The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
NZ_CP011980	Klebsiella pneumoniae 500_1420, complete genome	5308211	446294	479552	5308211	portal,terminase,integrase,protease,capsid,tRNA,tail,head	uncultured_Caudovirales_phage(73.33%)	35	463902:463919	479897:479914
WP_002919147.1|446294_447242_-|tRNA	methionyl-tRNA formyltransferase	tRNA	E3SNR5	Prochlorococcus_phage	37.2	2.2e-07
WP_002919144.1|447256_447766_-	peptide deformylase	NA	E3SLL2	Synechococcus_phage	40.3	2.6e-18
WP_002919139.1|447894_449019_+	DNA-protecting protein DprA	NA	NA	NA	NA	NA
WP_002919137.1|448990_449464_+	DUF494 domain-containing protein	NA	NA	NA	NA	NA
WP_004145330.1|449489_450032_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002919132.1|450036_450609_+	L-threonylcarbamoyladenylate synthase type 1 TsaC	NA	NA	NA	NA	NA
WP_002919126.1|450612_451431_+	shikimate dehydrogenase	NA	NA	NA	NA	NA
WP_002919125.1|451427_451685_+	DUF1488 domain-containing protein	NA	NA	NA	NA	NA
WP_002919123.1|451660_452215_-	gamma carbonic anhydrase family protein	NA	NA	NA	NA	NA
WP_002919103.1|458010_458232_-	membrane protein	NA	NA	NA	NA	NA
WP_002919102.1|458525_461636_-	multidrug efflux RND transporter permease subunit	NA	NA	NA	NA	NA
WP_002919101.1|461648_462788_-	efflux RND transporter periplasmic adaptor subunit	NA	NA	NA	NA	NA
WP_004150972.1|463166_463817_+	acrEF/envCD operon transcriptional regulator	NA	NA	NA	NA	NA
463902:463919	attL	GTATCAGTTCATGCCGTA	NA	NA	NA	NA
WP_004150971.1|464092_465319_+|integrase	site-specific integrase	integrase	A0A2H4JB45	uncultured_Caudovirales_phage	62.2	1.8e-150
WP_004150970.1|465411_466353_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001547839.1|466534_466819_+	AlpA family phage regulatory protein	NA	NA	NA	NA	NA
WP_004150969.1|466829_467609_+	hypothetical protein	NA	Q8HA02	Enterobacteria_phage	51.5	6.2e-40
WP_024194847.1|467732_467927_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004150968.1|468150_468330_+	host cell division inhibitor Icd-like protein	NA	A0A2H4JGW3	uncultured_Caudovirales_phage	94.9	2.6e-26
WP_001549752.1|468322_468511_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004150967.1|468503_468818_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004150966.1|468814_469183_+	hypothetical protein	NA	A0A2H4JCX7	uncultured_Caudovirales_phage	81.1	3.7e-51
WP_001549749.1|469179_469545_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004150965.1|469544_471680_+	DUF927 domain-containing protein	NA	A0A1W6JPG0	Morganella_phage	62.4	3.4e-205
WP_004150964.1|472022_472358_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004150963.1|472406_472919_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001549743.1|473182_474349_+|capsid	phage major capsid protein	capsid	A0A2H4JED2	uncultured_Caudovirales_phage	95.9	9.8e-207
WP_001547826.1|474400_474961_+|head,protease	HK97 family phage prohead protease	head,protease	A0A2H4JB68	uncultured_Caudovirales_phage	95.7	1.2e-98
WP_004150962.1|474962_476204_+|portal	phage portal protein	portal	A0A2H4JFJ9	uncultured_Caudovirales_phage	96.5	1.0e-230
WP_004150961.1|476200_476536_+|head	phage head closure protein	head	A0A2H4JHK5	uncultured_Caudovirales_phage	57.8	3.7e-26
WP_001547824.1|476532_476832_+|head,tail	phage gp6-like head-tail connector protein	head,tail	A0A2H4JD08	uncultured_Caudovirales_phage	80.8	3.4e-39
WP_004150959.1|476831_477275_+	HNH endonuclease	NA	A0A2H4JAS8	uncultured_Caudovirales_phage	91.8	2.8e-77
WP_004198610.1|477401_477593_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000113647.1|477550_477907_+|terminase	phage terminase small subunit P27 family	terminase	A0A2H4JHS3	uncultured_Caudovirales_phage	99.2	5.5e-60
WP_004150955.1|477890_479552_+|terminase	terminase large subunit	terminase	A0A2H4JB64	uncultured_Caudovirales_phage	98.0	0.0e+00
479897:479914	attR	GTATCAGTTCATGCCGTA	NA	NA	NA	NA
>prophage 2
NZ_CP011980	Klebsiella pneumoniae 500_1420, complete genome	5308211	1666393	1673300	5308211	tRNA	Planktothrix_phage(33.33%)	6	NA	NA
WP_004175147.1|1666393_1667257_+	ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	27.5	5.7e-10
WP_002912638.1|1667267_1668041_+	ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	36.3	1.5e-25
WP_002912636.1|1668283_1669177_-	lipid kinase YegS	NA	A0A1V0SBJ0	Catovirus	29.8	6.1e-15
WP_002912635.1|1669422_1670784_-|tRNA	tRNA 5-hydroxyuridine modification protein YegQ	tRNA	Q6DW11	Phage_TP	94.5	2.5e-206
WP_002912634.1|1671102_1671825_-	two-component system response regulator BaeR	NA	W8CYM9	Bacillus_phage	33.2	6.4e-31
WP_004151135.1|1671821_1673300_-	two-component system sensor histidine kinase BaeS	NA	W8CYF6	Bacillus_phage	28.3	1.1e-29
>prophage 3
NZ_CP011980	Klebsiella pneumoniae 500_1420, complete genome	5308211	1952375	2008861	5308211	transposase,protease,plate	Staphylococcus_phage(16.67%)	58	NA	NA
WP_002910830.1|1952375_1953122_+|protease	proteasome-type protease	protease	NA	NA	NA	NA
WP_004199384.1|1953533_1954547_+	fatty acid desaturase	NA	NA	NA	NA	NA
WP_004151439.1|1954539_1955340_+	PhnD/SsuA/transferrin family substrate-binding protein	NA	NA	NA	NA	NA
WP_002910767.1|1955326_1955500_-	hypothetical protein	NA	NA	NA	NA	NA
WP_009484364.1|1955527_1955713_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002910764.1|1956117_1957059_+	transcriptional regulator TdcA	NA	NA	NA	NA	NA
WP_002910762.1|1957152_1958142_+	bifunctional threonine ammonia-lyase/L-serine ammonia-lyase TdcB	NA	NA	NA	NA	NA
WP_004145486.1|1958167_1959499_+	threonine/serine transporter TdcC	NA	NA	NA	NA	NA
WP_002910759.1|1959526_1960735_+	propionate kinase	NA	NA	NA	NA	NA
WP_004152312.1|1960763_1963058_+	formate C-acetyltransferase	NA	A0A2P0VNR5	Tetraselmis_virus	41.8	2.3e-159
WP_004219578.1|1963488_1964604_+	branched-chain amino acid ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_002910727.1|1964713_1965628_+	branched-chain amino acid ABC transporter permease	NA	NA	NA	NA	NA
WP_002910725.1|1965637_1966915_+	high-affinity branched-chain amino acid ABC transporter permease LivM	NA	NA	NA	NA	NA
WP_002910722.1|1966911_1967787_+	ATP-binding cassette domain-containing protein	NA	W8CYL7	Bacillus_phage	41.5	9.5e-05
WP_002910721.1|1967783_1968503_+	ABC transporter ATP-binding protein	NA	A0A2H4PQG7	Staphylococcus_phage	26.0	2.5e-11
WP_002910720.1|1968508_1969402_-	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_002910719.1|1969685_1971329_+	phosphoenolpyruvate carboxykinase (ATP)	NA	A0A2H4PQN1	Staphylococcus_phage	50.4	9.8e-136
WP_002910717.1|1971378_1971855_-	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_002910715.1|1971953_1972880_+	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_004152313.1|1973183_1974479_+	MFS transporter	NA	Q6JIH2	Burkholderia_virus	36.8	1.3e-61
WP_004152314.1|1974493_1975300_+	ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_004152315.1|1975274_1976174_-	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_002910657.1|1976283_1976766_-	cold shock domain-containing protein	NA	NA	NA	NA	NA
WP_002910654.1|1976956_1977655_+	RluA family pseudouridine synthase	NA	A0A2H4UV25	Bodo_saltans_virus	27.2	2.6e-05
WP_004899028.1|1977680_1978265_-	DUF2058 domain-containing protein	NA	NA	NA	NA	NA
WP_002910650.1|1978334_1978664_-	gamma-glutamylcyclotransferase	NA	NA	NA	NA	NA
WP_002910647.1|1978750_1978996_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004156898.1|1979005_1979185_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002910645.1|1979232_1980573_+|plate	type VI secretion system baseplate subunit TssK	plate	NA	NA	NA	NA
WP_004152316.1|1980569_1981223_+	DotU family type IV/VI secretion system protein	NA	NA	NA	NA	NA
WP_004152317.1|1981226_1982924_+	OmpA family protein	NA	NA	NA	NA	NA
WP_004221091.1|1983382_1984576_+	type VI secretion system tip protein VgrG	NA	NA	NA	NA	NA
WP_020320395.1|1984541_1985864_+	type VI secretion system tip protein VgrG	NA	NA	NA	NA	NA
WP_004152319.1|1985887_1987243_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002910593.1|1987243_1987753_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002910591.1|1987749_1988256_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002910586.1|1988492_1989002_+	hypothetical protein	NA	NA	NA	NA	NA
WP_029779662.1|1989295_1990576_+	hypothetical protein	NA	NA	NA	NA	NA
WP_022644641.1|1990607_1991576_+|transposase	IS5 family transposase	transposase	A0A1B0VFY5	Salmonella_phage	96.3	6.5e-180
WP_004199326.1|1991717_1991900_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004153085.1|1991896_1992226_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002910551.1|1992222_1992729_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002910549.1|1992774_1993005_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004155011.1|1993110_1994220_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002910547.1|1994243_1994549_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002910544.1|1994570_1995464_+	SUMF1/EgtB/PvdO family nonheme iron enzyme	NA	A0A7H6	Microcystis_virus	30.5	6.7e-14
WP_004152633.1|1995647_1996541_+	SUMF1/EgtB/PvdO family nonheme iron enzyme	NA	A0A075BSL8	Microcystis_phage	27.3	1.7e-12
WP_002910539.1|1996716_1997610_+	SUMF1/EgtB/PvdO family nonheme iron enzyme	NA	A0A075BSL8	Microcystis_phage	27.1	2.8e-12
WP_004152632.1|1997785_1998676_+	SUMF1/EgtB/PvdO family nonheme iron enzyme	NA	A0A7H6	Microcystis_virus	29.8	4.1e-11
WP_000019473.1|1999012_1999993_+|transposase	IS5-like element ISKpn26 family transposase	transposase	Q38213	Escherichia_phage	99.1	8.9e-185
WP_071531187.1|2000031_2000154_-	hypothetical protein	NA	NA	NA	NA	NA
WP_029779706.1|2000116_2000353_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004227463.1|2000541_2000799_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002910497.1|2001096_2001363_+	PAAR domain-containing protein	NA	NA	NA	NA	NA
WP_004198077.1|2001366_2002524_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004198071.1|2002507_2005918_+	intracellular multiplication and macrophage-killing family protein	NA	NA	NA	NA	NA
WP_002910495.1|2006051_2007815_+|plate	type VI secretion system baseplate subunit TssF	plate	NA	NA	NA	NA
WP_002910494.1|2007814_2008861_+|plate	type VI secretion system baseplate subunit TssG	plate	NA	NA	NA	NA
>prophage 4
NZ_CP011980	Klebsiella pneumoniae 500_1420, complete genome	5308211	2672045	2682932	5308211		Escherichia_phage(87.5%)	9	NA	NA
WP_004151613.1|2672045_2675153_+	beta-galactosidase	NA	L0N6M2	Herpes_simplex_virus	59.6	0.0e+00
WP_004151612.1|2675207_2676473_+	MFS transporter	NA	NA	NA	NA	NA
WP_001620097.1|2676503_2677592_-	AAA family ATPase	NA	A0A077SLJ9	Escherichia_phage	100.0	8.0e-211
WP_002904006.1|2677678_2677939_-	hypothetical protein	NA	A0A077SK33	Escherichia_phage	97.7	3.5e-40
WP_004176269.1|2678236_2679097_+	class A broad-spectrum beta-lactamase SHV-11	NA	A0A077SL40	Escherichia_phage	99.3	2.2e-155
WP_002210513.1|2679117_2679879_-	DeoR/GlpR transcriptional regulator	NA	A0A077SK06	Escherichia_phage	100.0	1.9e-134
WP_004151610.1|2680139_2681042_+	NAD(P)-dependent oxidoreductase	NA	A0A077SLF7	Escherichia_phage	99.3	7.7e-159
WP_004151609.1|2681053_2682319_+	four-carbon acid sugar kinase family protein	NA	A0A077SLJ7	Escherichia_phage	99.5	6.6e-233
WP_002210516.1|2682311_2682932_+	aldolase	NA	A0A077SK32	Escherichia_phage	100.0	8.0e-115
>prophage 5
NZ_CP011980	Klebsiella pneumoniae 500_1420, complete genome	5308211	2909207	2948979	5308211	terminase,integrase	uncultured_Caudovirales_phage(36.17%)	56	2940092:2940106	2946101:2946115
WP_004152576.1|2909207_2910074_-	hypothetical protein	NA	A0A2H4IYR0	uncultured_Caudovirales_phage	64.5	1.9e-34
WP_004152575.1|2910073_2910847_-	DUF2612 domain-containing protein	NA	A0A2H4J1A9	uncultured_Caudovirales_phage	54.4	2.8e-77
WP_004152574.1|2910843_2912040_-	hypothetical protein	NA	A0A0M4RD32	Salmonella_phage	72.9	3.9e-158
WP_004152573.1|2912039_2912393_-	hypothetical protein	NA	A0A2H4J629	uncultured_Caudovirales_phage	80.3	2.3e-50
WP_004152572.1|2912394_2913048_-	hypothetical protein	NA	A0A2H4J8H6	uncultured_Caudovirales_phage	63.5	1.0e-59
WP_004152571.1|2913101_2913668_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004173705.1|2913704_2913890_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004152570.1|2913942_2914284_-	hypothetical protein	NA	A0A2H4J1A5	uncultured_Caudovirales_phage	46.6	1.8e-23
WP_004152569.1|2914283_2915306_-	hypothetical protein	NA	A0A2H4J1B2	uncultured_Caudovirales_phage	54.2	9.2e-100
WP_004152568.1|2915308_2915611_-	hypothetical protein	NA	A0A2H4J495	uncultured_Caudovirales_phage	55.2	2.0e-26
WP_004152567.1|2915611_2916211_-	hypothetical protein	NA	A0A2H4J1B3	uncultured_Caudovirales_phage	57.6	9.9e-54
WP_004152566.1|2916210_2918214_-	lytic transglycosylase domain-containing protein	NA	A0A2H4J9N7	uncultured_Caudovirales_phage	63.6	1.2e-247
WP_004152565.1|2918203_2918356_-	hypothetical protein	NA	A0A2H4J1A2	uncultured_Caudovirales_phage	88.0	7.6e-19
WP_004152564.1|2918391_2918817_-	hypothetical protein	NA	A0A2H4J2V6	uncultured_Caudovirales_phage	63.4	2.6e-40
WP_004152178.1|2920276_2920567_-	DUF3277 family protein	NA	A0A2H4J619	uncultured_Caudovirales_phage	85.5	2.6e-23
WP_004152177.1|2920577_2921723_-	DUF3383 domain-containing protein	NA	A0A2H4J8G4	uncultured_Caudovirales_phage	76.9	6.3e-166
WP_004152176.1|2921726_2922167_-	hypothetical protein	NA	A0A2H4J1A0	uncultured_Caudovirales_phage	51.7	1.6e-40
WP_001116156.1|2922261_2922648_-	hypothetical protein	NA	A0A2H4J1A4	uncultured_Caudovirales_phage	78.2	1.1e-48
WP_000834982.1|2922647_2923154_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000113538.1|2923150_2923570_-	DUF4054 domain-containing protein	NA	A0A0M5M3S2	Salmonella_phage	60.7	3.3e-40
WP_000725700.1|2923538_2923820_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001132269.1|2923859_2924801_-	DUF2184 domain-containing protein	NA	A0A2H4J191	uncultured_Caudovirales_phage	77.1	1.7e-137
WP_000528476.1|2924812_2925307_-	hypothetical protein	NA	A0A2H4JHM9	uncultured_Caudovirales_phage	62.7	4.2e-50
WP_004199270.1|2925310_2926513_-	DUF2213 domain-containing protein	NA	A0A0M4R5A6	Salmonella_phage	54.1	2.6e-106
WP_004152174.1|2926564_2927113_-	hypothetical protein	NA	A0A0M4REK0	Salmonella_phage	56.3	3.0e-49
WP_004152173.1|2927168_2928620_-	DUF1073 domain-containing protein	NA	A0A0M4S6U1	Salmonella_phage	68.8	3.8e-192
WP_004152172.1|2928857_2930258_-|terminase	PBSX family phage terminase large subunit	terminase	A0A077KAW0	Edwardsiella_phage	69.0	9.4e-188
WP_004152171.1|2930208_2930961_-	hypothetical protein	NA	A0A077KBY7	Edwardsiella_phage	66.0	4.0e-12
WP_004152170.1|2931062_2931383_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004153952.1|2931617_2932007_-	lipase chaperone	NA	A0A192Y6H8	Salmonella_phage	49.2	9.4e-21
WP_004152169.1|2932003_2932534_-	lysozyme	NA	K7PLY1	Enterobacteria_phage	77.1	2.7e-79
WP_004146526.1|2932536_2932785_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004152167.1|2933190_2933973_-	antitermination protein	NA	F1C595	Cronobacter_phage	76.8	7.2e-113
WP_004198239.1|2933969_2934446_-	hypothetical protein	NA	A0A286N2Q1	Klebsiella_phage	100.0	1.8e-90
WP_004218023.1|2934442_2935420_-	DNA primase	NA	A0A286N2Q0	Klebsiella_phage	99.4	4.8e-183
WP_004198228.1|2935406_2937065_-	DEAD/DEAH box helicase	NA	A0A286N2P9	Klebsiella_phage	96.0	0.0e+00
WP_004152163.1|2937373_2937667_-	hypothetical protein	NA	A0A286S2B5	Klebsiella_phage	97.6	2.8e-38
WP_004152162.1|2937641_2937863_-	helix-turn-helix transcriptional regulator	NA	A0A286S2C1	Klebsiella_phage	100.0	3.0e-32
WP_004152161.1|2937960_2938629_+	LexA family transcriptional regulator	NA	A0A286S2B2	Klebsiella_phage	99.5	2.4e-125
WP_004152160.1|2938799_2939114_+	hypothetical protein	NA	A0A286S1T9	Klebsiella_phage	100.0	1.0e-49
WP_004152159.1|2939106_2939295_+	hypothetical protein	NA	A0A286S1P8	Klebsiella_phage	100.0	4.6e-26
WP_004152158.1|2939464_2939830_+	hypothetical protein	NA	A0A286S1Q6	Klebsiella_phage	99.2	6.9e-58
WP_004152157.1|2939822_2940077_+	hypothetical protein	NA	A0A286SGR4	Klebsiella_phage	97.6	3.1e-41
2940092:2940106	attL	AGGCGCTGCAGGTCC	NA	NA	NA	NA
WP_004152156.1|2940263_2940689_+	hypothetical protein	NA	A0A286S1S2	Klebsiella_phage	77.9	3.5e-53
WP_004152155.1|2940685_2940880_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004152154.1|2940876_2941704_+	hypothetical protein	NA	Q8W654	Enterobacteria_phage	84.0	5.5e-111
WP_004152153.1|2941808_2942327_+	hypothetical protein	NA	A0A286S1S7	Klebsiella_phage	98.8	1.7e-94
WP_004154298.1|2942332_2943043_+	DNA-binding protein	NA	A0A286S260	Klebsiella_phage	88.3	2.1e-111
WP_004152151.1|2943032_2943257_+	hypothetical protein	NA	A0A286S2B3	Klebsiella_phage	89.2	3.1e-29
WP_004152150.1|2943253_2943466_+	hypothetical protein	NA	A0A286S2B6	Klebsiella_phage	98.6	3.4e-33
WP_004152149.1|2943462_2943942_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004152148.1|2944120_2944363_+	hypothetical protein	NA	A0A0M4RTZ2	Salmonella_phage	73.8	2.2e-20
WP_004152147.1|2944343_2945525_-|integrase	site-specific integrase	integrase	A0A0M4QX09	Salmonella_phage	84.2	5.6e-202
WP_016197745.1|2945721_2946270_+	DJ-1/PfpI family protein	NA	NA	NA	NA	NA
2946101:2946115	attR	GGACCTGCAGCGCCT	NA	NA	NA	NA
WP_004152145.1|2946468_2948001_-	HD domain-containing protein	NA	A0A1B1ISR1	uncultured_Mediterranean_phage	30.0	1.1e-21
WP_004152144.1|2948217_2948979_-	SDR family oxidoreductase	NA	Q06VL0	Trichoplusia_ni_ascovirus	32.5	2.4e-20
>prophage 6
NZ_CP011980	Klebsiella pneumoniae 500_1420, complete genome	5308211	3273352	3288405	5308211		Enterobacteria_phage(30.0%)	13	NA	NA
WP_004199491.1|3273352_3273628_+	hypothetical protein	NA	A0A0M3ULK3	Salmonella_phage	60.9	1.9e-23
WP_004199521.1|3273601_3274171_-	recombinase family protein	NA	A0A286S1P7	Klebsiella_phage	86.8	3.9e-84
WP_020313636.1|3274294_3275791_+	hypothetical protein	NA	A0A0A8J9V7	Klebsiella_phage	35.2	3.2e-69
WP_004199475.1|3275989_3276184_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016197598.1|3276194_3277706_-	hypothetical protein	NA	H6X4Y6	Enterobacteria_phage	33.7	9.8e-58
WP_004199504.1|3278703_3278856_-	DUF1378 family protein	NA	NA	NA	NA	NA
WP_004199533.1|3278852_3279383_-	hypothetical protein	NA	K7P6W1	Enterobacteria_phage	48.9	3.7e-36
WP_004199518.1|3279379_3279919_-	lysozyme	NA	H6WRZ4	Salmonella_phage	78.7	4.5e-82
WP_004199490.1|3279920_3280136_-	hypothetical protein	NA	A5LH82	Enterobacteria_phage	61.0	1.1e-12
WP_071595838.1|3280466_3280619_+	transmembrane anchored protein	NA	G9L6D9	Escherichia_phage	79.6	2.8e-13
WP_004199484.1|3281076_3284001_-	hypothetical protein	NA	W6MWW8	Pseudomonas_phage	41.3	1.8e-196
WP_016197574.1|3284000_3285383_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004199529.1|3285690_3288405_-	lytic transglycosylase domain-containing protein	NA	K4NWI2	Pseudomonas_phage	26.8	2.2e-31
>prophage 7
NZ_CP011980	Klebsiella pneumoniae 500_1420, complete genome	5308211	3292964	3318730	5308211	protease,integrase,tail,head	Pectobacterium_phage(30.77%)	38	3302664:3302678	3319215:3319229
WP_004191050.1|3292964_3293438_-	hypothetical protein	NA	K4NYY6	Pseudomonas_phage	46.3	1.8e-26
WP_004199478.1|3293476_3294472_-	bbp17	NA	W6MW28	Pseudomonas_phage	60.2	2.1e-104
WP_004199538.1|3294482_3295220_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004199528.1|3295206_3295530_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004141558.1|3295532_3297197_-|head,tail	phage head-tail adapter protein	head,tail	A0A221SAN2	Ralstonia_phage	39.4	3.1e-105
WP_004199513.1|3297196_3298591_-	hypothetical protein	NA	A0A0E3JIA1	Rhodoferax_phage	36.4	2.4e-58
WP_004199526.1|3298675_3299128_-	DNA-packaging protein	NA	A3EYX3	Salmonella_phage	66.4	1.1e-49
WP_004199477.1|3299134_3299395_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004199520.1|3299378_3299612_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004199492.1|3299673_3300198_-	DUF2829 domain-containing protein	NA	A0A1B0VMG3	Pseudomonas_phage	54.1	2.5e-45
WP_004199525.1|3300238_3300679_-	phage family protein	NA	R9TRJ4	Aeromonas_phage	43.8	4.3e-14
WP_004199527.1|3300684_3301032_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_071570746.1|3301019_3301343_-	DUF968 domain-containing protein	NA	A0A1I9KFA7	Aeromonas_phage	55.8	6.8e-25
WP_004199500.1|3301332_3301926_-	DUF1367 family protein	NA	H9C173	Pectobacterium_phage	72.1	7.2e-81
WP_004199517.1|3302075_3302261_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004199485.1|3302366_3302705_-	hypothetical protein	NA	A0A193GYX4	Enterobacter_phage	81.1	1.5e-46
3302664:3302678	attL	CGCGCGCTGCGCGGC	NA	NA	NA	NA
WP_004199511.1|3302697_3302901_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004199524.1|3302900_3303116_-	hypothetical protein	NA	K7PKY3	Enterobacterial_phage	65.7	1.8e-21
WP_004199508.1|3303108_3304053_-	DUF551 domain-containing protein	NA	R9TQX3	Aeromonas_phage	68.0	2.1e-37
WP_004199474.1|3304049_3304439_-	hypothetical protein	NA	R9TME7	Aeromonas_phage	36.8	8.8e-11
WP_004199493.1|3304566_3305352_-	hypothetical protein	NA	C7BGF1	Burkholderia_phage	52.9	4.8e-64
WP_004191074.1|3305391_3305625_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016197575.1|3305628_3306279_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004199519.1|3306317_3307706_-	AAA family ATPase	NA	Q8HA30	Enterobacteria_phage	47.3	1.5e-105
WP_020313633.1|3307702_3308671_-	helix-turn-helix domain-containing protein	NA	H9C164	Pectobacterium_phage	73.5	5.5e-38
WP_016197573.1|3308688_3308847_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004199487.1|3308930_3309377_-	hypothetical protein	NA	H9C162	Pectobacterium_phage	56.1	7.4e-30
WP_029499131.1|3309437_3309671_-	helix-turn-helix transcriptional regulator	NA	A0A0U2S629	Escherichia_phage	44.4	5.8e-10
WP_004199482.1|3309777_3310233_+	helix-turn-helix domain-containing protein	NA	A0A0U2QW76	Escherichia_phage	50.0	6.2e-32
WP_020313637.1|3311243_3311477_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004199499.1|3311521_3313654_+	hypothetical protein	NA	H9C157	Pectobacterium_phage	34.6	1.7e-95
WP_004199473.1|3313653_3314220_+	siphovirus Gp157 family protein	NA	H9C156	Pectobacterium_phage	61.5	2.5e-51
WP_004141609.1|3314221_3314407_+	hypothetical protein	NA	H9C155	Pectobacterium_phage	44.3	8.1e-07
WP_071595839.1|3314456_3314651_+	hypothetical protein	NA	H9C154	Pectobacterium_phage	66.1	4.4e-11
WP_004199480.1|3314616_3314841_+	DUF4224 domain-containing protein	NA	H9C153	Pectobacterium_phage	68.1	4.5e-20
WP_016197576.1|3314844_3315873_+|integrase	tyrosine-type recombinase/integrase	integrase	A0A192Y7M7	Salmonella_phage	54.1	4.4e-94
WP_004150834.1|3316148_3317801_-	ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_002898458.1|3318070_3318730_+|protease	FtsH protease modulator YccA	protease	A0A2H4JFM9	uncultured_Caudovirales_phage	46.6	3.2e-37
3319215:3319229	attR	CGCGCGCTGCGCGGC	NA	NA	NA	NA
>prophage 8
NZ_CP011980	Klebsiella pneumoniae 500_1420, complete genome	5308211	3403522	3496475	5308211	portal,terminase,plate,integrase,lysis,protease,capsid,tRNA,tail,head	Salmonella_phage(56.9%)	96	3459050:3459068	3496550:3496568
WP_002898139.1|3403522_3404815_-|tRNA	serine--tRNA ligase	tRNA	A0A1B1IVT2	uncultured_Mediterranean_phage	44.7	7.3e-94
WP_002898137.1|3404905_3406249_-	replication-associated recombination protein A	NA	G3MBE0	Bacillus_virus	40.8	7.3e-81
WP_002898132.1|3406257_3406869_-	outer membrane lipoprotein chaperone LolA	NA	NA	NA	NA	NA
WP_004150846.1|3406991_3411245_-	DNA translocase FtsK	NA	S5VNE3	Mycobacterium_phage	49.2	5.2e-88
WP_000228469.1|3411380_3411875_-	leucine-responsive transcriptional regulator Lrp	NA	NA	NA	NA	NA
WP_004141839.1|3412380_3413376_+	thioredoxin-disulfide reductase	NA	A0A2I2L5E1	Orpheovirus	44.0	3.3e-62
WP_002898017.1|3413490_3415257_+	cysteine/glutathione ABC transporter permease/ATP-binding protein CydD	NA	W8CYL7	Bacillus_phage	25.9	2.3e-21
WP_004150847.1|3415257_3416979_+	cysteine/glutathione ABC transporter ATP-binding protein/permease CydC	NA	A0A2R8FG22	Brazilian_cedratvirus	34.3	1.5e-14
WP_002898014.1|3417023_3417725_+|tRNA	leucyl/phenylalanyl-tRNA--protein transferase	tRNA	NA	NA	NA	NA
WP_001040187.1|3418078_3418297_+	translation initiation factor IF-1	NA	NA	NA	NA	NA
WP_002896522.1|3418417_3420697_-|protease	ATP-dependent Clp protease ATP-binding subunit ClpA	protease	A0A223W0B1	Agrobacterium_phage	42.0	1.6e-165
WP_002896520.1|3420727_3421045_-|protease	ATP-dependent Clp protease adapter ClpS	protease	A0A1B1IT64	uncultured_Mediterranean_phage	45.7	2.0e-13
WP_002896516.1|3421370_3421592_+	cold shock-like protein CspD	NA	A0A2H4N7Y6	Lake_Baikal_phage	61.2	1.3e-16
WP_071528213.1|3421546_3421729_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004150848.1|3421668_3423609_-	macrolide ABC transporter ATP-binding protein/permease MacB	NA	G9BWD6	Planktothrix_phage	40.5	1.9e-37
WP_002896440.1|3423605_3424721_-	macrolide transporter subunit MacA	NA	A0A140XAI1	Dickeya_phage	52.7	1.3e-06
WP_002896437.1|3424867_3426526_-	ATP-dependent endonuclease	NA	NA	NA	NA	NA
WP_002896434.1|3426945_3427641_+	aquaporin Z	NA	NA	NA	NA	NA
WP_004147773.1|3427756_3428656_+	lysine exporter LysO family protein	NA	NA	NA	NA	NA
WP_002896412.1|3428799_3430452_+	hydroxylamine reductase	NA	NA	NA	NA	NA
WP_002896410.1|3430462_3431431_+	NADH oxidoreductase	NA	NA	NA	NA	NA
WP_002896408.1|3431642_3432077_-	DoxX family protein	NA	NA	NA	NA	NA
WP_002896406.1|3432228_3433947_+	ubiquinone-dependent pyruvate dehydrogenase	NA	NA	NA	NA	NA
WP_002896404.1|3433985_3434987_+	low-specificity L-threonine aldolase	NA	NA	NA	NA	NA
WP_002896401.1|3434997_3436440_+	SDR family oxidoreductase	NA	NA	NA	NA	NA
WP_002896399.1|3436527_3437541_+	NAD(P)-dependent oxidoreductase	NA	NA	NA	NA	NA
WP_002896397.1|3437537_3438368_-	N-acetylmuramoyl-L-alanine amidase	NA	A0A1B0UZW5	Roseobacter_phage	31.6	4.1e-05
WP_004150851.1|3438399_3439539_-	GGDEF domain-containing protein	NA	NA	NA	NA	NA
WP_004147767.1|3439591_3439771_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002896394.1|3440416_3440932_+	lipoprotein	NA	NA	NA	NA	NA
WP_002896392.1|3441158_3441887_+	arginine ABC transporter ATP-binding protein ArtP	NA	G9BWD6	Planktothrix_phage	37.1	1.2e-29
WP_002896390.1|3441907_3442639_+	arginine ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_002896386.1|3442645_3443362_+	arginine ABC transporter permease ArtQ	NA	NA	NA	NA	NA
WP_004150852.1|3443361_3444030_+	arginine ABC transporter permease ArtM	NA	NA	NA	NA	NA
WP_002896384.1|3444213_3444945_+	arginine ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_002896382.1|3444987_3446460_-	two-component sensor histidine kinase	NA	W8CYF6	Bacillus_phage	31.8	7.9e-28
WP_002896380.1|3446456_3447173_-	response regulator transcription factor	NA	W8CYM9	Bacillus_phage	36.9	2.1e-34
WP_002896378.1|3447251_3448379_-	23S rRNA (uracil(747)-C(5))-methyltransferase RlmC	NA	A0A2K5B251	Erysipelothrix_phage	25.6	1.3e-19
WP_004198715.1|3448420_3448837_-	DUF2593 family protein	NA	NA	NA	NA	NA
WP_002896372.1|3448968_3449814_-	putrescine ABC transporter permease PotI	NA	NA	NA	NA	NA
WP_002896371.1|3449810_3450764_-	putrescine ABC transporter permease PotH	NA	NA	NA	NA	NA
WP_004176719.1|3450774_3451941_-	putrescine ABC transporter ATP-binding subunit PotG	NA	G3M9Y6	Bacillus_virus	34.9	2.3e-30
WP_002896368.1|3452071_3453184_-	spermidine/putrescine ABC transporter substrate-binding protein PotF	NA	NA	NA	NA	NA
WP_002896365.1|3453532_3454012_-	YbjN domain-containing protein	NA	NA	NA	NA	NA
WP_002896363.1|3454100_3455003_-	30S ribosomal protein S6--L-glutamate ligase	NA	A0A1D7SR78	Cyanophage	35.3	2.0e-34
WP_002896354.1|3455824_3456112_-	YbjC family protein	NA	NA	NA	NA	NA
WP_002896352.1|3456314_3456578_+	GrxA family glutaredoxin	NA	A0A2I7SAE2	Vibrio_phage	73.1	1.6e-27
WP_002896351.1|3456584_3456968_-	membrane protein	NA	NA	NA	NA	NA
WP_004179131.1|3457234_3458920_+	aspartate:alanine antiporter	NA	NA	NA	NA	NA
3459050:3459068	attL	ATGGGTTTTTTGTTGCCTG	NA	NA	NA	NA
WP_000972391.1|3459139_3459358_-	transcriptional activator Ogr/delta	NA	Q53ZE7	Salmonella_virus	69.0	7.5e-20
WP_002896225.1|3459449_3460550_-	phage late control D family protein	NA	A0A1S6KZZ5	Salmonella_phage	87.4	4.9e-176
WP_002896224.1|3460546_3461032_-|tail	phage tail protein	tail	E5G6Q2	Salmonella_phage	75.6	7.2e-63
WP_002896222.1|3461028_3463656_-|tail	phage tail tape measure protein	tail	E5FFG5	Burkholderia_phage	42.0	5.6e-117
WP_002896220.1|3463648_3463768_-|tail	GpE family phage tail protein	tail	E5G6Q0	Salmonella_phage	87.2	2.2e-13
WP_002896204.1|3463782_3464082_-|tail	phage tail assembly protein	tail	E5G6P9	Salmonella_phage	79.0	3.7e-33
WP_002896201.1|3464134_3464650_-|tail	phage major tail tube protein	tail	E5G6P8	Salmonella_phage	85.4	1.3e-81
WP_002896193.1|3464659_3465832_-|tail	phage tail sheath protein	tail	A0A1S6KZY7	Salmonella_phage	93.3	1.9e-210
WP_002896191.1|3465970_3467047_-|tail	phage tail protein	tail	Q37842	Escherichia_phage	44.8	1.2e-25
WP_002896188.1|3467076_3467280_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002896186.1|3467276_3468008_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004152882.1|3468011_3470963_-	hypothetical protein	NA	A0A2H4N7A3	Pectobacterium_phage	50.9	1.2e-06
WP_004150856.1|3470964_3471564_-|tail	phage tail protein I	tail	A0A1S6L000	Salmonella_phage	60.5	1.3e-58
WP_002896182.1|3471556_3472465_-|plate	baseplate assembly protein	plate	E5G6N8	Salmonella_phage	66.9	7.6e-106
WP_002896179.1|3472451_3472814_-|plate	baseplate assembly protein	plate	A0A1S6KZZ4	Salmonella_phage	84.7	5.8e-49
WP_002896177.1|3472810_3473383_-|plate	phage baseplate assembly protein V	plate	E5G6N6	Salmonella_phage	72.3	4.7e-77
WP_004150857.1|3473477_3474170_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002896175.1|3474166_3474613_-	phage virion morphogenesis protein	NA	A0A1S6L001	Salmonella_phage	71.2	2.2e-50
WP_002896172.1|3474605_3475037_-|tail	phage tail protein	tail	A0A1S6KZY0	Salmonella_phage	82.5	9.9e-64
WP_002896168.1|3475132_3475561_-|lysis	LysB family phage lysis regulatory protein	lysis	A0A1S6KZX8	Salmonella_phage	77.9	9.6e-51
WP_002896163.1|3475557_3475941_-	hypothetical protein	NA	A0A1S6KZZ2	Salmonella_phage	42.0	2.1e-17
WP_002896161.1|3475945_3476455_-	lysozyme	NA	E5G6N1	Salmonella_phage	83.4	2.1e-81
WP_002896158.1|3476435_3476651_-	hypothetical protein	NA	E5G6N0	Salmonella_phage	90.1	3.6e-30
WP_002896155.1|3476654_3476858_-|tail	tail protein X	tail	A0A1S6KZY4	Salmonella_phage	88.1	1.3e-29
WP_002896151.1|3476857_3477322_-|head	head completion/stabilization protein	head	A0A1S6KZW8	Salmonella_phage	89.0	8.4e-77
WP_000059191.1|3477417_3478068_-|terminase	terminase endonuclease subunit	terminase	E5G6M7	Salmonella_phage	96.3	8.7e-112
WP_002895972.1|3478071_3479130_-|capsid	phage major capsid protein, P2 family	capsid	E5G6M6	Salmonella_phage	93.1	1.1e-180
WP_002895967.1|3479146_3479980_-|capsid	GPO family capsid scaffolding protein	capsid	A0A1S6KZW9	Salmonella_phage	88.8	6.3e-123
WP_004150858.1|3480122_3481889_+|terminase	terminase ATPase subunit family protein	terminase	A0A1S6KZW3	Salmonella_phage	99.0	0.0e+00
WP_002895959.1|3481888_3482914_+|portal	phage portal protein	portal	A0A1S6KZW5	Salmonella_phage	86.7	7.6e-171
WP_004199124.1|3482975_3484718_-	AIPR family protein	NA	NA	NA	NA	NA
WP_004150861.1|3484993_3485182_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001217575.1|3485785_3486019_-	DinI family protein	NA	E5G6M1	Salmonella_phage	100.0	4.7e-36
WP_001154434.1|3486029_3486218_-	hypothetical protein	NA	E5G6M0	Salmonella_phage	98.4	5.5e-27
WP_004150862.1|3486371_3488786_-	replication endonuclease	NA	E5G6L9	Salmonella_phage	97.5	0.0e+00
WP_004150863.1|3488782_3489640_-	DNA adenine methylase	NA	E5G6L8	Salmonella_phage	95.4	2.0e-156
WP_000752622.1|3489636_3489864_-	TraR/DksA family transcriptional regulator	NA	E5G6L7	Salmonella_phage	98.7	6.0e-36
WP_004150864.1|3489863_3490097_-	DUF2732 family protein	NA	E5G6L6	Salmonella_phage	96.1	4.1e-32
WP_000963473.1|3490164_3490506_-	DUF5347 domain-containing protein	NA	E5G6L5	Salmonella_phage	99.1	4.6e-56
WP_000956179.1|3490469_3490670_-	DUF2724 domain-containing protein	NA	E5G6L4	Salmonella_phage	97.0	1.6e-32
WP_000460893.1|3490677_3491187_-	phage regulatory CII family protein	NA	E5G6L3	Salmonella_phage	98.8	5.8e-87
WP_000188448.1|3491219_3491441_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004152885.1|3491586_3492465_+	phage repressor protein CI	NA	A0A1S6KZZ7	Salmonella_phage	39.9	1.7e-30
WP_004150866.1|3492476_3493421_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004152765.1|3493519_3495004_-	group II intron reverse transcriptase/maturase	NA	A0A0U4J920	Pseudomonas_phage	35.5	1.2e-31
WP_009483812.1|3495003_3495255_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004151720.1|3495422_3496475_+|integrase	tyrosine-type recombinase/integrase	integrase	A0A218M4I3	Erwinia_phage	57.0	1.0e-106
3496550:3496568	attR	ATGGGTTTTTTGTTGCCTG	NA	NA	NA	NA
>prophage 9
NZ_CP011980	Klebsiella pneumoniae 500_1420, complete genome	5308211	3942785	3988060	5308211	integrase,tRNA,lysis,head	Escherichia_phage(26.42%)	62	3935998:3936044	3985132:3985178
3935998:3936044	attL	AATGGCACGCCCTACAGGATTCGAACCTGTGACCTACGGCTTAGAAG	NA	NA	NA	NA
WP_004151249.1|3942785_3945263_-	MoaD/ThiS family protein	NA	F1C5A7	Cronobacter_phage	45.6	2.7e-198
WP_004151250.1|3945249_3945645_-	hypothetical protein	NA	F1C5F2	Cronobacter_phage	54.0	8.0e-36
WP_004199076.1|3945641_3946112_-	hypothetical protein	NA	R9TPR6	Aeromonas_phage	41.0	2.5e-28
WP_004151252.1|3946111_3946588_-	hypothetical protein	NA	A0A2P1MXB5	Escherichia_phage	49.7	3.0e-37
WP_004151253.1|3946630_3950077_-	tape measure protein	NA	Q5G8W8	Enterobacteria_phage	48.6	1.4e-163
WP_004151254.1|3950169_3950673_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004151255.1|3950800_3951586_-	phage repressor protein	NA	A0A2L1IV39	Escherichia_phage	59.7	1.9e-84
WP_004151256.1|3951651_3952365_-	hypothetical protein	NA	H6WRU8	Salmonella_phage	50.2	3.9e-49
WP_004151257.1|3952354_3952525_-	Arc family DNA-binding protein	NA	I6R9A8	Salmonella_phage	87.0	6.1e-17
WP_004151258.1|3952624_3952984_+	Arc family DNA-binding protein	NA	A0A0P0ZBD1	Stx2-converting_phage	47.5	3.8e-16
WP_004151259.1|3953000_3953471_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004151260.1|3953764_3954019_-	hypothetical protein	NA	K7PM89	Enterobacteria_phage	73.0	6.7e-20
WP_004151261.1|3954021_3954777_-	DNA-binding protein	NA	K7PGT4	Enterobacteria_phage	51.0	2.4e-60
WP_004151262.1|3954952_3955630_-	hypothetical protein	NA	F1C5E8	Cronobacter_phage	57.9	4.8e-73
WP_004151263.1|3955682_3956435_-	Ig domain-containing protein	NA	G0ZNE6	Cronobacter_phage	42.1	5.8e-43
WP_004151264.1|3956503_3956896_-	hypothetical protein	NA	G0ZNE4	Cronobacter_phage	52.7	5.1e-35
WP_004151265.1|3956892_3957318_-	hypothetical protein	NA	R9TPP7	Aeromonas_phage	47.9	5.1e-28
WP_004151266.1|3957320_3957683_-	hypothetical protein	NA	A0A173GCE0	Salmonella_phage	45.0	1.8e-18
WP_004151267.1|3957682_3957856_-	hypothetical protein	NA	I6R0P9	Salmonella_phage	56.1	1.4e-13
WP_004151268.1|3957855_3958236_-	hypothetical protein	NA	F1C5E2	Cronobacter_phage	55.3	5.3e-29
WP_004151269.1|3958238_3958478_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004151270.1|3958488_3959583_-	hypothetical protein	NA	F1C5E1	Cronobacter_phage	62.8	1.7e-123
WP_004151271.1|3959594_3960023_-	hypothetical protein	NA	F1C5E0	Cronobacter_phage	60.8	1.6e-42
WP_004151272.1|3960026_3961412_-	DUF2213 domain-containing protein	NA	F1C5D9	Cronobacter_phage	60.0	2.3e-154
WP_004151273.1|3961484_3961961_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004151274.1|3962002_3963007_-|head	phage head morphogenesis protein	head	F1C5D8	Cronobacter_phage	69.7	9.0e-116
WP_004151275.1|3962981_3964403_-	DUF1073 domain-containing protein	NA	F1C5D7	Cronobacter_phage	57.1	9.6e-148
WP_004151276.1|3964415_3965888_-	hypothetical protein	NA	A0A1W6JNY3	Morganella_phage	82.5	1.3e-248
WP_004151277.1|3965887_3966490_-	hypothetical protein	NA	G8C7P2	Escherichia_phage	80.9	5.4e-76
WP_004151279.1|3966860_3967190_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004151280.1|3967295_3967760_-|lysis	lysis protein	lysis	Q76H63	Enterobacteria_phage	73.2	2.4e-55
WP_004151281.1|3967756_3968287_-	lysozyme	NA	G9L6J6	Escherichia_phage	78.5	6.0e-79
WP_004151282.1|3968289_3968538_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004151283.1|3969447_3970137_-	antitermination protein	NA	I6PDF8	Cronobacter_phage	54.5	1.4e-56
WP_004151284.1|3970133_3970664_-	HNH endonuclease	NA	A0A193GYW9	Enterobacter_phage	43.1	5.2e-30
WP_004151286.1|3970790_3971426_-	protein ninG	NA	M9NYX8	Enterobacteria_phage	77.9	2.7e-81
WP_004151287.1|3971418_3971589_-	NinE family protein	NA	G8C7V4	Escherichia_phage	73.2	1.3e-14
WP_004151288.1|3971588_3972044_-	hypothetical protein	NA	K7P7B8	Enterobacteria_phage	69.5	8.0e-56
WP_004151290.1|3972296_3972545_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004151291.1|3972544_3973192_-	DUF551 domain-containing protein	NA	A5LH60	Enterobacteria_phage	32.6	4.5e-12
WP_004151293.1|3973364_3974207_-	translation repressor RelE	NA	A0A2H4FRZ0	Salmonella_phage	60.8	1.8e-29
WP_004151294.1|3974313_3974820_-	hypothetical protein	NA	A0A0A6Z565	Enterobacter_phage	59.6	3.0e-27
WP_004151295.1|3974816_3975110_-	protein ren	NA	O48423	Enterobacteria_phage	65.6	3.3e-26
WP_004151296.1|3975109_3976540_-	AAA family ATPase	NA	Q9MCT4	Escherichia_phage	66.7	2.6e-185
WP_004151297.1|3976529_3977429_-	hypothetical protein	NA	F1C5C3	Cronobacter_phage	54.9	5.4e-88
WP_001548453.1|3977653_3977875_-	hypothetical protein	NA	G8EYH8	Enterobacteria_phage	41.7	6.9e-05
WP_004151299.1|3977915_3978149_-	helix-turn-helix domain-containing protein	NA	G8C7U2	Escherichia_phage	50.7	4.3e-13
WP_004151300.1|3978276_3978966_+	helix-turn-helix transcriptional regulator	NA	G8C7U1	Escherichia_phage	52.2	4.3e-61
WP_004151301.1|3979316_3979532_+	hypothetical protein	NA	B5WZV1	Pseudomonas_phage	48.6	1.6e-09
WP_004151303.1|3979631_3979826_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004151304.1|3979914_3980199_+	host nuclease inhibitor GamL	NA	G8C7T1	Escherichia_phage	62.8	8.0e-30
WP_004151305.1|3980214_3981060_+	phage recombination protein Bet	NA	A0A1I9KF88	Aeromonas_phage	59.2	6.9e-69
WP_004151306.1|3981056_3981737_+	YqaJ viral recombinase family protein	NA	A0A0M3ULE0	Salmonella_phage	93.4	7.9e-124
WP_004151308.1|3981733_3981892_+	DUF1317 family protein	NA	A0A0N7CHV0	Escherichia_phage	60.8	3.0e-10
WP_004151310.1|3981888_3982545_+	DNA methyltransferase	NA	G8C7S6	Escherichia_phage	87.5	2.7e-113
WP_004151312.1|3982541_3983309_+	hypothetical protein	NA	D5LH17	Escherichia_phage	53.4	1.7e-66
WP_004151314.1|3983305_3983524_+	hypothetical protein	NA	A0A1I9LJM7	Stx_converting_phage	47.2	1.2e-09
WP_004151316.1|3983525_3983741_+	TraR/DksA family transcriptional regulator	NA	A0A0K2FI84	Escherichia_phage	52.9	4.0e-13
WP_004151318.1|3983954_3985118_+|integrase	site-specific integrase	integrase	G8C7S0	Escherichia_phage	87.3	3.3e-202
WP_004143017.1|3985548_3986415_+	bifunctional methylenetetrahydrofolate dehydrogenase/methenyltetrahydrofolate cyclohydrolase FolD	NA	A0A249XZQ2	Enterococcus_phage	34.8	1.3e-30
3985132:3985178	attR	AATGGCACGCCCTACAGGATTCGAACCTGTGACCTACGGCTTAGAAG	NA	NA	NA	NA
WP_004143016.1|3986416_3986629_+	ribosome-associated protein YbcJ	NA	NA	NA	NA	NA
WP_004143010.1|3986674_3988060_-|tRNA	cysteine--tRNA ligase	tRNA	M1PG92	Moumouvirus	35.4	3.5e-46
>prophage 10
NZ_CP011980	Klebsiella pneumoniae 500_1420, complete genome	5308211	4197615	4209269	5308211	integrase	Enterobacteria_phage(70.0%)	13	4198065:4198079	4221122:4221136
WP_004144574.1|4197615_4198719_+	glutamate 5-kinase	NA	A0A1X9I5D0	Streptococcus_phage	40.5	4.8e-62
4198065:4198079	attL	CAATCTCTCCGCGCT	NA	NA	NA	NA
WP_002889940.1|4198729_4199983_+	glutamate-5-semialdehyde dehydrogenase	NA	A0A1X9I5D4	Streptococcus_phage	44.9	8.9e-89
WP_002889938.1|4200335_4201526_+|integrase	tyrosine-type recombinase/integrase	integrase	Q7M297	Enterobacteria_phage	62.7	6.4e-145
WP_004152029.1|4201513_4202464_+	AAA family ATPase	NA	A0A1X9IGI7	Lactococcus_phage	27.1	1.2e-13
WP_004152979.1|4202463_4202889_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002889930.1|4203457_4204024_-	phage polarity suppression protein	NA	Q7M2A1	Enterobacteria_phage	64.3	1.5e-59
WP_002889919.1|4204041_4204287_-	hypothetical protein	NA	Q7M294	Enterobacteria_phage	58.0	1.9e-19
WP_002889917.1|4204283_4205021_-	hypothetical protein	NA	Q7M2A2	Enterobacteria_phage	60.7	9.0e-73
WP_002889915.1|4205562_4205829_+	AlpA family transcriptional regulator	NA	Q7M299	Enterobacteria_phage	71.6	2.6e-30
WP_024940872.1|4205825_4206383_+	ash family protein	NA	Q7M2A7	Enterobacteria_phage	70.4	1.8e-33
WP_002889911.1|4206379_4206607_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002889897.1|4206603_4206924_+	DUF5375 domain-containing protein	NA	NA	NA	NA	NA
WP_002889890.1|4206935_4209269_+	DNA primase	NA	Q7M2A8	Enterobacteria_phage	82.2	0.0e+00
4221122:4221136	attR	CAATCTCTCCGCGCT	NA	NA	NA	NA
>prophage 11
NZ_CP011980	Klebsiella pneumoniae 500_1420, complete genome	5308211	4677515	4683340	5308211		Enterobacteria_phage(100.0%)	8	NA	NA
WP_004152207.1|4677515_4679849_-	DNA primase	NA	Q7M2A8	Enterobacteria_phage	83.9	0.0e+00
WP_004152206.1|4679863_4680184_-	DUF5375 domain-containing protein	NA	NA	NA	NA	NA
WP_004152205.1|4680180_4680408_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004153681.1|4680404_4680953_-	ash family protein	NA	Q7M2A7	Enterobacteria_phage	69.4	1.1e-30
WP_000556592.1|4680949_4681216_-	AlpA family transcriptional regulator	NA	Q7M299	Enterobacteria_phage	71.6	2.0e-30
WP_004152204.1|4681776_4682514_+	hypothetical protein	NA	Q7M2A2	Enterobacteria_phage	59.4	1.1e-70
WP_004152203.1|4682510_4682756_+	hypothetical protein	NA	Q7M294	Enterobacteria_phage	56.8	5.5e-19
WP_004152202.1|4682773_4683340_+	phage polarity suppression protein	NA	Q7M2A1	Enterobacteria_phage	63.8	9.7e-59
>prophage 12
NZ_CP011980	Klebsiella pneumoniae 500_1420, complete genome	5308211	4878143	4883230	5308211	transposase	Bacillus_phage(33.33%)	7	NA	NA
WP_004199298.1|4878143_4878827_+	TerC family protein	NA	W8EBD0	Pseudomonas_phage	42.2	5.1e-30
WP_002885338.1|4878972_4879890_+	curved DNA-binding protein	NA	A0A1V0SCV5	Indivirus	42.2	2.8e-07
WP_002885324.1|4879889_4880195_+	chaperone modulator CbpM	NA	NA	NA	NA	NA
WP_004152802.1|4880363_4880885_+|transposase	IS3 family transposase	transposase	A0A1B1P776	Bacillus_phage	33.5	1.3e-14
WP_077249631.1|4880887_4881727_+|transposase	IS3 family transposase	transposase	A0A1B1P773	Bacillus_phage	51.5	8.4e-75
WP_004151723.1|4881892_4882264_-	plasmid stabilization protein	NA	A0A222YWJ6	Escherichia_phage	53.7	2.8e-22
WP_004146678.1|4882273_4883230_-	recombinase	NA	A0A222YXF2	Escherichia_phage	78.0	1.3e-143
>prophage 1
NZ_CP011981	Klebsiella pneumoniae 500_1420 plasmid p500_1420-130.552kb, complete sequence	130552	5122	52214	130552	transposase,protease,integrase	Escherichia_phage(27.78%)	50	NA	NA
WP_004152391.1|5122_6838_-|integrase	tyrosine-type recombinase/integrase	integrase	NA	NA	NA	NA
WP_004152392.1|6947_9977_+|transposase	IS3-like element Tn4401 family transposase	transposase	NA	NA	NA	NA
WP_004199214.1|10083_11109_+|transposase	IS21 family transposase	transposase	A0A2L1IVA1	Escherichia_phage	50.3	1.4e-87
WP_004152394.1|11105_11885_+	AAA family ATPase	NA	A0A2L1IVB6	Escherichia_phage	61.8	2.5e-89
WP_004152395.1|11881_12121_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004199234.1|12172_13054_+	carbapenem-hydrolyzing class A beta-lactamase KPC-2	NA	A0A1B0VBP7	Salmonella_phage	52.2	2.2e-73
WP_004152397.1|13303_14623_-|transposase	IS1182-like element ISKpn6 family transposase	transposase	Q9MBP7	Staphylococcus_prophage	24.2	1.9e-12
WP_004152398.1|14899_16084_-|transposase	ISAs1-like element ISKpn31 family transposase	transposase	NA	NA	NA	NA
WP_004152400.1|16587_16947_+	DUF305 domain-containing protein	NA	A0A218MND9	uncultured_virus	62.0	3.6e-19
WP_004152401.1|17603_18014_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004152402.1|18112_18733_-	recombinase family protein	NA	A0A219Y912	Aeromonas_phage	31.5	2.0e-09
WP_004152403.1|18821_21719_-|transposase	Tn3-like element Tn5403 family transposase	transposase	A0A1B0V7H9	Salmonella_phage	37.7	2.7e-181
WP_001067855.1|21791_22496_+|transposase	IS6-like element IS26 family transposase	transposase	A0A077SL39	Escherichia_phage	100.0	1.8e-139
WP_004153729.1|23351_24179_+	phosphonate ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	37.6	2.6e-20
WP_004152695.1|24175_25039_+	phosphate/phosphite/phosphonate ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_004152694.1|25047_25875_+	phosphonate ABC transporter, permease protein PhnE	NA	NA	NA	NA	NA
WP_004152693.1|25883_26894_+	phosphonate dehydrogenase PtxD	NA	A0A1V0SBV6	Catovirus	25.1	1.4e-15
WP_004152692.1|26887_27757_+	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_004159231.1|28462_28789_-	hypothetical protein	NA	NA	NA	NA	NA
WP_032188295.1|28840_28927_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000019473.1|28965_29946_-|transposase	IS5-like element ISKpn26 family transposase	transposase	Q38213	Escherichia_phage	99.1	8.9e-185
WP_004171426.1|31086_31833_-|transposase	transposase	transposase	A0A218MNE7	uncultured_virus	72.7	4.8e-05
WP_004152118.1|31932_32214_+	helix-turn-helix domain-containing protein	NA	A0A1B1IUF9	uncultured_Mediterranean_phage	38.2	5.2e-05
WP_004152117.1|32248_32818_+	small heat shock protein sHSP20	NA	NA	NA	NA	NA
WP_004152116.1|32932_35728_+	heat shock survival AAA family ATPase ClpK	NA	K4FB40	Cronobacter_phage	41.0	5.2e-129
WP_004152115.1|35727_35925_+	hypothetical protein	NA	NA	NA	NA	NA
WP_009483782.1|36162_36912_+	diguanylate cyclase	NA	NA	NA	NA	NA
WP_004152113.1|36898_37861_+|protease	M48 family metalloprotease	protease	NA	NA	NA	NA
WP_071527923.1|38001_38481_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_004152111.1|38477_39203_+|transposase	IS3 family transposase	transposase	A0A1B1P773	Bacillus_phage	41.4	2.4e-46
WP_020314316.1|39703_41050_-|transposase	ISNCY family transposase	transposase	NA	NA	NA	NA
WP_003026803.1|41261_41744_-	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_003026799.1|41731_41998_-	DUF1778 domain-containing protein	NA	NA	NA	NA	NA
WP_004152108.1|42173_42428_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004152107.1|42503_42761_-	hypothetical protein	NA	NA	NA	NA	NA
WP_052536218.1|42809_43004_-	hemolysin expression modulator Hha	NA	NA	NA	NA	NA
WP_000019473.1|43117_44098_-|transposase	IS5-like element ISKpn26 family transposase	transposase	Q38213	Escherichia_phage	99.1	8.9e-185
WP_004152105.1|44246_44615_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004152104.1|44658_45153_-	DNA-binding protein	NA	NA	NA	NA	NA
WP_004152103.1|45183_45759_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004152102.1|45746_46016_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004153649.1|46676_46883_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004152336.1|46928_47237_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004152337.1|47264_47594_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004152338.1|47661_48018_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004152339.1|48024_48357_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004152340.1|48356_49139_+|integrase	phage integrase family protein	integrase	I3WFA4	Macacine_betaherpesvirus	90.2	4.6e-51
WP_004164986.1|49993_50188_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004152341.1|50352_50826_-	YkgJ family cysteine cluster protein	NA	NA	NA	NA	NA
WP_004152342.1|50945_52214_-|transposase	ISL3-like element ISKpn25 family transposase	transposase	Q6V7R1	Burkholderia_virus	34.7	5.2e-60
>prophage 2
NZ_CP011981	Klebsiella pneumoniae 500_1420 plasmid p500_1420-130.552kb, complete sequence	130552	56789	68881	130552		Enterobacteria_phage(25.0%)	13	NA	NA
WP_004152345.1|56789_58817_-	SAM-dependent DNA methyltransferase	NA	A0A220A2U5	Liberibacter_phage	26.6	2.1e-26
WP_004227314.1|58928_59144_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004152347.1|59368_59701_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004197751.1|59720_59906_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004152348.1|60077_61052_-	ParB/RepB/Spo0J family partition protein	NA	Q1MVJ4	Enterobacteria_phage	62.3	1.4e-105
WP_004152349.1|61048_62254_-	ParA family protein	NA	Q1MVJ3	Enterobacteria_phage	89.0	7.3e-205
WP_004152350.1|62575_63472_-	RepB family plasmid replication initiator protein	NA	Q71TL8	Escherichia_phage	53.8	3.3e-69
WP_004152351.1|63872_65144_-	Y-family DNA polymerase	NA	F1C5A5	Cronobacter_phage	63.7	3.6e-154
WP_004152352.1|65143_65575_-	translesion error-prone DNA polymerase V autoproteolytic subunit	NA	A0A1W6JNS2	Morganella_phage	52.5	1.0e-28
WP_004152353.1|65806_66778_+	mediator of plasmid stability	NA	A0A222YXF2	Escherichia_phage	46.8	1.1e-73
WP_004152354.1|66780_67452_+	mediator of plasmid stability	NA	NA	NA	NA	NA
WP_001568040.1|67512_67743_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004152355.1|68179_68881_+	DNA methylase	NA	A0A2I7RE86	Vibrio_phage	36.7	7.1e-27
>prophage 1
NZ_CP011983	Klebsiella pneumoniae 500_1420 plasmid p500_1420-43.380kb, complete sequence	43380	3248	13546	43380	transposase	Escherichia_phage(55.56%)	11	NA	NA
WP_000516402.1|3248_3911_-	peptidyl-arginine deiminase	NA	E5FFJ3	Burkholderia_phage	25.2	2.6e-07
WP_001549893.1|4291_4954_+	recombinase family protein	NA	M9Q1K0	Clostridium_phage	29.1	9.7e-10
WP_001549892.1|5040_5280_+	hypothetical protein	NA	I6PD82	Cronobacter_phage	55.1	4.4e-21
WP_004199403.1|5282_5639_+	hypothetical protein	NA	A0A222YZE2	Escherichia_phage	46.6	5.5e-20
WP_001067855.1|5672_6377_-|transposase	IS6-like element IS26 family transposase	transposase	A0A077SL39	Escherichia_phage	100.0	1.8e-139
WP_071538079.1|6367_6550_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002904004.1|6513_7374_+	class A extended-spectrum beta-lactamase SHV-12	NA	A0A077SL40	Escherichia_phage	99.3	2.2e-155
WP_002210513.1|7394_8156_-	DeoR/GlpR transcriptional regulator	NA	A0A077SK06	Escherichia_phage	100.0	1.9e-134
WP_023148136.1|8146_8380_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002903955.1|8417_9320_+	NAD(P)-dependent oxidoreductase	NA	A0A077SLF7	Escherichia_phage	99.7	2.6e-159
WP_004199413.1|10528_13546_-|transposase	Tn3-like element IS3000 family transposase	transposase	A0A125RQ78	Bacillus_phage	24.7	5.5e-52
