5-methyltetrahydropteroyltriglutamate-- homocysteine S-methyltransferase	NA	A0A218MNE0	uncultured_virus	45.5	6.0e-84
WP_003675378.1|165421_166378_+	ketopantoate reductase family protein	NA	NA	NA	NA	NA
WP_080637861.1|166562_167957_-	amino acid permease	NA	NA	NA	NA	NA
WP_143456168.1|168269_169925_+	MFS transporter	NA	A0A1V0QG10	Shearwaterpox_virus	33.8	4.3e-06
WP_142499017.1|171232_172084_+|transposase	IS3 family transposase	transposase	A0A1P8CWQ3	Bacillus_phage	28.1	9.2e-13
WP_011953599.1|172157_173963_-|tRNA	threonine--tRNA ligase	tRNA	A0A2K9L6B6	Tupanvirus	32.1	7.8e-86
WP_016496430.1|174291_174975_-	hypothetical protein	NA	NA	NA	NA	NA
WP_171945898.1|175240_176881_-	Nramp family divalent metal transporter	NA	NA	NA	NA	NA
WP_003665087.1|177405_178416_+	zinc-dependent alcohol dehydrogenase family protein	NA	NA	NA	NA	NA
WP_003675363.1|178677_179190_+	TetR/AcrR family transcriptional regulator	NA	NA	NA	NA	NA
WP_003675361.1|179200_180259_+	ABC transporter permease	NA	NA	NA	NA	NA
WP_016496431.1|180276_180963_+	ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	38.0	5.5e-32
WP_016496432.1|181061_183044_+	ABC transporter ATP-binding protein/permease	NA	G9BWD6	Planktothrix_phage	40.7	1.9e-32
WP_003675355.1|183273_183510_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003675352.1|183612_183930_-	winged helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_016496434.1|184093_185791_-	LysM peptidoglycan-binding domain-containing protein	NA	A0A0A7NU10	Lactobacillus_phage	44.3	1.2e-24
WP_003675348.1|186218_187163_+	LacI family DNA-binding transcriptional regulator	NA	C6ZCU4	Enterobacteria_phage	26.5	4.4e-16
WP_003675345.1|187294_187480_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003675343.1|187705_188326_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003675341.1|188327_189524_+	MFS transporter	NA	A0A2H4PQR6	Staphylococcus_phage	34.8	3.4e-53
WP_003675339.1|189845_191123_+|tRNA	histidine--tRNA ligase	tRNA	NA	NA	NA	NA
WP_016496435.1|191244_191739_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016496436.1|191842_192481_-	NAD(P)H-hydrate epimerase	NA	NA	NA	NA	NA
WP_003675334.1|192678_194064_-	L,D-transpeptidase	NA	NA	NA	NA	NA
WP_016496437.1|194256_195675_+|transposase	ISLre2-like element ISLre2 family transposase	transposase	NA	NA	NA	NA
WP_003669331.1|196197_196854_+	L,D-transpeptidase	NA	NA	NA	NA	NA
WP_016496438.1|197052_197634_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016496439.1|197704_198916_+	D-alanyl-D-alanine carboxypeptidase	NA	NA	NA	NA	NA
WP_003675325.1|198983_199838_+	alpha/beta hydrolase	NA	NA	NA	NA	NA
WP_003675324.1|200001_201123_-	glycerol dehydrogenase	NA	NA	NA	NA	NA
WP_016496440.1|201278_203408_-	LTA synthase family protein	NA	W6LM83	Streptococcus_phage	45.7	1.6e-159
WP_016496441.1|203533_203797_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003675320.1|203928_204582_+	phosphoglycerate mutase family protein	NA	NA	NA	NA	NA
WP_041821568.1|204801_205401_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_123835781.1|205337_206243_+|transposase	IS3 family transposase	transposase	A0A0C5AEA5	Paenibacillus_phage	29.9	7.8e-18
WP_003675317.1|208004_209414_-	Na+/H+ antiporter NhaC	NA	NA	NA	NA	NA
WP_016496446.1|209725_211054_-	purine permease	NA	Q9KX94	Enterobacteria_phage	30.8	3.5e-35
WP_016496447.1|211422_212856_+	C69 family dipeptidase	NA	NA	NA	NA	NA
WP_016496448.1|213006_214527_+|transposase	IS1182 family transposase	transposase	A0ZS58	Staphylococcus_virus	39.1	1.0e-94
WP_016496449.1|214838_215756_-	magnesium transporter CorA family protein	NA	NA	NA	NA	NA
WP_016496450.1|215902_216823_+	RluA family pseudouridine synthase	NA	NA	NA	NA	NA
WP_003665044.1|216841_217597_+	TerC family protein	NA	S5MAL1	Bacillus_phage	41.8	2.4e-41
WP_003675303.1|217598_217916_+	thioredoxin	NA	A0A1X9I9P5	Staphylococcus_phage	37.8	2.7e-18
WP_003675301.1|217984_219307_-	MATE family efflux transporter	NA	NA	NA	NA	NA
WP_016496451.1|219661_223162_+	LPXTG cell wall anchor domain-containing protein	NA	NA	NA	NA	NA
WP_003675296.1|223220_223553_-	winged helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_016496452.1|223597_224161_-	TMEM165/GDT1 family protein	NA	NA	NA	NA	NA
WP_016496453.1|224226_224991_-	ATP-binding cassette domain-containing protein	NA	G9BWD6	Planktothrix_phage	25.4	5.9e-11
WP_003675292.1|224983_225883_-	branched-chain amino acid ABC transporter permease	NA	NA	NA	NA	NA
WP_003675290.1|225879_226875_-	ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_016496454.1|227248_228274_-	C40 family peptidase	NA	A0A1J0GW44	Streptomyces_phage	44.9	4.2e-12
WP_016496411.1|228650_229574_+|transposase	IS30 family transposase	transposase	H7BUM7	unidentified_phage	31.7	5.1e-33
WP_051111511.1|229715_229961_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016496455.1|229953_231084_-|transposase	IS30 family transposase	transposase	H7BUM7	unidentified_phage	31.9	4.6e-36
WP_003668074.1|231510_232479_+|transposase	IS30 family transposase	transposase	NA	NA	NA	NA
>prophage 3
NC_021494	Lactobacillus reuteri I5007, complete sequence	1947706	255235	286969	1947706	transposase	unidentified_phage(27.27%)	31	NA	NA
WP_013923736.1|255235_256366_-|transposase	IS30 family transposase	transposase	H7BUM7	unidentified_phage	32.1	7.1e-37
WP_016496423.1|257040_258009_+|transposase	IS30 family transposase	transposase	NA	NA	NA	NA
WP_016496466.1|257994_258948_-	cysteine synthase A	NA	A0A1X9I5K7	Streptococcus_phage	65.1	4.4e-112
WP_016496467.1|258953_259781_-	homoserine O-succinyltransferase	NA	NA	NA	NA	NA
WP_016496361.1|259926_260886_+|transposase	IS30 family transposase	transposase	NA	NA	NA	NA
WP_016496469.1|261091_263020_-	FtsX-like permease family protein	NA	NA	NA	NA	NA
WP_016496470.1|263019_263775_-	ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	34.5	4.5e-27
WP_016496471.1|263887_264868_-	sensor histidine kinase	NA	NA	NA	NA	NA
WP_041821577.1|264860_265460_-	response regulator transcription factor	NA	W8CYM9	Bacillus_phage	35.3	1.5e-17
WP_003675240.1|265539_266382_+	aldo/keto reductase	NA	A0A2H4PQR8	Staphylococcus_phage	41.3	8.7e-56
WP_003675238.1|266575_267328_-	nicotinamide mononucleotide transporter	NA	A0A2H4PB74	Lactobacillus_phage	70.2	4.7e-93
WP_016496473.1|267578_268076_-	transcription elongation factor GreA	NA	NA	NA	NA	NA
WP_003675234.1|268182_269304_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016496474.1|269326_269653_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003664967.1|269709_269934_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016496475.1|269947_270454_-	YbhB/YbcL family Raf kinase inhibitor-like protein	NA	NA	NA	NA	NA
WP_016496476.1|270489_271272_-	tyrosine-protein phosphatase	NA	NA	NA	NA	NA
WP_003675226.1|271301_272270_-	SGNH/GDSL hydrolase family protein	NA	A0A2H4PRU1	Lactococcus_phage	31.9	5.9e-32
WP_003675223.1|272464_273643_+	galactokinase	NA	NA	NA	NA	NA
WP_003675221.1|273669_275121_+	UDP-glucose--hexose-1-phosphate uridylyltransferase	NA	NA	NA	NA	NA
WP_003675220.1|275158_276151_+	LacI family DNA-binding transcriptional regulator	NA	C6ZCU4	Enterobacteria_phage	23.9	2.4e-12
WP_003675218.1|276220_276832_-	DedA family protein	NA	NA	NA	NA	NA
WP_016496477.1|277081_278395_+	cation:dicarboxylase symporter family transporter	NA	NA	NA	NA	NA
WP_016496411.1|278552_279476_+|transposase	IS30 family transposase	transposase	H7BUM7	unidentified_phage	31.7	5.1e-33
WP_003669853.1|279508_279979_-	Lrp/AsnC family transcriptional regulator	NA	NA	NA	NA	NA
WP_003669854.1|280183_280648_+	universal stress protein	NA	NA	NA	NA	NA
WP_016496478.1|280726_281101_+	low temperature requirement protein A	NA	NA	NA	NA	NA
WP_072575277.1|281113_281737_+	low temperature requirement protein A	NA	NA	NA	NA	NA
WP_041816996.1|281826_282225_+|transposase	IS200/IS605 family transposase	transposase	A0A286QN76	Streptococcus_phage	62.1	1.1e-45
WP_003675214.1|283870_285823_-	MFS transporter	NA	NA	NA	NA	NA
WP_016496481.1|286045_286969_-|transposase	IS30 family transposase	transposase	H7BUM7	unidentified_phage	31.7	3.9e-33
>prophage 4
NC_021494	Lactobacillus reuteri I5007, complete sequence	1947706	385079	438459	1947706	transposase	unidentified_phage(18.18%)	41	NA	NA
WP_016497145.1|385079_386045_-|transposase	IS30 family transposase	transposase	H7BW47	unidentified_phage	30.7	1.9e-14
WP_016496526.1|386447_387062_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003664767.1|388169_388646_+	S-ribosylhomocysteine lyase	NA	NA	NA	NA	NA
WP_003675003.1|388761_389625_+	metal ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_003675000.1|391861_393043_+	PTS sugar transporter subunit IIC	NA	NA	NA	NA	NA
WP_003664757.1|393299_393857_+	elongation factor P	NA	NA	NA	NA	NA
WP_016496533.1|394206_395163_+|transposase	IS30 family transposase	transposase	NA	NA	NA	NA
WP_016496534.1|395185_395896_-	response regulator transcription factor	NA	W8CYM9	Bacillus_phage	37.2	7.7e-13
WP_041821599.1|396021_396894_+	phosphate ABC transporter substrate-binding protein	NA	E3SII0	Synechococcus_phage	25.9	1.3e-09
WP_003674993.1|396898_397798_+	phosphate ABC transporter permease subunit PstC	NA	NA	NA	NA	NA
WP_016496536.1|397797_398679_+	phosphate ABC transporter permease PstA	NA	NA	NA	NA	NA
WP_016496537.1|398689_399445_+	phosphate ABC transporter ATP-binding protein	NA	G3M9Y6	Bacillus_virus	29.6	1.8e-15
WP_016496538.1|399455_400160_+	phosphate signaling complex protein PhoU	NA	NA	NA	NA	NA
WP_016496539.1|401331_402195_+	efflux RND transporter permease subunit	NA	NA	NA	NA	NA
WP_013923866.1|403512_404688_+|transposase	transposase	transposase	A0A0P0ICY9	Lactobacillus_phage	55.7	2.7e-119
WP_016496544.1|405509_406649_+	glycoside hydrolase	NA	NA	NA	NA	NA
WP_041821602.1|406645_407410_-	NADPH-dependent oxidoreductase	NA	NA	NA	NA	NA
WP_016496411.1|407433_408357_-|transposase	IS30 family transposase	transposase	H7BUM7	unidentified_phage	31.7	5.1e-33
WP_016496546.1|408557_410330_-	oleate hydratase	NA	NA	NA	NA	NA
WP_016496547.1|410484_411828_+	potassium uptake protein	NA	NA	NA	NA	NA
WP_016496548.1|411820_412489_+	TrkA family potassium uptake protein	NA	NA	NA	NA	NA
WP_016496549.1|412506_413052_+	methyltransferase domain-containing protein	NA	NA	NA	NA	NA
WP_016496550.1|413309_414614_-	Nramp family divalent metal transporter	NA	NA	NA	NA	NA
WP_016496551.1|414616_415549_-	ferrochelatase	NA	NA	NA	NA	NA
WP_016496552.1|415856_416771_+	cysteine synthase family protein	NA	A0A1X9I5K7	Streptococcus_phage	41.8	8.8e-62
WP_016496554.1|417587_418616_-	putative sulfate exporter family transporter	NA	NA	NA	NA	NA
WP_016496555.1|418795_419512_+	alpha/beta hydrolase	NA	NA	NA	NA	NA
WP_016496556.1|419719_421189_-	ABC-F type ribosomal protection protein	NA	A0A2I4R674	Erysipelothrix_phage	24.9	1.2e-23
WP_013924000.1|421505_422924_-|transposase	ISLre2-like element ISLre2 family transposase	transposase	NA	NA	NA	NA
WP_016496557.1|423012_423975_-	Dyp-type peroxidase	NA	S4VXK8	Pandoravirus	27.5	7.7e-16
WP_016496558.1|424109_425627_+	YfcC family protein	NA	NA	NA	NA	NA
WP_016496559.1|425639_426974_+	Sapep family Mn(2+)-dependent dipeptidase	NA	NA	NA	NA	NA
WP_016496560.1|427271_428489_+	MFS transporter	NA	NA	NA	NA	NA
WP_003668877.1|428515_429973_+	sucrose phosphorylase	NA	NA	NA	NA	NA
WP_016496561.1|430124_430922_-	serine hydrolase	NA	NA	NA	NA	NA
WP_003674953.1|432198_433443_+	D-alanyl-D-alanine carboxypeptidase	NA	B6DZZ7	Stx2-converting_phage	25.6	1.1e-11
WP_003668870.1|433798_434239_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003674951.1|434315_435353_-	galactose mutarotase	NA	NA	NA	NA	NA
WP_003674949.1|435470_435698_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016496565.1|435720_437118_-	DUF2252 domain-containing protein	NA	NA	NA	NA	NA
WP_016496566.1|437298_438459_-|transposase	transposase	transposase	Q5ULQ4	Lactobacillus_virus	66.7	3.9e-147
>prophage 5
NC_021494	Lactobacillus reuteri I5007, complete sequence	1947706	628680	644091	1947706		Enterococcus_phage(25.0%)	11	NA	NA
WP_016496652.1|628680_629655_+	glycosyltransferase family 2 protein	NA	A8CG95	Salmonella_phage	38.9	1.2e-53
WP_016496654.1|629794_630853_+	DUF2029 domain-containing protein	NA	NA	NA	NA	NA
WP_016496655.1|630963_633285_+	glucosaminidase domain-containing protein	NA	A0A249Y0X5	Enterococcus_phage	39.8	1.5e-33
WP_016496656.1|633431_634301_+	glucose-1-phosphate thymidylyltransferase RfbA	NA	I7I009	Enterobacteria_phage	59.7	4.1e-101
WP_016496657.1|634314_634896_+	dTDP-4-dehydrorhamnose 3,5-epimerase	NA	I7HJC4	Enterobacteria_phage	45.1	1.3e-37
WP_016496658.1|634907_635948_+	dTDP-glucose 4,6-dehydratase	NA	H9NC62	Sphingomonas_phage	37.1	2.1e-51
WP_016496659.1|636094_636934_+	dTDP-4-dehydrorhamnose reductase	NA	A0A291LA50	Escherichia_phage	40.1	1.4e-34
WP_016496660.1|637005_639627_+	KxYKxGKxW signal peptide domain-containing protein	NA	A0A249XUP0	Enterococcus_phage	33.1	2.1e-07
WP_003674728.1|639698_640817_+	AI-2E family transporter	NA	NA	NA	NA	NA
WP_016496661.1|640857_642327_-	LCP family protein	NA	NA	NA	NA	NA
WP_003668625.1|642513_644091_+	peptide chain release factor 3	NA	A0A1B0RXH7	Streptococcus_phage	26.1	6.3e-31
>prophage 6
NC_021494	Lactobacillus reuteri I5007, complete sequence	1947706	834208	966755	1947706	transposase	Lactococcus_phage(20.0%)	99	NA	NA
WP_016496732.1|834208_835585_-|transposase	IS3 family transposase	transposase	A0A1B1P773	Bacillus_phage	34.8	6.0e-38
WP_016496733.1|835652_836633_-	polyprenyl synthetase family protein	NA	NA	NA	NA	NA
WP_016496734.1|836713_837613_+	prenyltransferase	NA	NA	NA	NA	NA
WP_003675609.1|837648_838350_-	bifunctional demethylmenaquinone methyltransferase/2-methoxy-6-polyprenyl-1,4-benzoquinol methylase UbiE	NA	A0A1X9I6N4	Streptococcus_phage	33.3	1.0e-04
WP_003675607.1|838370_839606_-	MFS transporter	NA	NA	NA	NA	NA
WP_003675605.1|839724_840603_+	metallophosphoesterase family protein	NA	NA	NA	NA	NA
WP_003667006.1|840748_841018_+	30S ribosomal protein S14	NA	NA	NA	NA	NA
WP_003675603.1|841249_841714_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003675601.1|841713_841941_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003675599.1|842011_842674_+	serine dehydratase	NA	NA	NA	NA	NA
WP_003675597.1|842683_843565_+	L-serine ammonia-lyase, iron-sulfur-dependent, subunit alpha	NA	NA	NA	NA	NA
WP_003675595.1|843665_844229_+	peroxiredoxin	NA	NA	NA	NA	NA
WP_003675593.1|844242_845910_+	FAD-dependent oxidoreductase	NA	G3MA85	Bacillus_virus	37.5	1.0e-55
WP_016496742.1|854710_855643_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016496743.1|855719_855944_+	LPXTG cell wall anchor domain-containing protein	NA	NA	NA	NA	NA
WP_003675586.1|857575_858766_+	accessory Sec system protein translocase subunit SecY2	NA	NA	NA	NA	NA
WP_003675585.1|858768_860280_+	accessory Sec system protein Asp1	NA	NA	NA	NA	NA
WP_016496746.1|860291_861779_+	accessory Sec system protein Asp2	NA	NA	NA	NA	NA
WP_003675581.1|861781_862669_+	accessory Sec system protein Asp3	NA	NA	NA	NA	NA
WP_016496747.1|862672_865021_+	accessory Sec system translocase SecA2	NA	NA	NA	NA	NA
WP_003675577.1|865035_866574_+	accessory Sec system glycosyltransferase GtfA	NA	NA	NA	NA	NA
WP_003675575.1|866566_867892_+	accessory Sec system glycosylation chaperone GtfB	NA	NA	NA	NA	NA
WP_016496748.1|867884_868082_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016496749.1|868337_868886_+	serine-rich glycoprotein adhesin	NA	NA	NA	NA	NA
WP_080637864.1|869021_870725_+	LPXTG cell wall anchor domain-containing protein	NA	NA	NA	NA	NA
WP_155258982.1|870843_871533_-	ATP-binding protein	NA	A0A059NT77	Lactococcus_phage	50.0	2.9e-49
WP_016496752.1|871471_872692_-|transposase	IS21 family transposase	transposase	A0A059NT83	Lactococcus_phage	44.3	1.2e-85
WP_003667025.1|872810_874214_-	C69 family dipeptidase	NA	NA	NA	NA	NA
WP_003676754.1|874352_876182_+	monovalent cation:proton antiporter family protein	NA	NA	NA	NA	NA
WP_003663508.1|876264_876450_+	4-oxalocrotonate tautomerase	NA	NA	NA	NA	NA
WP_016496753.1|876584_878087_+	glycerol kinase GlpK	NA	NA	NA	NA	NA
WP_041821653.1|878131_878644_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016496755.1|878676_878913_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016496756.1|878922_879498_-	sigma-70 family RNA polymerase sigma factor	NA	NA	NA	NA	NA
WP_143454404.1|879735_879933_+	hypothetical protein	NA	NA	NA	NA	NA
WP_035167654.1|880054_880453_+|transposase	IS200/IS605 family transposase	transposase	A0A286QN76	Streptococcus_phage	62.9	3.9e-46
WP_016496758.1|880452_881628_+|transposase	transposase	transposase	A0A0P0ICY9	Lactobacillus_phage	55.4	1.9e-117
WP_016496760.1|882601_883597_+	LCP family protein	NA	NA	NA	NA	NA
WP_016496761.1|883617_884496_+	exopolysaccharide biosynthesis protein	NA	NA	NA	NA	NA
WP_016496762.1|884508_885252_+	CpsD/CapB family tyrosine-protein kinase	NA	NA	NA	NA	NA
WP_016496763.1|885271_886201_+	GDP-mannose 4,6-dehydratase	NA	A0A1V0SKV4	Klosneuvirus	37.1	7.4e-48
WP_016496764.1|886217_886874_+	sugar transferase	NA	NA	NA	NA	NA
WP_016496765.1|886873_887650_+	glycosyltransferase family 2 protein	NA	NA	NA	NA	NA
WP_041821656.1|887794_888700_+	glycosyltransferase	NA	NA	NA	NA	NA
WP_155258983.1|888783_889821_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016496768.1|889820_890777_+	glycosyltransferase family 2 protein	NA	NA	NA	NA	NA
WP_016496769.1|890766_891756_+	glycosyltransferase family 2 protein	NA	NA	NA	NA	NA
WP_016496770.1|891752_892808_+	glycosyltransferase family 4 protein	NA	NA	NA	NA	NA
WP_016496771.1|892800_894318_+	glycosyltransferase	NA	A0A1V0SAH6	Catovirus	36.4	2.3e-14
WP_172635289.1|894271_894823_+	polysaccharide pyruvyl transferase family protein	NA	NA	NA	NA	NA
WP_016496773.1|894897_896412_+	oligosaccharide flippase family protein	NA	NA	NA	NA	NA
WP_016496774.1|896512_897481_+|transposase	IS30 family transposase	transposase	NA	NA	NA	NA
WP_016496775.1|897539_898283_+	glycosyl transferase	NA	A0A2K9L2U7	Tupanvirus	26.7	1.2e-08
WP_041821659.1|898439_899489_+	dTDP-glucose 4,6-dehydratase	NA	H9NC62	Sphingomonas_phage	35.5	3.3e-52
WP_013923981.1|900059_900248_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003668340.1|900237_900594_+	IS66 family insertion sequence element accessory protein TnpB	NA	S5WJH4	Leptospira_phage	44.6	6.1e-11
WP_016496777.1|900664_902209_+|transposase	IS66 family transposase	transposase	S5VTD3	Leptospira_phage	26.5	8.0e-31
WP_016496778.1|902281_903775_-|transposase	IS66 family transposase	transposase	S5VTD3	Leptospira_phage	27.6	1.2e-34
WP_041821568.1|904036_904636_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_123835781.1|904572_905478_+|transposase	IS3 family transposase	transposase	A0A0C5AEA5	Paenibacillus_phage	29.9	7.8e-18
WP_003671670.1|905617_906376_-	ATP-binding protein	NA	A0A059NT77	Lactococcus_phage	48.2	1.9e-62
WP_013923983.1|906380_907592_-|transposase	IS21 family transposase	transposase	A0A059NT83	Lactococcus_phage	45.9	8.3e-92
WP_016496779.1|907652_907997_-	IS66 family insertion sequence element accessory protein TnpB	NA	S5WJH4	Leptospira_phage	40.6	2.1e-08
WP_016496780.1|907986_908175_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016496786.1|911460_912462_+	glycosyl hydrolase 53 family protein	NA	NA	NA	NA	NA
WP_016496787.1|912510_913326_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016496411.1|913456_914380_-|transposase	IS30 family transposase	transposase	H7BUM7	unidentified_phage	31.7	5.1e-33
WP_013923736.1|914753_915884_+|transposase	IS30 family transposase	transposase	H7BUM7	unidentified_phage	32.1	7.1e-37
WP_016496790.1|917175_918399_+|transposase	IS21 family transposase	transposase	A0A059NT83	Lactococcus_phage	44.7	3.0e-89
WP_016496791.1|918400_919138_+	ATP-binding protein	NA	A0A059NT77	Lactococcus_phage	45.4	1.9e-51
WP_016496792.1|919464_920742_-|transposase	ISL3 family transposase	transposase	A0A1S5SBP9	Streptococcus_phage	29.7	3.8e-34
WP_155258984.1|920977_926353_+	KxYKxGKxW signal peptide domain-containing protein	NA	NA	NA	NA	NA
WP_016496794.1|927016_927949_+	homocysteine S-methyltransferase	NA	NA	NA	NA	NA
WP_016496795.1|927941_929345_+	amino acid permease	NA	NA	NA	NA	NA
WP_016496796.1|929423_929681_+	hypothetical protein	NA	NA	NA	NA	NA
WP_041816984.1|930079_930478_+|transposase	IS200/IS605 family transposase	transposase	A0A286QN76	Streptococcus_phage	62.9	3.0e-46
WP_016496797.1|930477_931653_+|transposase	transposase	transposase	A0A0P0ICY9	Lactobacillus_phage	55.7	5.9e-119
WP_003672329.1|932014_932257_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016496799.1|932438_934289_+	LPXTG-motif cell wall anchor domain protein	NA	NA	NA	NA	NA
WP_016496800.1|934353_937839_+	DEAD/DEAH box helicase	NA	A0A0P0YMN2	Yellowstone_lake_phycodnavirus	28.0	6.6e-41
WP_003676694.1|937934_938711_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016496801.1|938863_939754_+	glycoside hydrolase family 25	NA	A0A0A1ERA5	Lactobacillus_phage	54.2	2.7e-95
WP_003676691.1|939906_941025_+	exonuclease SbcCD subunit D	NA	A0A059T8H2	Listeria_phage	24.8	1.1e-10
WP_016496802.1|941026_944128_+	SMC family ATPase	NA	NA	NA	NA	NA
WP_003676686.1|945709_946165_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016496805.1|946193_946685_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003673967.1|952314_952476_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016496806.1|952530_953172_-	phosphatase PAP2 family protein	NA	NA	NA	NA	NA
WP_016496807.1|953313_955620_+	DUF4968 domain-containing protein	NA	NA	NA	NA	NA
WP_003673974.1|955777_957037_+	chloride channel protein	NA	NA	NA	NA	NA
WP_016496808.1|957221_957869_-	thiamine phosphate synthase	NA	NA	NA	NA	NA
WP_003673976.1|957865_958684_-	bifunctional hydroxymethylpyrimidine kinase/phosphomethylpyrimidine kinase	NA	NA	NA	NA	NA
WP_016496809.1|958676_959486_-	hydroxyethylthiazole kinase	NA	NA	NA	NA	NA
WP_003673979.1|959765_960071_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016496811.1|961322_962453_-|transposase	IS30 family transposase	transposase	H7BUM7	unidentified_phage	31.6	1.8e-35
WP_003673983.1|962733_963171_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003673985.1|963186_964146_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016496812.1|964279_965299_+	ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_016496813.1|965378_966755_+|transposase	IS3 family transposase	transposase	A0A1B1P773	Bacillus_phage	35.2	2.1e-38
>prophage 7
NC_021494	Lactobacillus reuteri I5007, complete sequence	1947706	1005020	1062050	1947706	transposase	Streptococcus_phage(17.65%)	55	NA	NA
WP_016496411.1|1005020_1005944_+|transposase	IS30 family transposase	transposase	H7BUM7	unidentified_phage	31.7	5.1e-33
WP_003674045.1|1008378_1008732_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003674047.1|1008865_1009513_-	DsbA family oxidoreductase	NA	NA	NA	NA	NA
WP_003674050.1|1010448_1010721_-	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_003674052.1|1010720_1011086_-	type II toxin-antitoxin system RelE/ParE family toxin	NA	NA	NA	NA	NA
WP_003674054.1|1011638_1012001_+	LapA family protein	NA	NA	NA	NA	NA
WP_016496837.1|1012021_1012858_+	HAD family phosphatase	NA	NA	NA	NA	NA
WP_003674056.1|1012902_1013385_-	nucleoside 2-deoxyribosyltransferase	NA	A0A0A7DMT2	Lactobacillus_phage	65.6	8.2e-59
WP_003674057.1|1013460_1013616_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003674059.1|1013617_1014481_-	alpha/beta hydrolase	NA	NA	NA	NA	NA
WP_003674061.1|1014556_1015195_-	DUF421 domain-containing protein	NA	NA	NA	NA	NA
WP_003674063.1|1015204_1015648_-	DUF3290 family protein	NA	NA	NA	NA	NA
WP_041821675.1|1015764_1016052_+	DUF454 family protein	NA	NA	NA	NA	NA
WP_016496838.1|1016161_1017448_+|transposase	ISL3 family transposase	transposase	A0A1S5SBP9	Streptococcus_phage	31.3	7.8e-48
WP_003674065.1|1017594_1019919_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003674068.1|1020097_1020952_-	DNA/RNA non-specific endonuclease	NA	NA	NA	NA	NA
WP_016496839.1|1021061_1022453_-	amino acid permease	NA	NA	NA	NA	NA
WP_003674070.1|1022738_1023644_-	LPXTG cell wall anchor domain-containing protein	NA	NA	NA	NA	NA
WP_003674072.1|1023683_1025459_-	1-deoxy-D-xylulose-5-phosphate synthase	NA	NA	NA	NA	NA
WP_003674073.1|1025626_1026877_+	DUF2075 domain-containing protein	NA	NA	NA	NA	NA
WP_003663794.1|1026879_1027572_+	TVP38/TMEM64 family protein	NA	NA	NA	NA	NA
WP_003674075.1|1027635_1030149_-	excinuclease ABC subunit UvrA	NA	A0A1B1IVR3	uncultured_Mediterranean_phage	31.9	1.3e-131
WP_003663797.1|1030164_1030503_-	CrcB family protein	NA	A0A2H4PQR0	Staphylococcus_phage	34.2	4.2e-09
WP_003674077.1|1030495_1030873_-	CrcB family protein	NA	NA	NA	NA	NA
WP_003663799.1|1030980_1031373_+	VOC family protein	NA	NA	NA	NA	NA
WP_003674078.1|1031424_1032237_-	YdcF family protein	NA	NA	NA	NA	NA
WP_003674079.1|1032240_1033974_-	AarF/ABC1/UbiB kinase family protein	NA	C7U092	Ostreococcus_tauri_virus	26.1	5.6e-33
WP_003674080.1|1034114_1035476_+	HlyC/CorC family transporter	NA	NA	NA	NA	NA
WP_003666232.1|1035535_1035964_-	CopY/TcrY family copper transport repressor	NA	NA	NA	NA	NA
WP_003674082.1|1036118_1037507_+	DHA2 family efflux MFS transporter permease subunit	NA	NA	NA	NA	NA
WP_003674084.1|1037555_1038011_-	DUF441 domain-containing protein	NA	NA	NA	NA	NA
WP_171945887.1|1038082_1038547_-	cupin domain-containing protein	NA	NA	NA	NA	NA
WP_003674088.1|1038596_1039073_-	flavodoxin	NA	NA	NA	NA	NA
WP_003674090.1|1039115_1040000_+	LysR family transcriptional regulator	NA	Q6JIH3	Burkholderia_virus	28.9	1.5e-05
WP_003674091.1|1040045_1040936_+	aldo/keto reductase	NA	A0A2H4PQR8	Staphylococcus_phage	42.7	8.3e-57
WP_003666221.1|1041073_1041340_+	ACT domain-containing protein	NA	NA	NA	NA	NA
WP_016496842.1|1041364_1042708_+	PFL family protein	NA	NA	NA	NA	NA
WP_016496843.1|1042761_1043286_-	GNAT family N-acetyltransferase	NA	M1PSC3	Streptococcus_phage	31.6	8.8e-14
WP_016496844.1|1043445_1044291_+	alpha/beta hydrolase	NA	NA	NA	NA	NA
WP_016496845.1|1044264_1045113_-	glycosyltransferase family 8 protein	NA	NA	NA	NA	NA
WP_016496846.1|1045354_1046605_-|transposase	transposase	transposase	A0A288TXV8	Enterococcus_phage	38.1	1.2e-56
WP_016496847.1|1046679_1047129_+|transposase	IS200/IS605 family transposase	transposase	A0A0P0IQC6	Lactobacillus_phage	50.0	1.2e-30
WP_016496848.1|1047210_1047870_+	HD domain-containing protein	NA	S4W232	Pandoravirus	26.3	2.2e-06
WP_016496849.1|1048071_1048716_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016496850.1|1048712_1049591_-	DegV family protein	NA	A0A0N9SI50	Staphylococcus_phage	37.4	6.0e-15
WP_016496851.1|1049807_1051490_+	fibronectin/fibrinogen-binding protein	NA	M1I5P2	Paramecium_bursaria_Chlorella_virus	38.0	1.2e-08
WP_016496852.1|1051537_1054015_-	ATP-grasp domain-containing protein	NA	NA	NA	NA	NA
WP_016496853.1|1054011_1055097_-	carbamoyl phosphate synthase small subunit	NA	NA	NA	NA	NA
WP_016496854.1|1055173_1056085_-	RluA family pseudouridine synthase	NA	A0A2H4UV25	Bodo_saltans_virus	28.7	3.2e-11
WP_016496855.1|1056088_1056535_-	signal peptidase II	NA	NA	NA	NA	NA
WP_003667861.1|1056535_1056943_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016496856.1|1056967_1057363_+	ribonuclease HI family protein	NA	NA	NA	NA	NA
WP_016496857.1|1057545_1058700_-	class I SAM-dependent RNA methyltransferase	NA	NA	NA	NA	NA
WP_016496620.1|1059324_1060248_+|transposase	IS30 family transposase	transposase	H7BUM7	unidentified_phage	32.8	1.0e-33
WP_016496859.1|1060724_1062050_+|transposase	ISL3 family transposase	transposase	A0A1S5SBP9	Streptococcus_phage	30.7	3.6e-48
>prophage 8
NC_021494	Lactobacillus reuteri I5007, complete sequence	1947706	1157095	1165160	1947706	tRNA	Staphylococcus_phage(33.33%)	8	NA	NA
WP_003674232.1|1157095_1157938_-	DegV family protein	NA	A0A0N9SI50	Staphylococcus_phage	34.1	6.1e-17
WP_003666062.1|1158116_1158761_+	hemolysin III family protein	NA	NA	NA	NA	NA
WP_003674233.1|1158749_1159238_-	dihydrofolate reductase	NA	A0A1B2IBQ4	Erwinia_phage	40.8	7.4e-23
WP_016496906.1|1159253_1160216_-	thymidylate synthase	NA	A0A0N9SH48	Staphylococcus_phage	60.9	5.6e-115
WP_016496907.1|1160234_1162145_-	ABC-F family ATP-binding cassette domain-containing protein	NA	A0A2K9L3Z8	Tupanvirus	30.4	1.8e-56
WP_016496908.1|1162146_1163358_-|tRNA	CCA tRNA nucleotidyltransferase	tRNA	H7BUW3	unidentified_phage	49.5	9.0e-46
WP_003674239.1|1163483_1164749_-	tetratricopeptide repeat protein	NA	NA	NA	NA	NA
WP_003666054.1|1164884_1165160_-	HU family DNA-binding protein	NA	A0A0H3UZA0	Geobacillus_virus	68.5	2.6e-25
>prophage 9
NC_021494	Lactobacillus reuteri I5007, complete sequence	1947706	1210407	1276910	1947706	transposase,protease,tRNA	Streptococcus_phage(11.11%)	60	NA	NA
WP_003665822.1|1210407_1210845_-|tRNA	D-tyrosyl-tRNA(Tyr) deacylase	tRNA	NA	NA	NA	NA
WP_016496925.1|1210855_1213093_-	bifunctional (p)ppGpp synthetase/guanosine-3',5'-bis(diphosphate) 3'-pyrophosphohydrolase	NA	J9Q7H7	Salmonella_phage	32.1	1.8e-07
WP_003674298.1|1213111_1213447_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016496926.1|1213525_1214266_-	16S rRNA (uracil(1498)-N(3))-methyltransferase	NA	NA	NA	NA	NA
WP_016496927.1|1214266_1215226_-	50S ribosomal protein L11 methyltransferase	NA	NA	NA	NA	NA
WP_016496928.1|1215303_1215609_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003668154.1|1215805_1215985_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003674305.1|1216092_1217052_+	L-lactate dehydrogenase	NA	NA	NA	NA	NA
WP_003674306.1|1217135_1217312_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003674308.1|1217387_1218464_-	Ldh family oxidoreductase	NA	NA	NA	NA	NA
WP_016496929.1|1218536_1219952_-	C69 family dipeptidase	NA	NA	NA	NA	NA
WP_003665812.1|1220445_1222281_-	elongation factor 4	NA	E4ZFJ7	Streptococcus_phage	25.9	2.5e-23
WP_003665811.1|1222411_1223563_-	molecular chaperone DnaJ	NA	E3T4P7	Cafeteria_roenbergensis_virus	32.4	2.3e-30
WP_003674311.1|1223691_1225557_-	molecular chaperone DnaK	NA	A0A2P1EIW2	Megavirus	46.6	1.1e-135
WP_003674313.1|1225581_1226154_-	nucleotide exchange factor GrpE	NA	NA	NA	NA	NA
WP_003674314.1|1226166_1227219_-	heat-inducible transcriptional repressor HrcA	NA	NA	NA	NA	NA
WP_003674316.1|1227339_1227711_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016496411.1|1228072_1228996_-|transposase	IS30 family transposase	transposase	H7BUM7	unidentified_phage	31.7	5.1e-33
WP_016496932.1|1230482_1231430_-	riboflavin biosynthesis protein RibF	NA	NA	NA	NA	NA
WP_003674319.1|1231442_1232348_-|tRNA	tRNA pseudouridine(55) synthase TruB	tRNA	NA	NA	NA	NA
WP_003665800.1|1232541_1232901_-	30S ribosome-binding factor RbfA	NA	NA	NA	NA	NA
WP_003674321.1|1232920_1235179_-	translation initiation factor IF-2	NA	A0A2H4UTS4	Bodo_saltans_virus	24.8	3.9e-18
WP_003665798.1|1235192_1235504_-	ribosomal L7Ae/L30e/S12e/Gadd45 family protein	NA	NA	NA	NA	NA
WP_003668183.1|1235490_1235793_-	YlxR family protein	NA	NA	NA	NA	NA
WP_003674322.1|1235821_1237009_-	transcription termination/antitermination protein NusA	NA	NA	NA	NA	NA
WP_003674323.1|1237029_1237503_-	ribosome maturation factor RimP	NA	NA	NA	NA	NA
WP_003674324.1|1237636_1241968_-	PolC-type DNA polymerase III	NA	Q8W6C3	Saccharomonospora_phage	23.4	1.6e-28
WP_003674325.1|1242043_1243777_-|tRNA	proline--tRNA ligase	tRNA	A0A2K9L6B6	Tupanvirus	22.0	1.1e-07
WP_003674327.1|1243806_1245081_-|protease	RIP metalloprotease RseP	protease	NA	NA	NA	NA
WP_016496933.1|1245103_1245889_-	phosphatidate cytidylyltransferase	NA	NA	NA	NA	NA
WP_041821870.1|1245908_1246688_-	isoprenyl transferase	NA	R9W0U9	Flavobacterium_phage	42.5	5.8e-22
WP_003666863.1|1246895_1247459_-	ribosome recycling factor	NA	NA	NA	NA	NA
WP_003666862.1|1247463_1248186_-	UMP kinase	NA	NA	NA	NA	NA
WP_003666861.1|1248267_1249143_-	elongation factor Ts	NA	NA	NA	NA	NA
WP_003666860.1|1249241_1250030_-	30S ribosomal protein S2	NA	NA	NA	NA	NA
WP_003674330.1|1250192_1251185_-	D-2-hydroxyacid dehydrogenase	NA	M1I4S0	Paramecium_bursaria_Chlorella_virus	31.6	2.7e-40
WP_003668197.1|1251186_1251477_-	GIY-YIG nuclease family protein	NA	NA	NA	NA	NA
WP_003674331.1|1251466_1252222_-|tRNA	tRNA1(Val) (adenine(37)-N6)-methyltransferase	tRNA	NA	NA	NA	NA
WP_041821721.1|1252316_1252955_+	1-acyl-sn-glycerol-3-phosphate acyltransferase	NA	NA	NA	NA	NA
WP_003666855.1|1252998_1253226_-	YneF family protein	NA	NA	NA	NA	NA
WP_003674333.1|1253299_1253551_-	DUF896 domain-containing protein	NA	NA	NA	NA	NA
WP_003674334.1|1253679_1254306_+	transcriptional repressor LexA	NA	A0A1B2APZ1	Phage_Wrath	50.7	4.3e-15
WP_003674335.1|1254349_1255507_-	hydroxymethylglutaryl-CoA synthase	NA	NA	NA	NA	NA
WP_003674336.1|1255532_1256201_-	viroplasmin family protein	NA	C1KFJ1	Lactobacillus_virus	33.9	3.5e-31
WP_003674337.1|1256567_1257182_-	DUF308 domain-containing protein	NA	NA	NA	NA	NA
WP_003674338.1|1257293_1257812_-	adenine phosphoribosyltransferase	NA	A0A1X9I6E2	Streptococcus_phage	32.1	9.9e-10
WP_003674340.1|1257828_1260156_-	single-stranded-DNA-specific exonuclease RecJ	NA	A7KV88	Bacillus_phage	32.2	3.2e-76
WP_003674342.1|1260289_1261123_-	SDR family oxidoreductase	NA	NA	NA	NA	NA
WP_003674343.1|1261139_1262069_-	ribonuclease Z	NA	NA	NA	NA	NA
WP_003674345.1|1262101_1263418_-	GTPase ObgE	NA	NA	NA	NA	NA
WP_003674347.1|1263483_1265295_-	excinuclease ABC subunit UvrC	NA	NA	NA	NA	NA
WP_016496936.1|1265438_1265576_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003674350.1|1265779_1266079_-	nucleoside triphosphate pyrophosphohydrolase family protein	NA	A0A1S7FYY8	Listeria_phage	49.0	5.0e-22
WP_003668240.1|1266080_1266671_-	YihA family ribosome biogenesis GTP-binding protein	NA	NA	NA	NA	NA
WP_003674352.1|1266688_1267939_-|protease	ATP-dependent Clp protease ATP-binding subunit ClpX	protease	G3M9Z9	Bacillus_virus	59.2	1.4e-137
WP_016496937.1|1268116_1269427_-	trigger factor	NA	NA	NA	NA	NA
WP_013924000.1|1270401_1271820_+|transposase	ISLre2-like element ISLre2 family transposase	transposase	NA	NA	NA	NA
WP_016496423.1|1273341_1274310_+|transposase	IS30 family transposase	transposase	NA	NA	NA	NA
WP_003671670.1|1275309_1276068_+	ATP-binding protein	NA	A0A059NT77	Lactococcus_phage	48.2	1.9e-62
WP_041821884.1|1276133_1276910_+|transposase	IS30 family transposase	transposase	H7BUM7	unidentified_phage	37.1	5.6e-33
>prophage 10
NC_021494	Lactobacillus reuteri I5007, complete sequence	1947706	1521404	1611248	1947706	terminase,head,protease,tRNA,portal,transposase,integrase,tail,holin,capsid	Streptococcus_phage(25.93%)	84	1527890:1527949	1577454:1577534
WP_003676182.1|1521404_1521986_+|protease	matrixin family metalloprotease	protease	NA	NA	NA	NA
WP_016497024.1|1522069_1522972_+	EamA family transporter	NA	NA	NA	NA	NA
WP_003676187.1|1523154_1524087_-	carbamate kinase	NA	NA	NA	NA	NA
WP_003666512.1|1524103_1525111_-	ornithine carbamoyltransferase	NA	NA	NA	NA	NA
WP_003676189.1|1525364_1526204_+	DNA-binding domain-containing protein	NA	NA	NA	NA	NA
WP_016497025.1|1526316_1527825_-	xylulokinase	NA	NA	NA	NA	NA
1527890:1527949	attL	TGGCTCTACGTCAAGTAGTGTTGATACGCAGATATGAATCATCGCCAATTAAATTGGTCT	NA	NA	NA	NA
WP_003676211.1|1529421_1530780_-	glucose-6-phosphate isomerase	NA	NA	NA	NA	NA
WP_016497028.1|1530960_1531575_+	sugar O-acetyltransferase	NA	NA	NA	NA	NA
WP_003676215.1|1531642_1532503_-	sugar transporter	NA	NA	NA	NA	NA
WP_016497029.1|1532671_1534159_-	HAMP domain-containing histidine kinase	NA	W8CYF6	Bacillus_phage	32.9	5.2e-35
WP_003676219.1|1534158_1534878_-	response regulator transcription factor	NA	NA	NA	NA	NA
WP_016497030.1|1535120_1536236_-|integrase	site-specific integrase	integrase	A0A2P0ZL94	Lactobacillus_phage	31.5	5.8e-39
WP_016497031.1|1536564_1537197_-	helix-turn-helix transcriptional regulator	NA	A0A1W6JQE6	Staphylococcus_phage	38.1	4.2e-10
WP_016497032.1|1537368_1537638_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_016497033.1|1537744_1537930_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016497034.1|1538040_1538391_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016497035.1|1538435_1538945_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016497036.1|1538948_1540523_+	prophage P3 protein 8, DNA primase/helicase	NA	A0A1P8VVM0	Streptococcus_phage	34.8	2.0e-69
WP_016497037.1|1540642_1540894_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016497038.1|1540896_1541061_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016497039.1|1541060_1541411_+|head	phage head closure protein	head	A0A0M7RFE1	Lactobacillus_phage	40.8	3.4e-06
WP_041821741.1|1541458_1541893_+	HNH endonuclease	NA	A0A2H4J3B4	uncultured_Caudovirales_phage	40.6	5.4e-17
WP_016497040.1|1542428_1542917_+|terminase	phage terminase small subunit P27 family	terminase	A0A0D4DCN9	Staphylococcus_phage	33.6	5.8e-12
WP_016497041.1|1542913_1544614_+|terminase	terminase large subunit	terminase	E9LUI0	Lactobacillus_phage	41.4	1.1e-116
WP_016497042.1|1544633_1545767_+|portal	phage portal protein	portal	A0A2H4JA65	uncultured_Caudovirales_phage	37.0	1.3e-54
WP_041821921.1|1545738_1547301_+|capsid	phage major capsid protein	capsid	B8R651	Lactobacillus_phage	27.2	7.3e-48
WP_016497044.1|1547636_1547933_+|head,tail	phage gp6-like head-tail connector protein	head,tail	NA	NA	NA	NA
WP_016497045.1|1548260_1548665_+	prophage protein 20	NA	NA	NA	NA	NA
WP_003668074.1|1548776_1549745_-|transposase	IS30 family transposase	transposase	NA	NA	NA	NA
WP_003666472.1|1550473_1551085_-	LysM peptidoglycan-binding domain-containing protein	NA	A0A288TY55	Enterococcus_phage	53.6	6.6e-29
WP_003666471.1|1551407_1552214_-	Cof-type HAD-IIB family hydrolase	NA	NA	NA	NA	NA
WP_003666470.1|1552206_1552674_-	MarR family transcriptional regulator	NA	NA	NA	NA	NA
WP_016497046.1|1552684_1554550_-	acetyltransferase	NA	NA	NA	NA	NA
WP_003666468.1|1554611_1554923_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016496423.1|1555151_1556120_-|transposase	IS30 family transposase	transposase	NA	NA	NA	NA
WP_016497047.1|1556262_1558083_-	glutamine--fructose-6-phosphate transaminase (isomerizing)	NA	Q76DQ7	Chlorella_virus	36.8	1.1e-90
WP_003676226.1|1558291_1559647_-	phosphoglucosamine mutase	NA	A0A127AWJ1	Bacillus_phage	23.5	2.3e-18
WP_003676227.1|1559674_1560568_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003667494.1|1560551_1561415_-	TIGR00159 family protein	NA	NA	NA	NA	NA
WP_016497049.1|1561561_1562917_-	L-fucose:H+ symporter permease	NA	NA	NA	NA	NA
WP_003676229.1|1562936_1563332_-	D-ribose pyranase	NA	NA	NA	NA	NA
WP_016497050.1|1563343_1564267_-	ribokinase	NA	NA	NA	NA	NA
WP_016497051.1|1564598_1565495_-	UDP-N-acetylmuramate dehydrogenase	NA	NA	NA	NA	NA
WP_003667489.1|1565619_1566159_+	3'-5' exonuclease	NA	A0A1S5SFA9	Streptococcus_phage	40.9	1.9e-24
WP_003676235.1|1566170_1566593_+	PAS domain-containing protein	NA	NA	NA	NA	NA
WP_003676236.1|1566625_1567135_-	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_003676239.1|1567134_1567593_-|tRNA	tRNA (adenosine(37)-N6)-threonylcarbamoyltransferase complex ATPase subunit type 1 TsaE	tRNA	NA	NA	NA	NA
WP_016497052.1|1567712_1568687_-	phosphate acetyltransferase	NA	NA	NA	NA	NA
WP_003676241.1|1568747_1569437_-	uracil-DNA glycosylase	NA	A0A0B5IW78	Pandoravirus	44.3	2.2e-44
WP_003667483.1|1569587_1570172_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003666449.1|1570228_1570702_-	SsrA-binding protein SmpB	NA	W5RAM5	Staphylococcus_phage	54.8	4.0e-42
WP_003676243.1|1570719_1573125_-	ribonuclease R	NA	Q0GXV6	Lactococcus_phage	38.3	7.7e-89
WP_003676244.1|1573111_1573888_-	alpha/beta fold hydrolase	NA	NA	NA	NA	NA
WP_003667480.1|1573966_1574206_-	preprotein translocase subunit SecG	NA	NA	NA	NA	NA
WP_003676246.1|1574272_1575823_-	ClC family H(+)/Cl(-) exchange transporter	NA	NA	NA	NA	NA
WP_003666444.1|1575940_1577323_-	amino acid permease	NA	NA	NA	NA	NA
WP_016497053.1|1577543_1578830_-|transposase	ISL3 family transposase	transposase	A0A1S5SBP9	Streptococcus_phage	31.1	3.9e-47
1577454:1577534	attR	TGGCTCTACGTCAAGTAGTGTTGATACGCAGATATGAATCATCGCCAATTAAATTGGTCTAGTTAGAACTGTCATTCGTGA	NA	NA	NA	NA
WP_003666443.1|1579039_1580362_-	phosphopyruvate hydratase	NA	A0A1X9I5Z8	Streptococcus_phage	69.9	8.9e-172
WP_003667474.1|1580452_1581202_-	triose-phosphate isomerase	NA	NA	NA	NA	NA
WP_003666439.1|1581317_1582523_-	phosphoglycerate kinase	NA	NA	NA	NA	NA
WP_003666436.1|1582613_1583621_-	type I glyceraldehyde-3-phosphate dehydrogenase	NA	NA	NA	NA	NA
WP_003666435.1|1584123_1584717_-	ATP-dependent Clp endopeptidase proteolytic subunit ClpP	NA	A0A223W000	Agrobacterium_phage	54.3	8.0e-56
WP_016497054.1|1584909_1586265_-	MFS transporter	NA	NA	NA	NA	NA
WP_003676247.1|1587175_1588117_-	DNA-binding protein WhiA	NA	Q7AWZ3	Streptococcus_phage	38.1	1.6e-50
WP_003676248.1|1588135_1589122_-	uridine diphosphate-N-acetylglucosamine-binding protein YvcK	NA	A1IMD5	Streptococcus_phage	54.2	5.5e-94
WP_035162073.1|1589137_1590031_-	RNase adapter RapZ	NA	A0A0R8VB27	Thermobifida_phage	29.4	2.0e-10
WP_003676250.1|1590117_1591449_-	amino acid permease	NA	NA	NA	NA	NA
WP_003676251.1|1591717_1594582_-	excinuclease ABC subunit UvrA	NA	A0A1B1IVR3	uncultured_Mediterranean_phage	56.1	1.1e-310
WP_016497056.1|1594597_1596613_-	excinuclease ABC subunit UvrB	NA	NA	NA	NA	NA
WP_003666419.1|1596834_1597107_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003666416.1|1597212_1597851_-	HD domain-containing protein	NA	NA	NA	NA	NA
WP_016497057.1|1598015_1599740_-	phospho-sugar mutase	NA	A0A1X9I671	Streptococcus_phage	59.8	6.5e-199
WP_003676255.1|1599829_1600336_-	acyl-CoA thioesterase	NA	NA	NA	NA	NA
WP_003676256.1|1600381_1601263_-	amino acid ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_003676257.1|1601521_1602691_-	ArgE/DapE family deacylase	NA	NA	NA	NA	NA
WP_016497058.1|1602784_1603717_-	thioredoxin-disulfide reductase	NA	G3MA85	Bacillus_virus	52.1	9.0e-86
WP_016497059.1|1603976_1604780_+	(Fe-S)-binding protein	NA	NA	NA	NA	NA
WP_003676262.1|1604780_1606268_+	iron-sulfur cluster-binding protein	NA	NA	NA	NA	NA
WP_016497060.1|1606260_1606995_+	lactate utilization protein C	NA	NA	NA	NA	NA
WP_003676267.1|1607065_1607980_-	UTP--glucose-1-phosphate uridylyltransferase GalU	NA	A0A127AW70	Bacillus_phage	46.4	4.4e-69
WP_003666397.1|1608044_1609061_-	NAD(P)H-dependent glycerol-3-phosphate dehydrogenase	NA	NA	NA	NA	NA
WP_003676269.1|1609086_1609914_-	prolipoprotein diacylglyceryl transferase	NA	NA	NA	NA	NA
WP_016497061.1|1609914_1610877_-	HPr kinase/phosphorylase	NA	NA	NA	NA	NA
WP_003670462.1|1610891_1611248_-|holin	phage holin family protein	holin	NA	NA	NA	NA
>prophage 11
NC_021494	Lactobacillus reuteri I5007, complete sequence	1947706	1632600	1640374	1947706	tRNA	Streptococcus_phage(50.0%)	8	NA	NA
WP_080637870.1|1632600_1633401_-	carbon-nitrogen family hydrolase	NA	M1H2P4	Paramecium_bursaria_Chlorella_virus	24.3	6.2e-11
WP_016497070.1|1633977_1634766_+	glutamate 5-kinase	NA	A0A1X9I5D0	Streptococcus_phage	36.9	2.6e-38
WP_016497071.1|1634777_1636022_+	glutamate-5-semialdehyde dehydrogenase	NA	A0A1X9I5D4	Streptococcus_phage	51.3	2.3e-105
WP_016497072.1|1636039_1636813_+	pyrroline-5-carboxylate reductase	NA	A0A1X9I6T5	Streptococcus_phage	37.3	1.6e-32
WP_016497073.1|1636919_1637951_-|tRNA	tRNA (adenosine(37)-N6)-threonylcarbamoyltransferase complex transferase subunit TsaD	tRNA	A0A0R6PI74	Moraxella_phage	39.3	5.9e-62
WP_003666354.1|1637969_1638524_-	ribosomal protein S18-alanine N-acetyltransferase	NA	NA	NA	NA	NA
WP_016497075.1|1638507_1639233_-|tRNA	tRNA (adenosine(37)-N6)-threonylcarbamoyltransferase complex dimerization subunit type 1 TsaB	tRNA	NA	NA	NA	NA
WP_016497076.1|1639378_1640374_-	UDP-glucose 4-epimerase GalE	NA	A0A1V0SG19	Hokovirus	36.2	5.7e-46
>prophage 12
NC_021494	Lactobacillus reuteri I5007, complete sequence	1947706	1672308	1736638	1947706	transposase,protease,tRNA	Bacillus_virus(11.76%)	47	NA	NA
WP_003675935.1|1672308_1673721_-|tRNA	cysteine--tRNA ligase	tRNA	M1PG92	Moumouvirus	30.9	8.9e-53
WP_003675937.1|1674094_1675246_-	PIN/TRAM domain-containing protein	NA	NA	NA	NA	NA
WP_003675938.1|1675264_1676638_-	DNA repair protein RadA	NA	NA	NA	NA	NA
WP_003675940.1|1676663_1677200_-	hypothetical protein	NA	J9PV85	Bacillus_phage	49.1	2.8e-39
WP_003675942.1|1677338_1677635_+	N-acetyltransferase	NA	NA	NA	NA	NA
WP_003666281.1|1677646_1678330_+	ribose-5-phosphate isomerase RpiA	NA	NA	NA	NA	NA
WP_016497087.1|1678358_1679699_+	C1 family peptidase	NA	R4TV59	Phaeocystis_globosa_virus	32.8	1.4e-71
WP_003675946.1|1679806_1680598_-	extracellular solute-binding protein	NA	NA	NA	NA	NA
WP_003675947.1|1680613_1681363_-	amino acid ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	36.5	1.6e-24
WP_003675949.1|1681368_1682070_-	amino acid ABC transporter permease	NA	NA	NA	NA	NA
WP_016497088.1|1682096_1683239_-	PLP-dependent transferase	NA	A0A0B5JD48	Pandoravirus	26.4	1.8e-19
WP_016497089.1|1683516_1684383_-	alpha/beta hydrolase	NA	NA	NA	NA	NA
WP_003667318.1|1684357_1685107_-	2,3-bisphosphoglycerate-dependent phosphoglycerate mutase	NA	NA	NA	NA	NA
WP_003675955.1|1685237_1687007_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016497090.1|1687104_1688064_-	beta-galactosidase small subunit	NA	NA	NA	NA	NA
WP_003675959.1|1688047_1689934_-	beta-galactosidase	NA	L0N6M2	Herpes_simplex_virus	33.5	3.4e-92
WP_003675961.1|1690237_1690690_-	SprT family protein	NA	NA	NA	NA	NA
WP_016497091.1|1690682_1692860_-	RNA-binding transcriptional accessory protein	NA	NA	NA	NA	NA
WP_016497092.1|1692931_1693759_-	ammonia-dependent NAD(+) synthetase	NA	G3MA24	Bacillus_virus	54.7	4.7e-78
WP_016497093.1|1693771_1695238_-	nicotinate phosphoribosyltransferase	NA	G3MA18	Bacillus_virus	45.0	7.4e-111
WP_003666262.1|1695299_1696001_-	GntR family transcriptional regulator	NA	NA	NA	NA	NA
WP_003666260.1|1696155_1696875_-	amino acid racemase	NA	NA	NA	NA	NA
WP_041821766.1|1696908_1698558_-	aspartate:alanine antiporter	NA	NA	NA	NA	NA
WP_003675971.1|1698648_1700049_-	MFS transporter	NA	NA	NA	NA	NA
WP_016497095.1|1700166_1700811_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003675973.1|1701169_1702000_-	metallophosphoesterase	NA	NA	NA	NA	NA
WP_016497096.1|1702059_1703559_-	peptide MFS transporter	NA	A0A0P0IY73	Acinetobacter_phage	34.1	1.2e-68
WP_172381020.1|1703771_1704473_-	DUF3642 domain-containing protein	NA	NA	NA	NA	NA
WP_035162004.1|1706152_1706482_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016497100.1|1706594_1706963_+	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_003675988.1|1707252_1707753_-	thiol peroxidase	NA	NA	NA	NA	NA
WP_003675989.1|1708163_1709345_+|transposase	IS66 family transposase	transposase	A0A218MNE7	uncultured_virus	26.6	2.9e-25
WP_003674676.1|1715382_1716795_+	aryl-sulfate sulfotransferase	NA	NA	NA	NA	NA
WP_003676198.1|1717199_1717937_-	ATP-binding protein	NA	A0A059NT77	Lactococcus_phage	45.8	3.0e-52
WP_016496790.1|1717938_1719162_-|transposase	IS21 family transposase	transposase	A0A059NT83	Lactococcus_phage	44.7	3.0e-89
WP_016497102.1|1719590_1720769_-|transposase	IS66 family transposase	transposase	NA	NA	NA	NA
WP_016497103.1|1720876_1722055_+|transposase	IS256 family transposase	transposase	A0A220NQR7	Corynebacterium_phage	26.1	2.9e-33
WP_016497106.1|1722551_1722908_-	IS66 family insertion sequence element accessory protein TnpB	NA	S5WJH4	Leptospira_phage	47.7	5.6e-12
WP_016497107.1|1722897_1723086_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016497108.1|1723323_1727112_-	YSIRK-type signal peptide-containing protein	NA	NA	NA	NA	NA
WP_016497110.1|1727753_1728713_-	beta-galactosidase small subunit	NA	NA	NA	NA	NA
WP_155258986.1|1728994_1729261_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016497113.1|1729335_1730466_-|transposase	IS30 family transposase	transposase	H7BUM7	unidentified_phage	32.1	3.2e-37
WP_016497114.1|1730868_1732395_-|tRNA	lysine--tRNA ligase	tRNA	A0A2K9KZX5	Tupanvirus	41.9	3.4e-90
WP_003674674.1|1732415_1733417_-|tRNA	tRNA dihydrouridine synthase DusB	tRNA	NA	NA	NA	NA
WP_003674673.1|1733524_1734445_-	Hsp33 family molecular chaperone HslO	NA	NA	NA	NA	NA
WP_016497115.1|1734535_1736638_-|protease	ATP-dependent zinc metalloprotease FtsH	protease	H8ZJI5	Ostreococcus_tauri_virus	48.4	4.6e-106
>prophage 13
NC_021494	Lactobacillus reuteri I5007, complete sequence	1947706	1792839	1853011	1947706	transposase,integrase,protease,tRNA	unidentified_phage(25.0%)	53	1842488:1842504	1853401:1853417
WP_003674580.1|1792839_1794867_-|tRNA	methionine--tRNA ligase	tRNA	A0A1V0SHR2	Klosneuvirus	36.2	1.0e-89
WP_003674578.1|1794944_1795793_-	DUF72 domain-containing protein	NA	A0A1V0CNL1	Kaumoebavirus	31.1	2.5e-10
WP_016497131.1|1796242_1796941_-	NAD-dependent protein deacylase	NA	NA	NA	NA	NA
WP_003674570.1|1796946_1797906_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016497132.1|1797898_1799161_-	hydroxymethylglutaryl-CoA reductase, degradative	NA	NA	NA	NA	NA
WP_003667177.1|1799153_1800095_-	Ppx/GppA family phosphatase	NA	NA	NA	NA	NA
WP_016497133.1|1800238_1801261_-|tRNA	tryptophan--tRNA ligase	tRNA	NA	NA	NA	NA
WP_016497134.1|1801538_1802498_+	site-specific DNA-methyltransferase	NA	A0A1W6JJW1	Lactococcus_phage	28.1	2.2e-18
WP_016497135.1|1802548_1802992_-	nucleoside-diphosphate kinase	NA	D2E8E1	Anguillid_herpesvirus	44.4	8.4e-26
WP_016497136.1|1803079_1805398_-	AAA family ATPase	NA	NA	NA	NA	NA
WP_016497137.1|1805410_1806580_-	cation:proton antiporter	NA	NA	NA	NA	NA
WP_016497138.1|1806862_1808224_-	aspartate aminotransferase family protein	NA	NA	NA	NA	NA
WP_016497139.1|1808186_1809659_-	amino acid permease	NA	NA	NA	NA	NA
WP_016497140.1|1809956_1810598_+	endonuclease III	NA	NA	NA	NA	NA
WP_016497141.1|1810609_1810900_+	FMN-binding protein	NA	NA	NA	NA	NA
WP_016497142.1|1810987_1812184_-	tetracycline resistance MFS efflux pump	NA	A0A2H4UVM2	Bodo_saltans_virus	20.2	1.2e-05
WP_016497143.1|1812566_1813490_-|transposase	IS30 family transposase	transposase	H7BUM7	unidentified_phage	31.7	6.7e-33
WP_016497145.1|1814653_1815619_+|transposase	IS30 family transposase	transposase	H7BW47	unidentified_phage	30.7	1.9e-14
WP_003674547.1|1815986_1816919_-	L-lactate dehydrogenase	NA	NA	NA	NA	NA
WP_003671339.1|1817441_1818293_+	MetQ/NlpA family ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_016497147.1|1818305_1819370_+	methionine ABC transporter ATP-binding protein	NA	W6JKT0	Anomala_cuprea_entomopoxvirus	27.5	7.7e-17
WP_003665503.1|1819362_1820052_+	ABC transporter permease	NA	NA	NA	NA	NA
WP_016497148.1|1820070_1821216_+	ArgE/DapE family deacylase	NA	NA	NA	NA	NA
WP_016497149.1|1821674_1823012_+	ClC family H(+)/Cl(-) exchange transporter	NA	NA	NA	NA	NA
WP_003674537.1|1823163_1823592_-	peptide-methionine (R)-S-oxide reductase MsrB	NA	NA	NA	NA	NA
WP_003674534.1|1823663_1824302_-	ABC transporter permease	NA	NA	NA	NA	NA
WP_003674533.1|1824294_1825065_-	ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	38.0	4.3e-25
WP_003674531.1|1825039_1825705_-	ABC transporter permease	NA	NA	NA	NA	NA
WP_003674529.1|1825771_1826671_-	glycine/betaine ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_016497150.1|1826820_1827276_+	Rrf2 family transcriptional regulator	NA	NA	NA	NA	NA
WP_016497151.1|1827278_1828133_+	NAD(P)H-binding protein	NA	NA	NA	NA	NA
WP_003674522.1|1828348_1829539_-	phosphopentomutase	NA	NA	NA	NA	NA
WP_003674520.1|1829642_1831451_+	cadmium-translocating P-type ATPase	NA	E4ZFI9	Streptococcus_phage	29.9	1.3e-69
WP_016497152.1|1831908_1832643_-|protease	matrixin family metalloprotease	protease	NA	NA	NA	NA
WP_003674515.1|1832718_1833423_-	hypothetical protein	NA	NA	NA	NA	NA
WP_080637876.1|1833532_1833865_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016497154.1|1833916_1834840_+|transposase	IS30 family transposase	transposase	H7BVY4	unidentified_phage	31.3	5.1e-33
WP_016497155.1|1835198_1836554_+	FAD-dependent oxidoreductase	NA	A0A2K5B2C5	Erysipelothrix_phage	52.3	7.6e-126
WP_003667137.1|1836680_1836968_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016497156.1|1837029_1839879_-	DEAD/DEAH box helicase	NA	Q9T1H9	Lactobacillus_phage	27.9	1.1e-25
WP_003674507.1|1839899_1840400_-	phosphatase PAP2 family protein	NA	NA	NA	NA	NA
WP_016497157.1|1840399_1841353_-	aldo/keto reductase	NA	NA	NA	NA	NA
WP_003665466.1|1841628_1842399_-	triose-phosphate isomerase	NA	NA	NA	NA	NA
1842488:1842504	attL	TGCTATCCTAAAGTTAA	NA	NA	NA	NA
WP_016497158.1|1842530_1842932_+	phosphate-starvation-inducible protein PsiE	NA	NA	NA	NA	NA
WP_016497159.1|1842943_1843486_+	serine hydrolase family protein	NA	NA	NA	NA	NA
WP_003674500.1|1845459_1846878_+	sodium:proton antiporter	NA	NA	NA	NA	NA
WP_003674499.1|1847023_1847257_+	cytochrome b5	NA	NA	NA	NA	NA
WP_003674496.1|1847322_1847973_-	NAD(P)H-binding protein	NA	NA	NA	NA	NA
WP_003674494.1|1848051_1848279_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003674492.1|1848386_1849127_+	SDR family oxidoreductase	NA	W8CYX9	Bacillus_phage	38.2	6.0e-08
WP_016497162.1|1849290_1850613_-	MHS family MFS transporter	NA	Q6JIH2	Burkholderia_virus	31.9	1.5e-38
WP_003674489.1|1851334_1851904_-|integrase	site-specific integrase	integrase	NA	NA	NA	NA
WP_016497163.1|1852045_1853011_+|transposase	IS30 family transposase	transposase	H7BW47	unidentified_phage	30.3	7.3e-14
1853401:1853417	attR	TGCTATCCTAAAGTTAA	NA	NA	NA	NA
>prophage 1
NC_021495	Lactobacillus reuteri I5007 plasmid pLRI03, complete sequence	15577	563	7203	15577	transposase	Staphylococcus_phage(28.57%)	9	NA	NA
WP_172635290.1|563_1475_-|transposase	IS3 family transposase	transposase	Q716C2	Shigella_phage	28.2	5.2e-14
WP_016497321.1|1411_2125_-	helix-turn-helix domain-containing protein	NA	A0A0C5AJ29	Paenibacillus_phage	38.8	1.1e-30
WP_016497322.1|2685_3264_+	recombinase family protein	NA	A0A1J1J8Z4	Escherichia_phage	33.3	1.8e-23
WP_155258994.1|3396_3942_+	recombinase family protein	NA	A0A0A8WIK3	Clostridium_phage	29.1	1.3e-07
WP_007124974.1|4308_4926_+	CadD family cadmium resistance transporter	NA	NA	NA	NA	NA
WP_003672749.1|4942_5293_+	helix-turn-helix transcriptional regulator	NA	E4ZFI8	Streptococcus_phage	34.0	7.9e-11
WP_003669793.1|5396_5798_-	arsenate reductase (thioredoxin)	NA	A0A2H4PQT9	Staphylococcus_phage	49.6	1.8e-27
WP_016497324.1|5800_6835_-	ACR3 family arsenite efflux transporter	NA	NA	NA	NA	NA
WP_016497325.1|6891_7203_-	winged helix-turn-helix transcriptional regulator	NA	A0A2H4PQT4	Staphylococcus_phage	50.0	2.6e-21
>prophage 1
NC_021496	Lactobacillus reuteri I5007 plasmid pLRI02, complete sequence	40038	2553	39932	40038	integrase,protease,head,portal,terminase,tail,capsid	Lactobacillus_phage(63.33%)	48	NA	NA
WP_016497205.1|2553_2805_-	hypothetical protein	NA	A0A2K9VC51	Lactobacillus_phage	49.4	5.3e-17
WP_016497206.1|2804_2993_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016497207.1|2989_3301_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016497208.1|3287_3626_-	VRR-NUC domain-containing protein	NA	A0A0A1ENT6	Lactobacillus_phage	84.7	8.9e-52
WP_155258997.1|3625_3820_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003717912.1|3823_4252_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016497210.1|4568_5870_-	virulence-associated E family protein	NA	A0A0A1EL11	Lactobacillus_phage	51.1	8.3e-106
WP_016497211.1|5853_6645_-	bifunctional DNA primase/polymerase	NA	U3PBE3	Lactobacillus_phage	54.9	1.5e-70
WP_016497212.1|6665_7238_-	hypothetical protein	NA	A0A2P0ZLB9	Lactobacillus_phage	37.6	1.2e-27
WP_016497213.1|7256_7952_-	AAA family ATPase	NA	U3PIS9	Lactobacillus_phage	62.8	4.6e-79
WP_016497214.1|7945_9346_-	DEAD/DEAH box helicase	NA	U3PFS7	Lactobacillus_phage	57.7	6.8e-146
WP_016497215.1|9349_9610_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016497216.1|9633_9903_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_016497217.1|9913_10402_-	siphovirus Gp157 family protein	NA	A0A2P0ZLB3	Lactobacillus_phage	41.4	4.0e-29
WP_016497218.1|10398_10590_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016497219.1|10579_10768_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016497220.1|10771_10948_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016497221.1|11087_11327_-	hypothetical protein	NA	Q9T1I6	Lactobacillus_phage	43.1	3.4e-05
WP_016497222.1|11333_11537_-	helix-turn-helix transcriptional regulator	NA	A0A1S5SDM7	Streptococcus_phage	53.4	8.6e-10
WP_016497223.1|11783_12209_+	helix-turn-helix transcriptional regulator	NA	Q5YAA4	Bacillus_phage	48.6	4.7e-26
WP_016497224.1|12222_12669_+	ImmA/IrrE family metallo-endopeptidase	NA	Q5YAA5	Bacillus_phage	27.3	6.1e-08
WP_016497225.1|12719_13256_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016497226.1|13416_14529_+|integrase	site-specific integrase	integrase	A0A1S5S8R9	Streptococcus_phage	35.3	3.7e-54
WP_016497227.1|15106_16549_-	glycosyl hydrolase family 25	NA	Q6SE63	Lactobacillus_prophage	40.3	4.8e-30
WP_155258999.1|16541_16925_-	hypothetical protein	NA	A0A0A1ELI5	Lactobacillus_phage	52.2	4.1e-21
WP_016497229.1|16917_17187_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016497230.1|17201_17672_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016497231.1|17685_17871_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016497232.1|17882_18350_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016497233.1|18362_18614_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016497234.1|18627_18798_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016497235.1|18846_22635_-	hypothetical protein	NA	Q6SE68	Lactobacillus_prophage	24.8	7.4e-46
WP_155259000.1|22636_24511_-|tail	phage tail protein	tail	E9LUJ4	Lactobacillus_phage	37.7	1.2e-33
WP_041822076.1|25315_26170_-|tail	phage tail family protein	tail	A6M962	Geobacillus_virus	33.6	1.4e-21
WP_016497238.1|26205_30681_-	tape measure protein	NA	E9LUR1	Lactobacillus_phage	31.7	1.4e-27
WP_016497239.1|30951_31302_-	hypothetical protein	NA	A8YQJ8	Lactobacillus_phage	35.3	4.1e-07
WP_016497240.1|31409_32042_-	small major structural protein	NA	O64291	Streptococcus_virus	30.7	2.4e-18
WP_016497241.1|32076_32454_-	DUF806 family protein	NA	A0A2P0ZLF4	Lactobacillus_phage	36.4	1.1e-15
WP_016497242.1|32450_32888_-	hypothetical protein	NA	A0A2P0VJL9	Streptococcus_phage	53.2	3.5e-32
WP_016497243.1|32880_33243_-|head	phage head closure protein	head	NA	NA	NA	NA
WP_016497244.1|33232_33583_-|head,tail	phage gp6-like head-tail connector protein	head,tail	A0A2I6QQY5	Streptococcus_phage	43.2	2.6e-14
WP_016497245.1|33596_34775_-|capsid	phage major capsid protein	capsid	Q9T1F6	Lactobacillus_phage	59.1	7.3e-125
WP_016497246.1|34774_35494_-|protease	Clp protease ClpP	protease	E9LUQ2	Lactobacillus_phage	54.6	3.0e-57
WP_016497247.1|35480_36674_-|portal	phage portal protein	portal	E9LUQ1	Lactobacillus_phage	58.1	3.4e-130
WP_041822066.1|36690_36870_-	DUF1056 family protein	NA	NA	NA	NA	NA
WP_016497248.1|36859_38731_-|terminase	terminase large subunit	terminase	E9LUP9	Lactobacillus_phage	66.8	1.6e-251
WP_016497249.1|38727_39183_-|terminase	phage terminase small subunit P27 family	terminase	A0A286QRF4	Streptococcus_phage	63.8	8.0e-48
WP_041822068.1|39410_39932_-	HNH endonuclease	NA	E9LUP7	Lactobacillus_phage	60.6	2.1e-47
