The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
NC_021500	Enterobacter sp. R4-368, complete sequence	5039027	1116548	1122897	5039027		Enterobacteria_phage(50.0%)	6	NA	NA
WP_020454293.1|1116548_1117091_-	dTDP-4-dehydrorhamnose 3,5-epimerase	NA	A0A291LA62	Escherichia_phage	56.8	2.0e-53
WP_020454294.1|1117094_1117970_-	glucose-1-phosphate thymidylyltransferase RfbA	NA	I7I009	Enterobacteria_phage	64.5	9.6e-106
WP_020454295.1|1118018_1118918_-	dTDP-4-dehydrorhamnose reductase	NA	A0A140G5S3	Enterobacteria_phage	34.2	4.1e-27
WP_020454296.1|1118914_1120003_-	dTDP-glucose 4,6-dehydratase	NA	I7HTA3	Enterobacteria_phage	53.9	2.0e-100
WP_020454297.1|1120410_1121304_-	GalU regulator GalF	NA	A0A127AW70	Bacillus_phage	40.3	2.8e-44
WP_020454298.1|1121481_1122897_-	colanic acid biosynthesis protein WcaM	NA	A0A291LBB9	Klebsiella_phage	32.2	3.8e-19
>prophage 2
NC_021500	Enterobacter sp. R4-368, complete sequence	5039027	1202015	1210384	5039027	tRNA	Enterobacteria_phage(66.67%)	9	NA	NA
WP_044489687.1|1202015_1204049_+|tRNA	methionine--tRNA ligase	tRNA	A0A1V0SDF2	Indivirus	27.8	8.9e-54
WP_020454356.1|1204135_1204591_+	YehR family lipoprotein	NA	Q9EYF5	Enterobacteria_phage	43.0	5.4e-28
WP_020454357.1|1204675_1205161_-	DUF1456 family protein	NA	Q9EYF4	Enterobacteria_phage	78.7	1.1e-63
WP_017459820.1|1205214_1205934_-	two-component system response regulator BtsR	NA	NA	NA	NA	NA
WP_020454358.1|1205927_1207616_-	sensor histidine kinase	NA	Q9EYF3	Enterobacteria_phage	84.5	1.2e-258
WP_020454360.1|1207835_1208567_+	HTH-type transcriptional regulator MlrA	NA	Q9EYF2	Enterobacteria_phage	75.4	4.6e-85
WP_020454361.1|1208627_1208741_+	protein YohO	NA	NA	NA	NA	NA
WP_020454362.1|1208715_1209453_-	ABC transporter permease	NA	NA	NA	NA	NA
WP_020454363.1|1209436_1210384_-	ABC transporter ATP-binding protein	NA	F2Y1V5	Organic_Lake_phycodnavirus	29.2	8.1e-10
>prophage 3
NC_021500	Enterobacter sp. R4-368, complete sequence	5039027	1275797	1324586	5039027	head,terminase,holin,capsid,tail,integrase	Salmonella_phage(26.67%)	54	1275483:1275533	1326189:1326239
1275483:1275533	attL	TGTCATGGGGTGTCAGGGGTCGGAGGTTCAAATCCTCTCGTGCCGACCAAA	NA	NA	NA	NA
WP_020454419.1|1275797_1276469_+	SOS response-associated peptidase	NA	A0A2H4J5W2	uncultured_Caudovirales_phage	60.3	1.1e-77
WP_020454420.1|1276950_1277931_+	Abi family protein	NA	NA	NA	NA	NA
WP_020454421.1|1278174_1279440_-	Y-family DNA polymerase	NA	I6RSM4	Salmonella_phage	89.3	3.6e-223
WP_044489689.1|1279442_1279865_-	translesion error-prone DNA polymerase V autoproteolytic subunit	NA	A0A1W6JNS2	Morganella_phage	56.7	7.2e-35
WP_020454423.1|1280000_1280429_-|tail	tail fiber assembly protein	tail	U5P083	Shigella_phage	36.0	1.3e-15
WP_071925206.1|1281590_1282217_-	hypothetical protein	NA	A0A1X7QGJ8	Escherichia_phage	34.3	7.3e-15
WP_020454425.1|1282738_1285918_-	host specificity protein J	NA	O64335	Escherichia_phage	81.3	0.0e+00
WP_020454426.1|1285969_1286569_-|tail	tail assembly protein	tail	K7PHE5	Enterobacteria_phage	75.4	3.4e-78
WP_020454427.1|1286628_1287051_-	hypothetical protein	NA	G8C7Q7	Escherichia_phage	33.7	1.8e-09
WP_020454428.1|1287053_1287935_-	hypothetical protein	NA	NA	NA	NA	NA
WP_189660096.1|1287927_1288488_-	hypothetical protein	NA	NA	NA	NA	NA
WP_020454430.1|1288832_1289540_-	C40 family peptidase	NA	K7PGV2	Enterobacterial_phage	79.0	2.4e-115
WP_020454431.1|1289541_1290297_-|tail	phage minor tail protein L	tail	K7PKU0	Enterobacteria_phage	84.9	4.6e-125
WP_020454432.1|1290293_1290632_-|tail	phage tail protein	tail	K7PKL8	Enterobacterial_phage	74.1	1.5e-46
WP_020454433.1|1290631_1293922_-|tail	phage tail tape measure protein	tail	A0A220NRN7	Escherichia_phage	72.7	0.0e+00
WP_020454434.1|1293957_1294221_-	DUF4035 domain-containing protein	NA	K7P7L5	Enterobacteria_phage	72.4	2.6e-30
WP_020454435.1|1294244_1294631_-|tail	phage tail protein	tail	K7PGV0	Enterobacterial_phage	61.3	1.9e-34
WP_020454436.1|1294678_1295152_-	hypothetical protein	NA	A0A220NRQ0	Escherichia_phage	85.7	2.3e-69
WP_020454437.1|1295211_1295559_-	DUF3168 domain-containing protein	NA	Q9MCS8	Enterobacteria_phage	48.7	1.5e-25
WP_020454438.1|1295555_1296002_-	HK97 gp10 family phage protein	NA	Q9MCS9	Enterobacteria_phage	71.8	6.2e-53
WP_020454439.1|1295998_1296337_-|head	phage head closure protein	head	A0A2H4JHK5	uncultured_Caudovirales_phage	54.1	1.8e-28
WP_020454440.1|1296348_1296675_-|head,tail	phage gp6-like head-tail connector protein	head,tail	S4TSQ3	Salmonella_phage	55.6	3.4e-24
WP_020454443.1|1299048_1299216_-	hypothetical protein	NA	S4TR49	Salmonella_phage	83.8	3.2e-10
WP_020454444.1|1299254_1301192_-|capsid	phage major capsid protein	capsid	S4TNE3	Salmonella_phage	90.4	0.0e+00
WP_020454445.1|1301250_1302909_-|terminase	terminase large subunit	terminase	Q3HQS7	Burkholderia_phage	71.3	3.1e-238
WP_020454446.1|1302912_1303413_-|terminase	terminase small subunit	terminase	S4TNN3	Salmonella_phage	73.2	3.0e-56
WP_020454447.1|1303516_1303885_-	HNH endonuclease	NA	S4TTG9	Salmonella_phage	82.0	3.3e-52
WP_020454448.1|1303877_1304471_-	hypothetical protein	NA	S4TR53	Salmonella_phage	71.9	1.2e-83
WP_020454449.1|1304452_1305913_-	hypothetical protein	NA	S4TSQ9	Salmonella_phage	75.3	1.6e-227
WP_020454450.1|1306000_1306450_+	hypothetical protein	NA	NA	NA	NA	NA
WP_020454451.1|1306909_1307314_-	DUF2513 domain-containing protein	NA	NA	NA	NA	NA
WP_044489425.1|1307400_1307745_-	hypothetical protein	NA	NA	NA	NA	NA
WP_020454453.1|1308119_1308653_-	hypothetical protein	NA	K7PHH7	Enterobacteria_phage	70.7	1.7e-52
WP_110093598.1|1308652_1309102_-	lysozyme	NA	A0A0M4R365	Salmonella_phage	79.1	4.5e-59
WP_020454455.1|1309098_1309383_-|holin	phage holin family protein	holin	K7PKN9	Enterobacterial_phage	50.0	4.6e-17
WP_020454456.1|1309369_1309750_-|holin	phage holin family protein	holin	F1C592	Cronobacter_phage	80.2	1.9e-50
WP_020454457.1|1309849_1310917_-	site-specific DNA-methyltransferase	NA	Q8SBE2	Shigella_phage	81.6	6.9e-175
WP_020454458.1|1311210_1312542_+	hypothetical protein	NA	R9TRQ8	Vibrio_phage	27.1	6.5e-21
WP_020454459.1|1312581_1312947_-	antitermination protein	NA	U5P0A5	Shigella_phage	67.5	3.7e-43
WP_020454460.1|1312961_1313954_-	DUF968 domain-containing protein	NA	A0A291AWV9	Escherichia_phage	68.5	9.1e-137
WP_020454461.1|1313950_1314673_-	phage regulatory protein/antirepressor Ant	NA	G0ZND1	Cronobacter_phage	59.2	2.4e-62
WP_020454462.1|1314684_1315074_-	RusA family crossover junction endodeoxyribonuclease	NA	A0A1C9IIA0	Salmonella_phage	82.2	1.2e-57
WP_189660114.1|1315070_1315391_-	LexA family transcriptional regulator	NA	K7PHB4	Enterobacterial_phage	48.1	8.8e-17
WP_020454464.1|1315418_1317734_-	Dam family site-specific DNA-(adenine-N6)-methyltransferase	NA	A0A1B0V7P0	Salmonella_phage	46.0	5.7e-198
WP_020454465.1|1317730_1318612_-	conserved phage C-terminal domain-containing protein	NA	K7PLZ7	Enterobacterial_phage	61.1	1.6e-44
WP_071925208.1|1318601_1318781_-	DUF4222 domain-containing protein	NA	S5M7S5	Escherichia_phage	71.2	5.6e-13
WP_020454467.1|1318944_1319496_-	hypothetical protein	NA	A0A1C9II13	Salmonella_phage	58.7	3.5e-53
WP_020454468.1|1319518_1319722_-	Cro/Cl family transcriptional regulator	NA	H9C161	Pectobacterium_phage	64.4	8.0e-16
WP_020454469.1|1319813_1320473_+	helix-turn-helix domain-containing protein	NA	H9C160	Pectobacterium_phage	64.5	6.6e-75
WP_189660097.1|1320750_1321035_-	hypothetical protein	NA	NA	NA	NA	NA
WP_020454472.1|1322119_1322872_+	hypothetical protein	NA	M1FN76	Enterobacteria_phage	84.4	2.0e-128
WP_020454473.1|1322884_1323154_+	hypothetical protein	NA	NA	NA	NA	NA
WP_020454474.1|1323184_1323394_+	hypothetical protein	NA	NA	NA	NA	NA
WP_020454475.1|1323395_1324586_+|integrase	phage integrase Arm DNA-binding domain-containing protein	integrase	A0A2H4J1K3	uncultured_Caudovirales_phage	28.7	7.8e-26
1326189:1326239	attR	TGTCATGGGGTGTCAGGGGTCGGAGGTTCAAATCCTCTCGTGCCGACCAAA	NA	NA	NA	NA
>prophage 4
NC_021500	Enterobacter sp. R4-368, complete sequence	5039027	1667800	1748549	5039027	lysis,integrase,tRNA,tail,plate	Escherichia_phage(23.68%)	82	1723847:1723862	1752523:1752538
WP_174240595.1|1667800_1668325_-|tRNA	tRNA adenosine(34) deaminase TadA	tRNA	S4VYT2	Pandoravirus	40.8	2.6e-05
WP_020454742.1|1668370_1669006_-	phosphatidylglycerophosphatase C	NA	NA	NA	NA	NA
WP_044489703.1|1669199_1670444_+	MFS transporter	NA	NA	NA	NA	NA
WP_020454744.1|1670574_1671423_+	MurR/RpiR family transcriptional regulator	NA	NA	NA	NA	NA
WP_110093605.1|1671458_1672757_-	SGNH/GDSL hydrolase family protein	NA	NA	NA	NA	NA
WP_017459033.1|1673105_1673366_+	YfhL family 4Fe-4S dicluster ferredoxin	NA	A0A1B1IWY9	uncultured_Mediterranean_phage	53.5	3.8e-18
WP_017459034.1|1673362_1673743_-	holo-ACP synthase	NA	NA	NA	NA	NA
WP_017459035.1|1673742_1674474_-	pyridoxine 5'-phosphate synthase	NA	NA	NA	NA	NA
WP_017459036.1|1674540_1675248_-	DNA repair protein RecO	NA	NA	NA	NA	NA
WP_020454746.1|1675382_1676288_-	GTPase Era	NA	NA	NA	NA	NA
WP_044489704.1|1676284_1676965_-	ribonuclease III	NA	E5EQH1	Micromonas_sp._RCC1109_virus	33.0	4.8e-20
WP_020454748.1|1677175_1678150_-	signal peptidase I	NA	NA	NA	NA	NA
WP_020454749.1|1678165_1679965_-	elongation factor 4	NA	E4ZFJ7	Streptococcus_phage	25.9	1.4e-23
WP_020454750.1|1680121_1680601_-	SoxR-reducing system protein RseC	NA	NA	NA	NA	NA
WP_020454751.1|1680597_1681551_-	sigma-E factor regulatory protein RseB	NA	NA	NA	NA	NA
WP_020454752.1|1681550_1682201_-	anti-sigma-E factor RseA	NA	NA	NA	NA	NA
WP_000003307.1|1682232_1682808_-	RNA polymerase sigma factor RpoE	NA	NA	NA	NA	NA
WP_020454753.1|1683230_1684850_+	L-aspartate oxidase	NA	NA	NA	NA	NA
WP_020454754.1|1684834_1685572_-|tRNA	tRNA1(Val) (adenine(37)-N6)-methyltransferase	tRNA	NA	NA	NA	NA
WP_020454755.1|1685701_1687036_+	ATP-dependent RNA helicase SrmB	NA	Q5GF26	Diachasmimorpha_longicaudata_entomopoxvirus	30.4	6.7e-42
WP_020454756.1|1687079_1687463_-	autonomous glycyl radical cofactor GrcA	NA	A0A193GZ98	Escherichia_phage	80.5	3.1e-32
WP_020454757.1|1687777_1688467_+	uracil-DNA glycosylase	NA	A0A0A8IL23	Epstein-Barr_virus	49.6	1.5e-53
WP_020454758.1|1688677_1689796_-|tRNA	tRNA/rRNA methyltransferase	tRNA	NA	NA	NA	NA
WP_020454759.1|1690000_1690420_+	thioredoxin TrxC	NA	A0A0K2FIM3	Achromobacter_phage	38.5	6.3e-15
WP_020454760.1|1690489_1691188_+	DTW domain-containing protein	NA	NA	NA	NA	NA
WP_020454761.1|1691220_1693875_+	protein lysine acetyltransferase	NA	NA	NA	NA	NA
WP_020454762.1|1693994_1695350_+	CDP-diacylglycerol--serine O-phosphatidyltransferase	NA	NA	NA	NA	NA
WP_020454763.1|1695395_1695716_+	YfiM family lipoprotein	NA	NA	NA	NA	NA
WP_020454764.1|1695719_1697018_-	MFS transporter	NA	Q6JIH2	Burkholderia_virus	31.3	4.1e-44
WP_020454765.1|1702874_1705448_-	ATP-dependent chaperone ClpB	NA	H6X3M6	Enterobacteria_phage	34.9	5.5e-125
WP_020454766.1|1705577_1706309_-	polyphenol oxidase	NA	NA	NA	NA	NA
WP_017459962.1|1706305_1707286_-	23S rRNA pseudouridine(1911/1915/1917) synthase RluD	NA	NA	NA	NA	NA
WP_020454767.1|1707417_1708155_+	outer membrane protein assembly factor BamD	NA	NA	NA	NA	NA
WP_044489450.1|1708430_1708769_+	ribosome-associated translation inhibitor RaiA	NA	NA	NA	NA	NA
WP_189660115.1|1708871_1708922_+	pheA operon leader peptide PheL	NA	NA	NA	NA	NA
WP_020454769.1|1709026_1710187_+	bifunctional chorismate mutase/prephenate dehydratase	NA	NA	NA	NA	NA
WP_020454770.1|1710183_1711056_-	SMP-30/gluconolactonase/LRE family protein	NA	NA	NA	NA	NA
WP_020454771.1|1711124_1712246_-	bifunctional chorismate mutase/prephenate dehydrogenase	NA	NA	NA	NA	NA
WP_020454772.1|1712255_1713326_-	3-deoxy-7-phosphoheptulonate synthase AroF	NA	A0A0B6VT43	Edwardsiella_phage	52.3	2.1e-91
WP_020454773.1|1713509_1714871_-	PepSY domain-containing protein	NA	NA	NA	NA	NA
WP_189660116.1|1714934_1715360_-	DUF2946 domain-containing protein	NA	NA	NA	NA	NA
WP_020454775.1|1715759_1716611_-	phage repressor protein CI	NA	Q6K1G0	Salmonella_virus	58.8	6.1e-89
WP_020454776.1|1717142_1717481_+	DUF5347 domain-containing protein	NA	A0A218M4I7	Erwinia_phage	66.7	3.4e-35
WP_020454777.1|1717548_1717776_+	DUF2732 family protein	NA	NA	NA	NA	NA
WP_020454778.1|1717775_1717997_+	TraR/DksA family transcriptional regulator	NA	Q6K1F5	Salmonella_virus	74.6	7.4e-23
WP_020454779.1|1717997_1720052_+	replication endonuclease	NA	A0A218M4H2	Erwinia_phage	65.5	9.3e-253
WP_017459947.1|1720126_1720312_+	hypothetical protein	NA	A0A0M5M1G5	Salmonella_phage	77.0	7.8e-18
WP_020454780.1|1720522_1720726_+|tail	tail protein X	tail	Q858W3	Yersinia_virus	75.0	7.0e-20
WP_017459945.1|1720716_1720947_+	primosomal protein	NA	A0A218M4L5	Erwinia_phage	44.6	4.0e-11
WP_020454781.1|1720921_1721431_+	lysozyme	NA	A0A218M4K3	Erwinia_phage	74.2	5.6e-66
WP_020454782.1|1721427_1721841_+|lysis	LysB family phage lysis regulatory protein	lysis	A0A0M4R2N5	Salmonella_phage	63.5	1.9e-16
WP_044489451.1|1721948_1722416_+|tail	phage tail protein	tail	A0A0F7LA33	Escherichia_phage	61.4	3.7e-48
WP_020454784.1|1722493_1723129_+|plate	phage baseplate assembly protein V	plate	U5N3F0	Enterobacteria_phage	81.5	7.2e-95
WP_020454785.1|1723125_1723473_+	GPW/gp25 family protein	NA	A0A0F7LDQ1	Escherichia_phage	70.4	6.1e-40
WP_020454786.1|1723477_1724386_+|plate	baseplate assembly protein	plate	A0A218M4K5	Erwinia_phage	77.8	1.4e-128
1723847:1723862	attL	CTGCGTCTGCGCGCGC	NA	NA	NA	NA
WP_020454787.1|1724378_1724987_+|tail	phage tail protein I	tail	A0A218M4J3	Erwinia_phage	78.7	8.1e-88
WP_020454788.1|1725142_1726234_+|tail	phage tail protein	tail	A0A2I8TVA9	Erwinia_phage	62.7	9.4e-119
WP_020454789.1|1726233_1726830_+|tail	tail fiber assembly protein	tail	A0A218M4J2	Erwinia_phage	60.4	3.4e-62
WP_020454791.1|1728264_1728681_+|tail	tail fiber assembly protein	tail	A0A0F7LDZ0	Escherichia_phage	45.3	2.5e-27
WP_020454792.1|1728819_1730001_+|tail	phage tail sheath protein	tail	S4TRX2	Salmonella_phage	87.8	8.1e-201
WP_020454793.1|1730013_1730532_+|tail	phage major tail tube protein	tail	Q858V0	Yersinia_virus	88.4	8.5e-86
WP_020454794.1|1730592_1730874_+|tail	phage tail assembly protein	tail	A0A0F7LDQ8	Escherichia_phage	78.4	1.0e-29
WP_017459930.1|1730906_1731026_+|tail	GpE family phage tail protein	tail	A0A0F7LCR6	Escherichia_phage	87.2	1.3e-13
WP_020454795.1|1731018_1732791_+|tail	phage tail tape measure protein	tail	A0A0M3UL85	Salmonella_phage	40.9	9.2e-39
WP_020454796.1|1732805_1733264_+|tail	phage tail protein	tail	A0A0F7LBX3	Escherichia_phage	65.2	1.2e-48
WP_020454797.1|1733263_1734400_+	phage late control D family protein	NA	A0A0F7LDZ2	Escherichia_phage	48.4	5.8e-95
WP_020454798.1|1734478_1734673_+	ogr/Delta-like zinc finger family protein	NA	Q37973	Salmonella_virus	78.8	1.1e-19
WP_004104634.1|1735100_1735448_-	50S ribosomal protein L19	NA	NA	NA	NA	NA
WP_020454799.1|1735489_1736257_-|tRNA	tRNA (guanosine(37)-N1)-methyltransferase TrmD	tRNA	NA	NA	NA	NA
WP_017459924.1|1736287_1736836_-	ribosome maturation factor RimM	NA	NA	NA	NA	NA
WP_017459923.1|1736854_1737103_-	30S ribosomal protein S16	NA	NA	NA	NA	NA
WP_017459922.1|1737360_1738722_-	signal recognition particle protein	NA	NA	NA	NA	NA
WP_020454801.1|1738888_1739677_+	inner membrane protein YpjD	NA	NA	NA	NA	NA
WP_025263874.1|1739694_1740981_+	HlyC/CorC family transporter	NA	NA	NA	NA	NA
WP_147271691.1|1741026_1741623_-	nucleotide exchange factor GrpE	NA	NA	NA	NA	NA
WP_020454803.1|1741746_1742625_+	NAD(+) kinase	NA	NA	NA	NA	NA
WP_020454804.1|1742712_1744374_+	DNA repair protein RecN	NA	NA	NA	NA	NA
WP_017459915.1|1744521_1744863_+	outer membrane protein assembly factor BamE	NA	NA	NA	NA	NA
WP_020454805.1|1744999_1745293_-	RnfH family protein	NA	NA	NA	NA	NA
WP_044489456.1|1745282_1745759_-	type II toxin-antitoxin system RatA family toxin	NA	NA	NA	NA	NA
WP_017459912.1|1745878_1746361_+	SsrA-binding protein SmpB	NA	W5RAM5	Staphylococcus_phage	47.4	1.4e-29
WP_020454807.1|1747346_1748549_+|integrase	tyrosine-type recombinase/integrase	integrase	A0A1B5FPC6	Escherichia_phage	48.5	1.3e-105
1752523:1752538	attR	GCGCGCGCAGACGCAG	NA	NA	NA	NA
>prophage 5
NC_021500	Enterobacter sp. R4-368, complete sequence	5039027	2323154	2362759	5039027	integrase,head,terminase,holin,portal,capsid,lysis,tRNA,tail,plate	Erwinia_phage(30.0%)	48	2329342:2329357	2363699:2363714
WP_020455307.1|2323154_2324168_-|tRNA	tRNA (adenosine(37)-N6)-threonylcarbamoyltransferase complex transferase subunit TsaD	tRNA	A0A0R6PI74	Moraxella_phage	59.2	2.4e-108
WP_001144069.1|2324406_2324622_+	30S ribosomal protein S21	NA	NA	NA	NA	NA
WP_020455308.1|2324790_2326536_+	DNA primase	NA	A0A0K1LMQ9	Caulobacter_phage	37.2	9.2e-76
WP_020455309.1|2326692_2328534_+	RNA polymerase sigma factor RpoD	NA	A0A2I7SAT0	Vibrio_phage	33.7	8.3e-35
WP_020455310.1|2328592_2329099_-	G/U mismatch-specific DNA glycosylase	NA	NA	NA	NA	NA
2329342:2329357	attL	AGTGGCTTTTTTGTTT	NA	NA	NA	NA
WP_020455311.1|2329468_2329687_-	DNA-binding transcriptional regulator	NA	A0A2I8TV89	Erwinia_phage	83.1	3.3e-31
WP_020455312.1|2329761_2330943_-	phage late control D family protein	NA	A0A218M4J7	Erwinia_phage	77.0	2.3e-163
WP_020455313.1|2330942_2331419_-|tail	phage tail protein	tail	A0A0F7LDE8	Escherichia_phage	75.2	4.9e-64
WP_020455314.1|2331431_2333903_-|tail	phage tail tape measure protein	tail	Q7Y4C8	Escherichia_virus	66.4	3.4e-257
WP_110093618.1|2333895_2334033_-|tail	GpE family phage tail protein	tail	A0A0F7LCR6	Escherichia_phage	86.7	3.7e-17
WP_020455316.1|2334047_2334323_-|tail	phage tail assembly protein	tail	A0A0F7LDQ8	Escherichia_phage	87.9	1.1e-36
WP_020455317.1|2334384_2334903_-|tail	phage major tail tube protein	tail	A0A0F7LDZ1	Escherichia_phage	93.0	2.8e-89
WP_020455318.1|2334916_2336107_-|tail	phage tail sheath protein	tail	A0A0F7LBW9	Escherichia_phage	88.6	1.1e-202
WP_020455319.1|2336601_2337183_-|tail	tail fiber assembly protein	tail	E5G6P1	Salmonella_phage	32.2	1.2e-16
WP_020455320.1|2337182_2338427_-|tail	phage tail protein	tail	M1TAS6	Escherichia_phage	47.4	4.1e-110
WP_020455321.1|2338423_2339035_-|tail	phage tail protein I	tail	A0A218M4J3	Erwinia_phage	84.1	2.6e-94
WP_020455322.1|2339027_2339936_-|plate	baseplate assembly protein	plate	A0A218M4K5	Erwinia_phage	78.5	3.7e-129
WP_020455323.1|2339940_2340288_-	GPW/gp25 family protein	NA	A0A0F7LDQ1	Escherichia_phage	78.3	7.0e-44
WP_020455324.1|2340284_2340920_-|plate	phage baseplate assembly protein V	plate	U5N3F0	Enterobacteria_phage	86.7	3.3e-100
WP_020455325.1|2340992_2342054_-	patatin-like phospholipase family protein	NA	NA	NA	NA	NA
WP_020455326.1|2342147_2343101_+	hypothetical protein	NA	NA	NA	NA	NA
WP_020455327.1|2343121_2343574_-	phage virion morphogenesis protein	NA	O80313	Escherichia_phage	63.3	1.6e-43
WP_044489490.1|2343566_2344034_-|tail	phage tail protein	tail	A0A0F7LA33	Escherichia_phage	77.9	1.7e-64
WP_020455329.1|2344141_2344555_-|lysis	LysB family phage lysis regulatory protein	lysis	O80310	Escherichia_phage	73.0	6.2e-47
WP_020455330.1|2344551_2345061_-	lysozyme	NA	A0A218M4K3	Erwinia_phage	79.0	5.2e-72
WP_020455331.1|2345044_2345281_-|holin	holin	holin	A0A218M4L5	Erwinia_phage	45.2	6.9e-11
WP_020455332.1|2345271_2345475_-|tail	tail protein X	tail	U5N3E7	Enterobacteria_phage	77.6	1.8e-23
WP_020455333.1|2345474_2345978_-|head	head completion/stabilization protein	head	M1SNN6	Escherichia_phage	81.1	8.0e-73
WP_020455334.1|2346074_2346833_-|terminase	terminase endonuclease subunit	terminase	Q94MI7	Enterobacteria_phage	68.9	5.2e-84
WP_020455335.1|2346836_2348009_-|capsid	phage major capsid protein, P2 family	capsid	O80304	Escherichia_phage	62.3	3.7e-129
WP_020455336.1|2348045_2348903_-|capsid	GPO family capsid scaffolding protein	capsid	Q6K1I7	Salmonella_virus	72.6	1.9e-114
WP_020455337.1|2349080_2350850_+|terminase	terminase ATPase subunit family protein	terminase	A0A0M4RE51	Salmonella_phage	83.7	7.0e-297
WP_020455338.1|2350849_2351887_+|portal	phage portal protein	portal	Q6K1J0	Salmonella_virus	78.3	2.1e-160
WP_044489492.1|2352207_2354232_-	hypothetical protein	NA	NA	NA	NA	NA
WP_020455340.1|2354233_2354698_-	hypothetical protein	NA	NA	NA	NA	NA
WP_044489739.1|2354711_2355620_-	hypothetical protein	NA	NA	NA	NA	NA
WP_020455342.1|2355833_2356019_-	hypothetical protein	NA	A0A218M4I0	Erwinia_phage	70.9	5.8e-13
WP_020455343.1|2356156_2358385_-	replication endonuclease	NA	A0A218M4H2	Erwinia_phage	87.1	0.0e+00
WP_020455344.1|2358381_2358657_-	DUF3850 domain-containing protein	NA	A0A0P0I3U9	Klebsiella_phage	52.6	4.6e-14
WP_020455345.1|2358653_2358878_-	TraR/DksA family transcriptional regulator	NA	Q6K1F5	Salmonella_virus	81.1	3.8e-27
WP_020455346.1|2358877_2359105_-	DUF2732 domain-containing protein	NA	F1BUS3	Erwinia_phage	73.3	1.1e-21
WP_020455347.1|2359172_2359511_-	DUF5347 domain-containing protein	NA	A0A218M4I7	Erwinia_phage	81.2	2.8e-45
WP_020455348.1|2359474_2359663_-	DUF2724 domain-containing protein	NA	Q6K1F7	Salmonella_virus	63.1	3.9e-17
WP_020455349.1|2359670_2360180_-	phage regulatory CII family protein	NA	A0A0M4QWN1	Salmonella_phage	86.4	1.5e-79
WP_020455350.1|2360210_2360432_-	hypothetical protein	NA	NA	NA	NA	NA
WP_020455351.1|2360566_2361148_+	phage repressor protein	NA	F1BUS8	Erwinia_phage	41.4	2.2e-34
WP_020455352.1|2361162_2361732_+	PH domain-containing protein	NA	Q4ZA70	Staphylococcus_virus	34.3	2.6e-19
WP_020455353.1|2361736_2362759_+|integrase	tyrosine-type recombinase/integrase	integrase	F1BUS9	Erwinia_phage	64.6	2.0e-123
2363699:2363714	attR	AGTGGCTTTTTTGTTT	NA	NA	NA	NA
>prophage 6
NC_021500	Enterobacter sp. R4-368, complete sequence	5039027	3095076	3106225	5039027	holin,integrase	Salmonella_phage(69.23%)	16	3095182:3095196	3113821:3113835
WP_020455927.1|3095076_3096450_-	envelope stress sensor histidine kinase CpxA	NA	W8CYF6	Bacillus_phage	24.1	1.1e-15
3095182:3095196	attL	AATCGCCAGGCCAAG	NA	NA	NA	NA
WP_044489537.1|3096446_3097145_-	envelope stress response regulator transcription factor CpxR	NA	Q6XM27	Feldmannia_irregularis_virus	30.3	3.1e-06
WP_020455929.1|3097296_3097800_+	cell-envelope stress modulator CpxP	NA	NA	NA	NA	NA
WP_020455930.1|3097976_3098957_-|integrase	tyrosine-type recombinase/integrase	integrase	A0A0M4RTQ0	Salmonella_phage	87.1	9.2e-166
WP_020455931.1|3099026_3099347_-	transcriptional regulator	NA	A0A0M5M1I9	Salmonella_phage	67.0	2.0e-32
WP_020455932.1|3099456_3099738_+	hypothetical protein	NA	A0A0M4RCW1	Salmonella_phage	63.4	1.4e-31
WP_071925293.1|3099992_3100196_+	DUF4761 family protein	NA	A0A0M5M1I3	Salmonella_phage	66.2	7.8e-19
WP_020455934.1|3100185_3100413_+	DUF2724 domain-containing protein	NA	A0A0M4S6M9	Salmonella_phage	72.0	1.6e-25
WP_044489767.1|3100510_3100720_+	hypothetical protein	NA	A0A0M4R514	Salmonella_phage	57.4	2.4e-15
WP_189660069.1|3100760_3100958_+	DUF2732 family protein	NA	NA	NA	NA	NA
WP_020455937.1|3101145_3101388_+	hypothetical protein	NA	NA	NA	NA	NA
WP_020455938.1|3101390_3103769_+	replication endonuclease	NA	A0A0M4RTM8	Salmonella_phage	68.5	1.4e-292
WP_071925246.1|3104155_3104347_+	type II toxin-antitoxin system HicA family toxin	NA	A0A0D4DC32	Acinetobacter_phage	76.3	1.2e-18
WP_044489769.1|3104359_3104770_+	type II toxin-antitoxin system HicB family antitoxin	NA	A0A0D4DCG1	Acinetobacter_phage	56.2	4.1e-35
WP_020455939.1|3105519_3105843_+|holin	phage holin family protein	holin	A0A0M3ULH4	Salmonella_phage	54.0	5.2e-25
WP_020455940.1|3105832_3106225_+	M15 family metallopeptidase	NA	S4TRL9	Salmonella_phage	76.6	4.1e-56
3113821:3113835	attR	CTTGGCCTGGCGATT	NA	NA	NA	NA
>prophage 1
NC_021492	Enterobacter sp. R4-368 plasmid pENT01, complete sequence	116007	63	54924	116007	transposase,integrase	Escherichia_phage(27.78%)	55	7232:7253	25828:25849
WP_110093664.1|63_1210_+|transposase	IS3 family transposase	transposase	U5P429	Shigella_phage	90.4	5.2e-144
WP_016495505.1|1308_1935_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016495506.1|2009_2270_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016495507.1|2284_2953_-	hypothetical protein	NA	NA	NA	NA	NA
WP_189660128.1|2955_3927_-	StbA family protein	NA	A0A222YXF2	Escherichia_phage	46.0	2.5e-70
WP_016495509.1|4188_4533_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016495512.1|5496_5940_+	translesion error-prone DNA polymerase V autoproteolytic subunit	NA	A0A1W6JNS2	Morganella_phage	53.5	3.3e-30
WP_044489848.1|5927_7202_+	Y-family DNA polymerase	NA	F1C5A5	Cronobacter_phage	61.8	8.3e-151
7232:7253	attL	AAGCACGGCAGGACGCCGTGCG	NA	NA	NA	NA
WP_016495514.1|7712_8474_+	replication initiation protein RepE	NA	I3WF20	Macacine_betaherpesvirus	87.6	2.2e-127
WP_016495515.1|9170_9806_+	AAA family ATPase	NA	A0A222YXS3	Escherichia_phage	46.2	4.4e-44
WP_016495516.1|9808_10117_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016495517.1|10178_11519_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016495518.1|11713_12508_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016495519.1|12905_13109_+	hypothetical protein	NA	NA	NA	NA	NA
WP_189660126.1|13402_13654_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016495521.1|13783_14044_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016495522.1|14654_15434_-|integrase	phage integrase family protein	integrase	I3WFA4	Macacine_betaherpesvirus	89.3	3.0e-50
WP_016495523.1|15430_16153_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016495524.1|16195_16543_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016495525.1|17661_18087_+	ester cyclase	NA	NA	NA	NA	NA
WP_044489865.1|18217_18577_+	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_016495527.1|18899_19538_+	NAD(P)H-binding protein	NA	NA	NA	NA	NA
WP_016495528.1|19813_20719_-	NmrA/HSCARG family protein	NA	NA	NA	NA	NA
WP_016495530.1|20858_21776_+	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_016495531.1|21956_22745_-	sulfite exporter TauE/SafE family protein	NA	NA	NA	NA	NA
WP_016495532.1|22853_23621_+	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_016495533.1|23965_24232_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016495534.1|24228_24867_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016495535.1|24863_25649_+	hypothetical protein	NA	NA	NA	NA	NA
WP_044489868.1|27288_27720_-	hypothetical protein	NA	NA	NA	NA	NA
25828:25849	attR	AAGCACGGCAGGACGCCGTGCG	NA	NA	NA	NA
WP_016495538.1|27885_28797_+	4-hydroxybenzoate octaprenyltransferase	NA	NA	NA	NA	NA
WP_016495540.1|29926_32170_+	type VI secretion system tip protein VgrG	NA	A0A077K8Q4	Ralstonia_phage	27.5	9.8e-46
WP_016495541.1|32180_32543_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016495542.1|33039_33285_+	hypothetical protein	NA	NA	NA	NA	NA
WP_189660127.1|33361_33964_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016495544.1|33960_34419_+	DUF1311 domain-containing protein	NA	NA	NA	NA	NA
WP_016495545.1|34690_35059_-	hypothetical protein	NA	NA	NA	NA	NA
WP_071925300.1|35045_35447_-	BPSL0067 family protein	NA	NA	NA	NA	NA
WP_110093710.1|35672_36819_+|transposase	IS3 family transposase	transposase	U5P429	Shigella_phage	92.6	3.9e-147
WP_016495549.1|36955_37126_+	hypothetical protein	NA	NA	NA	NA	NA
WP_044489850.1|37378_37954_-	PIN domain-containing protein	NA	K4HZX4	Acidithiobacillus_phage	52.3	3.3e-46
WP_016495551.1|37922_38414_-	helix-turn-helix domain-containing protein	NA	K4ICM4	Acidithiobacillus_phage	49.3	5.3e-29
WP_001067855.1|38952_39657_+|transposase	IS6-like element IS26 family transposase	transposase	A0A077SL39	Escherichia_phage	100.0	1.8e-139
WP_016495554.1|39809_40901_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016495555.1|40917_42222_+	3-phosphoshikimate 1-carboxyvinyltransferase	NA	NA	NA	NA	NA
WP_016495556.1|42245_42758_+	adenylyl-sulfate kinase	NA	A0A2K9L4R9	Tupanvirus	37.6	6.1e-20
WP_016495557.1|43202_44045_-	ATP-binding protein	NA	A0A059NT77	Lactococcus_phage	34.7	2.0e-31
WP_016495558.1|44034_45567_-|transposase	IS21-like element ISAav1 family transposase	transposase	A0A2L1IVA1	Escherichia_phage	28.4	1.3e-17
WP_016495559.1|45660_46659_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016495560.1|46806_47481_+	DNA methylase	NA	A0A0M4S5U3	Salmonella_phage	46.7	9.8e-50
WP_044489851.1|47482_48088_-	recombinase family protein	NA	NA	NA	NA	NA
WP_003830785.1|48207_48774_-	TetR family transcriptional regulator	NA	NA	NA	NA	NA
WP_003830786.1|48784_50296_-	MFS transporter	NA	NA	NA	NA	NA
WP_001067848.1|50710_51415_+|transposase	IS6-like element IS26 family transposase	transposase	A0A077SL39	Escherichia_phage	99.6	1.2e-138
WP_016495564.1|51939_54924_+|transposase	Tn3 family transposase	transposase	A0A1B0V7H9	Salmonella_phage	54.3	9.6e-307
