The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
NC_021224	Lactobacillus plantarum subsp. plantarum P-8, complete sequence	3035719	300591	356246	3035719	bacteriocin,transposase,protease	unidentified_phage(28.57%)	48	NA	NA
WP_015639911.1|300591_301521_+|transposase	IS30-like element ISLpl1 family transposase	transposase	H7BW61	unidentified_phage	31.8	8.5e-20
WP_041142848.1|301633_303001_-	aldehyde dehydrogenase family protein	NA	NA	NA	NA	NA
WP_003641904.1|303426_304290_+	class II fructose-1,6-bisphosphate aldolase	NA	NA	NA	NA	NA
WP_003646426.1|304582_305899_-	MFS transporter	NA	NA	NA	NA	NA
WP_003646427.1|306068_306971_-	SPFH/Band 7/PHB domain protein	NA	NA	NA	NA	NA
WP_003641907.1|306983_307184_-	hypothetical protein	NA	NA	NA	NA	NA
WP_015639914.1|307866_309279_+	C69 family dipeptidase	NA	NA	NA	NA	NA
WP_003641910.1|309344_309590_+	hypothetical protein	NA	NA	NA	NA	NA
WP_041142657.1|309718_310282_+	biotin transporter BioY	NA	NA	NA	NA	NA
WP_003646429.1|310319_311291_+	biotin--[acetyl-CoA-carboxylase] ligase	NA	NA	NA	NA	NA
WP_003646430.1|311287_311608_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003646431.1|311761_312937_+	pyridoxal phosphate-dependent aminotransferase	NA	NA	NA	NA	NA
WP_003646432.1|313112_314279_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003646433.1|314873_315689_+	ABC transporter permease	NA	NA	NA	NA	NA
WP_003641921.1|315701_316793_+	ABC transporter ATP-binding protein	NA	A0A2H4PQG7	Staphylococcus_phage	29.7	7.2e-18
WP_003643757.1|317171_317444_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003646434.1|317670_318213_+	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_015639920.1|318209_319655_+	MFS transporter	NA	NA	NA	NA	NA
WP_003643760.1|319984_321301_-	ammonium transporter	NA	H8ZJB2	Ostreococcus_tauri_virus	29.6	1.1e-33
WP_015639922.1|321582_322512_-|transposase	IS30 family transposase	transposase	H7BW61	unidentified_phage	32.6	3.8e-20
WP_003646436.1|322843_323803_+	L-lactate dehydrogenase	NA	NA	NA	NA	NA
WP_003641927.1|323905_324175_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003646437.1|325160_325829_+	ribose 5-phosphate isomerase A	NA	NA	NA	NA	NA
WP_015639924.1|325986_327492_+	multicopper oxidase domain-containing protein	NA	NA	NA	NA	NA
WP_003643763.1|327756_328125_+	DUF1304 domain-containing protein	NA	NA	NA	NA	NA
WP_003641932.1|328237_328747_-	YbhB/YbcL family Raf kinase inhibitor-like protein	NA	NA	NA	NA	NA
WP_015639925.1|328777_329974_-	DUF2075 domain-containing protein	NA	NA	NA	NA	NA
WP_003646440.1|330083_330554_+	Rrf2 family transcriptional regulator	NA	NA	NA	NA	NA
WP_003641935.1|330572_331028_+	hypothetical protein	NA	NA	NA	NA	NA
WP_015639927.1|331131_331704_+	acetyl-CoA carboxylase biotin carboxyl carrier protein subunit	NA	NA	NA	NA	NA
WP_003646441.1|331869_332790_-	ribonucleoside hydrolase RihC	NA	NA	NA	NA	NA
WP_003643768.1|332926_333838_+	oxidoreductase	NA	NA	NA	NA	NA
WP_003646442.1|334727_335174_-	ribonuclease H	NA	NA	NA	NA	NA
WP_015639929.1|335411_336938_+	ABC transporter permease/substrate-binding protein	NA	NA	NA	NA	NA
WP_003641941.1|336938_337910_+	ABC transporter ATP-binding protein	NA	G3M9Y6	Bacillus_virus	31.7	1.7e-23
WP_003646444.1|337987_339319_+	NAD(P)/FAD-dependent oxidoreductase	NA	NA	NA	NA	NA
WP_003643773.1|339784_341302_+	glycerol kinase GlpK	NA	NA	NA	NA	NA
WP_015639932.1|341316_343146_+	type 1 glycerol-3-phosphate oxidase	NA	NA	NA	NA	NA
WP_003641945.1|343160_343883_+	aquaporin family protein	NA	M1HWZ0	Paramecium_bursaria_Chlorella_virus	31.9	3.2e-30
WP_015639934.1|344077_346426_+	MucBP domain-containing protein	NA	NA	NA	NA	NA
WP_041142658.1|346427_348260_+	extracellular protein, lysine-rich	NA	NA	NA	NA	NA
WP_003646448.1|348265_348499_+	hypothetical protein	NA	NA	NA	NA	NA
WP_015639937.1|348928_350104_-|transposase	IS256 family transposase	transposase	NA	NA	NA	NA
WP_003646470.1|350437_351211_-|protease	CPBP family intramembrane metalloprotease	protease	NA	NA	NA	NA
WP_003643811.1|351309_351468_-|bacteriocin	two-peptide bacteriocin plantaricin EF subunit PlnF	bacteriocin	NA	NA	NA	NA
WP_003646472.1|351924_354075_+	peptide cleavage/export ABC transporter	NA	W8CYL7	Bacillus_phage	27.9	6.1e-45
WP_003646473.1|354090_355467_+	HlyD family secretion protein	NA	NA	NA	NA	NA
WP_015639939.1|355556_356246_+|protease	CPBP family intramembrane metalloprotease	protease	NA	NA	NA	NA
>prophage 2
NC_021224	Lactobacillus plantarum subsp. plantarum P-8, complete sequence	3035719	541302	549927	3035719		Streptococcus_phage(66.67%)	11	NA	NA
WP_015640011.1|541302_543000_+	DNA polymerase III subunit gamma/tau	NA	A0A1U9WR94	Streptococcus_virus	37.3	1.3e-55
WP_015640012.1|543021_543330_+	YbaB/EbfC family nucleoid-associated protein	NA	NA	NA	NA	NA
WP_003637790.1|543345_543945_+	recombination protein RecR	NA	NA	NA	NA	NA
WP_003640957.1|543959_544211_+	YaaL family protein	NA	NA	NA	NA	NA
WP_003644908.1|544609_545275_+	dTMP kinase	NA	M1PSC7	Streptococcus_phage	52.7	1.4e-53
WP_003640965.1|545271_545601_+	cyclic-di-AMP receptor	NA	NA	NA	NA	NA
WP_003640966.1|545617_546637_+	DNA polymerase III subunit delta'	NA	M1NSC1	Streptococcus_phage	33.5	2.1e-32
WP_003640967.1|546661_547009_+	DNA replication initiation control protein YabA	NA	M1PFV3	Streptococcus_phage	33.3	2.4e-12
WP_003643942.1|547107_548004_+	16S rRNA (cytidine(1402)-2'-O)-methyltransferase	NA	M1PLC5	Streptococcus_phage	55.7	9.9e-82
WP_041142670.1|548007_548793_+	acyl-ACP thioesterase	NA	NA	NA	NA	NA
WP_003643943.1|548931_549927_+	UDP-glucose 4-epimerase GalE	NA	A0A2K9L5H6	Tupanvirus	38.2	5.9e-51
>prophage 3
NC_021224	Lactobacillus plantarum subsp. plantarum P-8, complete sequence	3035719	749006	777815	3035719	integrase,transposase,protease	unidentified_phage(28.57%)	21	775608:775629	778379:778400
WP_001748085.1|749006_750182_+|transposase	IS256 family transposase	transposase	NA	NA	NA	NA
WP_003645770.1|750602_751286_+|protease	CPBP family intramembrane metalloprotease	protease	NA	NA	NA	NA
WP_003645769.1|751505_751850_+	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_003645768.1|752005_752713_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_015640093.1|752721_753597_+|transposase	IS3 family transposase	transposase	U5P429	Shigella_phage	28.9	2.8e-20
WP_015640094.1|753673_754972_-	MFS transporter	NA	NA	NA	NA	NA
WP_015640096.1|757401_758331_+|transposase	IS30 family transposase	transposase	H7BW61	unidentified_phage	33.2	1.7e-20
WP_015640098.1|759278_759662_+	MORN motif-containing protein	NA	NA	NA	NA	NA
WP_003645763.1|759651_761499_+	acetyltransferase	NA	A0A1R3Y5Q6	Salmonella_virus	23.7	5.8e-20
WP_003641172.1|761739_761994_+	GlsB/YeaQ/YmgE family stress response membrane protein	NA	NA	NA	NA	NA
WP_003644045.1|762005_762551_+	alkaline shock response membrane anchor protein AmaP	NA	NA	NA	NA	NA
WP_003641174.1|762563_762746_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003644046.1|762760_763183_+	Asp23/Gls24 family envelope stress response protein	NA	NA	NA	NA	NA
WP_003641176.1|763243_763684_+	Asp23/Gls24 family envelope stress response protein	NA	NA	NA	NA	NA
WP_016511031.1|763887_764688_+	fumarylacetoacetate hydrolase family protein	NA	NA	NA	NA	NA
WP_041142679.1|764819_765830_+	DUF4767 domain-containing protein	NA	NA	NA	NA	NA
WP_003644050.1|766629_767202_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003645758.1|767383_769918_+	M1 family metallopeptidase	NA	A0A0P0IY26	Acinetobacter_phage	27.4	3.5e-68
WP_015639922.1|770642_771572_-|transposase	IS30 family transposase	transposase	H7BW61	unidentified_phage	32.6	3.8e-20
WP_015640108.1|775555_776746_+	restriction endonuclease subunit S	NA	A0A2H4PQP5	Staphylococcus_phage	27.5	8.1e-15
775608:775629	attL	CTTGGGAGCAGCGTAAGCTAAA	NA	NA	NA	NA
WP_015379944.1|776897_777815_+|integrase	site-specific integrase	integrase	A8ATM2	Listeria_phage	44.7	2.7e-74
WP_015379944.1|776897_777815_+|integrase	site-specific integrase	integrase	A8ATM2	Listeria_phage	44.7	2.7e-74
778379:778400	attR	TTTAGCTTACGCTGCTCCCAAG	NA	NA	NA	NA
>prophage 4
NC_021224	Lactobacillus plantarum subsp. plantarum P-8, complete sequence	3035719	1144276	1154114	3035719		Lactobacillus_phage(87.5%)	9	NA	NA
WP_015640258.1|1144276_1145506_+	hypothetical protein	NA	A0A2P0ZL72	Lactobacillus_phage	97.7	2.7e-215
WP_015640259.1|1145596_1146568_-	Nisin resistance protein	NA	A0A2P0ZL68	Lactobacillus_phage	98.8	2.0e-181
WP_003645222.1|1146753_1147701_-	LysR family transcriptional regulator	NA	A0A2P0ZL89	Lactobacillus_phage	99.7	1.7e-177
WP_003643097.1|1148044_1148659_+	NAD(P)H-dependent oxidoreductase	NA	A0A2P0ZL77	Lactobacillus_phage	100.0	6.3e-112
WP_015380220.1|1148661_1151100_+	flavocytochrome c	NA	A0A2P0ZL82	Lactobacillus_phage	99.5	0.0e+00
WP_003643095.1|1151187_1151748_+	hypothetical protein	NA	A0A2P0ZL75	Lactobacillus_phage	100.0	2.7e-101
WP_003643094.1|1151818_1152259_-	nucleoside 2-deoxyribosyltransferase	NA	A0A2P0ZL88	Lactobacillus_phage	99.3	8.0e-77
WP_015380221.1|1152354_1152492_+	LPXTG cell wall anchor domain-containing protein	NA	NA	NA	NA	NA
WP_003645220.1|1153118_1154114_+	glycosyltransferase family 2 protein	NA	S5FKN0	Shigella_phage	38.8	3.1e-52
>prophage 5
NC_021224	Lactobacillus plantarum subsp. plantarum P-8, complete sequence	3035719	1650569	1736475	3035719	protease,tRNA,terminase,tail,integrase,capsid,portal,head	Lactobacillus_phage(77.55%)	95	1676115:1676132	1743406:1743423
WP_003645968.1|1650569_1651493_-|tRNA	tRNA pseudouridine(55) synthase TruB	tRNA	NA	NA	NA	NA
WP_003645967.1|1651977_1652499_-	shikimate kinase	NA	NA	NA	NA	NA
WP_041142729.1|1652501_1653599_-	prephenate dehydrogenase	NA	NA	NA	NA	NA
WP_015640474.1|1653601_1654864_-	3-phosphoshikimate 1-carboxyvinyltransferase	NA	NA	NA	NA	NA
WP_003645964.1|1654877_1655405_-	amino acid biosynthesis protein	NA	NA	NA	NA	NA
WP_003640721.1|1655413_1656583_-	chorismate synthase	NA	NA	NA	NA	NA
WP_041142730.1|1656575_1658030_-	MFS transporter	NA	NA	NA	NA	NA
WP_003640723.1|1658678_1659032_-	30S ribosome-binding factor RbfA	NA	NA	NA	NA	NA
WP_003645962.1|1659054_1661631_-	translation initiation factor IF-2	NA	A0A2H4UTS4	Bodo_saltans_virus	23.3	9.6e-21
WP_041142731.1|1661645_1661951_-	ribosomal L7Ae/L30e/S12e/Gadd45 family protein	NA	NA	NA	NA	NA
WP_003640726.1|1661940_1662240_-	YlxR family protein	NA	NA	NA	NA	NA
WP_003640727.1|1662284_1663502_-	transcription termination/antitermination protein NusA	NA	NA	NA	NA	NA
WP_003640728.1|1663522_1663999_-	ribosome maturation factor RimP	NA	NA	NA	NA	NA
WP_015640478.1|1664294_1668608_-	PolC-type DNA polymerase III	NA	A0A1X9SH08	Bradyrhizobium_phage	34.0	1.0e-14
WP_003640732.1|1669101_1670811_-|tRNA	proline--tRNA ligase	tRNA	NA	NA	NA	NA
WP_003640733.1|1670850_1672128_-|protease	RIP metalloprotease RseP	protease	NA	NA	NA	NA
WP_003640734.1|1672165_1672951_-	phosphatidate cytidylyltransferase	NA	NA	NA	NA	NA
WP_003640735.1|1672966_1673746_-	isoprenyl transferase	NA	R9W0U9	Flavobacterium_phage	43.1	1.1e-23
WP_003640736.1|1673865_1674429_-	ribosome recycling factor	NA	NA	NA	NA	NA
WP_003640737.1|1674430_1675153_-	UMP kinase	NA	NA	NA	NA	NA
WP_003644498.1|1675352_1676231_-	elongation factor Ts	NA	NA	NA	NA	NA
1676115:1676132	attL	GTCAACGGCTTTTTCCAT	NA	NA	NA	NA
WP_003640739.1|1676333_1677137_-	30S ribosomal protein S2	NA	NA	NA	NA	NA
WP_003640740.1|1677361_1678084_+	HAD family hydrolase	NA	NA	NA	NA	NA
WP_003640741.1|1678373_1679372_-	D-2-hydroxyacid dehydrogenase	NA	M1HKI4	Acanthocystis_turfacea_Chlorella_virus	34.9	2.3e-47
WP_003645628.1|1679456_1679762_-	GIY-YIG nuclease family protein	NA	NA	NA	NA	NA
WP_003645629.1|1679745_1680504_-|tRNA	tRNA1(Val) (adenine(37)-N6)-methyltransferase	tRNA	NA	NA	NA	NA
WP_003645630.1|1680615_1681251_+	1-acyl-sn-glycerol-3-phosphate acyltransferase	NA	NA	NA	NA	NA
WP_003640745.1|1681307_1681544_-	YneF family protein	NA	NA	NA	NA	NA
WP_003644501.1|1681641_1681881_-	DUF896 domain-containing protein	NA	NA	NA	NA	NA
WP_003640747.1|1682032_1682665_+	transcriptional repressor LexA	NA	A0A1B2APZ1	Phage_Wrath	56.2	2.3e-16
WP_089197934.1|1682754_1682985_-	DNA alkylation repair protein	NA	NA	NA	NA	NA
WP_003645631.1|1683288_1683918_+	hypothetical protein	NA	NA	NA	NA	NA
WP_015380455.1|1683967_1685137_-	hydroxymethylglutaryl-CoA synthase	NA	NA	NA	NA	NA
WP_003645633.1|1685172_1685565_-	hypothetical protein	NA	NA	NA	NA	NA
WP_015640487.1|1685728_1686121_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003645635.1|1686566_1687508_+	glycosyltransferase family 2 protein	NA	V9QJB1	Oenococcus_phage	48.7	3.1e-78
WP_003645636.1|1688207_1688780_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_080316528.1|1688931_1690116_-	LCP family protein	NA	NA	NA	NA	NA
WP_003645638.1|1690096_1690888_-	ABC transporter ATP-binding protein	NA	G3M9Y6	Bacillus_virus	36.8	4.5e-30
WP_015640489.1|1690906_1692649_-	ABC transporter permease subunit	NA	NA	NA	NA	NA
WP_003645640.1|1693127_1694339_-	FtsW/RodA/SpoVE family cell cycle protein	NA	NA	NA	NA	NA
WP_015640490.1|1695127_1695505_-	hypothetical protein	NA	A0A2K9VCG4	Lactobacillus_phage	61.2	3.7e-14
WP_015640491.1|1695515_1695779_-	hemolysin XhlA family protein	NA	E9LUR9	Lactobacillus_phage	98.9	7.4e-38
WP_015640492.1|1695778_1696939_-	LysM peptidoglycan-binding domain-containing protein	NA	E9LUR8	Lactobacillus_phage	86.7	1.0e-192
WP_015640493.1|1696951_1697212_-	hypothetical protein	NA	A0A0A1ENR9	Lactobacillus_phage	84.2	6.5e-18
WP_041142732.1|1697208_1698306_-	collagen-like protein	NA	A0A2P0ZLF6	Lactobacillus_phage	88.5	2.2e-59
WP_003641410.1|1698289_1698451_-	hypothetical protein	NA	A0A2P0ZLG1	Lactobacillus_phage	96.2	4.7e-19
WP_015640495.1|1698466_1698709_-	hypothetical protein	NA	A0A1S5RCP9	Lactobacillus_phage	93.8	1.2e-34
WP_015640497.1|1700797_1703155_-|tail	phage tail protein	tail	E9LUR3	Lactobacillus_phage	89.9	0.0e+00
WP_015640498.1|1703218_1704988_-|tail	phage tail family protein	tail	E9LUR2	Lactobacillus_phage	89.1	0.0e+00
WP_015640499.1|1705060_1709956_-	C40 family peptidase	NA	A0A2P0ZLG0	Lactobacillus_phage	61.5	0.0e+00
WP_015640500.1|1709987_1710173_-	hypothetical protein	NA	NA	NA	NA	NA
WP_015640501.1|1710217_1710592_-|tail	phage tail assembly chaperone	tail	A0A2P0ZLH4	Lactobacillus_phage	94.4	4.6e-57
WP_041142733.1|1710667_1711324_-|tail	phage tail protein	tail	A0A2P0ZLH1	Lactobacillus_phage	86.4	1.4e-101
WP_015640503.1|1711339_1711720_-	DUF806 family protein	NA	A0A2P0ZLF4	Lactobacillus_phage	88.9	3.2e-58
WP_015640504.1|1711719_1712127_-	HK97 gp10 family phage protein	NA	A0A2P0ZLE6	Lactobacillus_phage	93.2	6.5e-65
WP_041142734.1|1712129_1712477_-|head	phage head closure protein	head	A0A2P0ZLF0	Lactobacillus_phage	72.2	1.2e-43
WP_041142735.1|1712466_1712799_-|head,tail	phage gp6-like head-tail connector protein	head,tail	E9LUQ4	Lactobacillus_phage	89.8	1.7e-47
WP_015640507.1|1712871_1714092_-|capsid	phage major capsid protein	capsid	E9LUQ3	Lactobacillus_phage	89.3	2.2e-201
WP_041142736.1|1714091_1714847_-|protease	Clp protease ClpP	protease	E9LUQ2	Lactobacillus_phage	92.8	8.8e-124
WP_015640509.1|1714824_1716018_-|portal	phage portal protein	portal	E9LUQ1	Lactobacillus_phage	98.5	1.2e-223
WP_041142737.1|1716020_1716215_-	DUF1056 family protein	NA	E9LUQ0	Lactobacillus_phage	93.8	2.8e-26
WP_015640511.1|1716204_1718103_-|terminase	terminase large subunit	terminase	E9LUP9	Lactobacillus_phage	96.0	0.0e+00
WP_015640512.1|1718105_1718564_-|terminase	phage terminase small subunit P27 family	terminase	E9LUP8	Lactobacillus_phage	96.7	8.0e-80
WP_041142738.1|1718733_1718994_-	hypothetical protein	NA	NA	NA	NA	NA
WP_134987746.1|1718999_1719470_-	HNH endonuclease	NA	E9LUP7	Lactobacillus_phage	91.6	8.2e-80
WP_041142740.1|1719480_1719633_-	hypothetical protein	NA	NA	NA	NA	NA
WP_015640516.1|1720048_1720474_-	RinA family phage transcriptional regulator	NA	E9LUP5	Lactobacillus_phage	87.9	3.2e-67
WP_041142741.1|1720454_1720625_-	hypothetical protein	NA	E9LUP4	Lactobacillus_phage	91.1	8.5e-19
WP_015640518.1|1720627_1721029_-	hypothetical protein	NA	E9LUP3	Lactobacillus_phage	76.7	3.2e-56
WP_131067371.1|1721025_1721433_-	hypothetical protein	NA	A0A2P0ZKS9	Lactobacillus_phage	36.9	7.8e-10
WP_015640520.1|1721447_1721597_-	hypothetical protein	NA	NA	NA	NA	NA
WP_041142742.1|1721639_1722647_-	DNA cytosine methyltransferase	NA	A0A1I9KKE7	Lactobacillus_phage	68.0	1.2e-144
WP_015640522.1|1722661_1722871_-	hypothetical protein	NA	NA	NA	NA	NA
WP_015640523.1|1722970_1723351_-	hypothetical protein	NA	NA	NA	NA	NA
WP_015640524.1|1723347_1723848_-	hypothetical protein	NA	O03915	Lactobacillus_phage	64.2	2.0e-55
WP_015640525.1|1723983_1724769_-	ATP-binding protein	NA	E9LUN6	Lactobacillus_phage	98.5	2.1e-144
WP_015640526.1|1724768_1725575_-	hypothetical protein	NA	A0A0S2MYA8	Enterococcus_phage	36.9	2.3e-45
WP_041142744.1|1725624_1726317_-	hypothetical protein	NA	E9LUU3	Lactobacillus_phage	97.8	8.9e-131
WP_015640528.1|1726363_1727023_-	DUF669 domain-containing protein	NA	E9LUU2	Lactobacillus_phage	80.8	3.5e-76
WP_041142745.1|1727025_1727688_-	AAA family ATPase	NA	E9LUU1	Lactobacillus_phage	95.5	1.2e-116
WP_015640530.1|1727688_1728549_-	DUF1351 domain-containing protein	NA	A0A0P0IV40	Lactobacillus_phage	34.4	2.4e-37
WP_015640531.1|1728548_1728695_-	hypothetical protein	NA	E9LUT9	Lactobacillus_phage	91.5	1.5e-16
WP_173424401.1|1728697_1728862_-	hypothetical protein	NA	E9LUT8	Lactobacillus_phage	85.1	7.2e-15
WP_015640532.1|1729077_1729332_-	hypothetical protein	NA	NA	NA	NA	NA
WP_041142746.1|1729474_1729735_-	hypothetical protein	NA	NA	NA	NA	NA
WP_164878070.1|1730413_1730578_-	hypothetical protein	NA	NA	NA	NA	NA
WP_041142747.1|1730591_1731299_-	Rha family transcriptional regulator	NA	D2IYT0	Enterococcus_phage	58.5	1.2e-63
WP_041142748.1|1731356_1731734_+	hypothetical protein	NA	NA	NA	NA	NA
WP_027821294.1|1732004_1732220_-	helix-turn-helix transcriptional regulator	NA	A0A2H4JBV7	uncultured_Caudovirales_phage	71.0	5.9e-17
WP_015640539.1|1732412_1733084_+	LexA family transcriptional regulator	NA	D7RWL5	Brochothrix_phage	47.6	3.8e-46
WP_041142749.1|1733208_1733784_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003641358.1|1733789_1733990_+	hypothetical protein	NA	E9LUS6	Lactobacillus_phage	100.0	4.9e-26
WP_003641356.1|1734829_1735144_+	hypothetical protein	NA	NA	NA	NA	NA
WP_041142750.1|1735311_1736475_+|integrase	site-specific integrase	integrase	B4XYR4	Lactobacillus_phage	36.2	1.6e-55
1743406:1743423	attR	GTCAACGGCTTTTTCCAT	NA	NA	NA	NA
>prophage 6
NC_021224	Lactobacillus plantarum subsp. plantarum P-8, complete sequence	3035719	2006734	2101427	3035719	plate,terminase,tail,integrase,capsid,portal,transposase,head	Lactobacillus_phage(34.88%)	99	2070034:2070055	2084157:2084178
WP_015640658.1|2006734_2007910_-|transposase	IS256 family transposase	transposase	NA	NA	NA	NA
WP_003645418.1|2008207_2008381_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003639227.1|2008698_2009328_-	uracil phosphoribosyltransferase	NA	NA	NA	NA	NA
WP_003641436.1|2009407_2010646_-	serine hydroxymethyltransferase	NA	A0A219Y950	Aeromonas_phage	50.6	1.4e-94
WP_003645419.1|2010704_2011724_-	threonylcarbamoyl-AMP synthase	NA	A0A291ATS8	Pandoravirus	41.5	9.3e-52
WP_003645420.1|2012014_2012881_-	peptide chain release factor N(5)-glutamine methyltransferase	NA	NA	NA	NA	NA
WP_003641433.1|2012873_2013956_-	peptide chain release factor 1	NA	NA	NA	NA	NA
WP_003644660.1|2013969_2014548_-	thymidine kinase	NA	A0A249XZX5	Enterococcus_phage	49.7	7.3e-46
WP_003645421.1|2014809_2016156_+	Mur ligase family protein	NA	NA	NA	NA	NA
WP_003645422.1|2016158_2016881_+	cobyric acid synthase	NA	NA	NA	NA	NA
WP_015640662.1|2017141_2018107_-	mannose-6-phosphate isomerase, class I	NA	NA	NA	NA	NA
WP_003645424.1|2018183_2019203_-	serine hydrolase	NA	A0A249XPW4	Mycobacterium_phage	24.2	5.3e-07
WP_003641426.1|2019373_2019559_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003641425.1|2019810_2020839_-	branched-chain amino acid aminotransferase	NA	NA	NA	NA	NA
WP_003641424.1|2020970_2021333_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003645426.1|2021548_2022520_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003641422.1|2022534_2024424_-	ABC transporter ATP-binding protein	NA	W8CYL7	Bacillus_phage	32.1	9.4e-58
WP_041142768.1|2024423_2026154_-	ABC transporter ATP-binding protein	NA	W8CYL7	Bacillus_phage	27.4	5.8e-46
WP_003641420.1|2026377_2026770_-	YxeA family protein	NA	NA	NA	NA	NA
WP_003645429.1|2026992_2027838_+	polysaccharide deacetylase family protein	NA	NA	NA	NA	NA
WP_041142769.1|2028321_2029332_-	Abi family protein	NA	A0A0H4U080	Erysipelothrix_phage	26.3	3.3e-25
WP_015640668.1|2030216_2030603_-	hypothetical protein	NA	A0A2H4PBB2	Lactobacillus_phage	83.7	2.2e-14
WP_015640669.1|2030613_2030877_-	hemolysin XhlA family protein	NA	E9LUR9	Lactobacillus_phage	92.0	3.4e-35
WP_041142770.1|2030876_2032082_-	LysM peptidoglycan-binding domain-containing protein	NA	E9LUR8	Lactobacillus_phage	85.8	1.4e-192
WP_015640671.1|2032170_2032344_-	XkdX family protein	NA	NA	NA	NA	NA
WP_015640672.1|2032343_2032703_-	hypothetical protein	NA	NA	NA	NA	NA
WP_015640674.1|2034284_2034413_-	XkdX family protein	NA	NA	NA	NA	NA
WP_015640675.1|2034504_2034867_-	DUF2977 domain-containing protein	NA	NA	NA	NA	NA
WP_015640676.1|2034866_2035604_-	hypothetical protein	NA	NA	NA	NA	NA
WP_015640677.1|2035609_2036224_-|plate	phage baseplate upper protein	plate	A0A1J0MFQ3	Staphylococcus_phage	49.3	1.6e-46
WP_015640678.1|2036238_2037231_-	SGNH/GDSL hydrolase family protein	NA	I6TFU2	Staphylococcus_virus	39.3	6.1e-40
WP_015640679.1|2037235_2039098_-|tail	phage tail protein	tail	A0A1X9IGI5	Lactococcus_phage	32.6	9.3e-50
WP_015640680.1|2039097_2039835_-	hypothetical protein	NA	A0A1S5SA63	Streptococcus_phage	37.0	1.8e-41
WP_015640682.1|2044141_2044378_-	hypothetical protein	NA	NA	NA	NA	NA
WP_015640683.1|2044470_2044959_-	hypothetical protein	NA	NA	NA	NA	NA
WP_041142771.1|2044976_2045537_-	hypothetical protein	NA	NA	NA	NA	NA
WP_080316530.1|2045548_2045935_-	DUF3168 domain-containing protein	NA	NA	NA	NA	NA
WP_015640686.1|2045936_2046491_-	hypothetical protein	NA	NA	NA	NA	NA
WP_041142872.1|2046480_2046804_-	hypothetical protein	NA	NA	NA	NA	NA
WP_015640688.1|2046808_2047174_-|head,tail	phage head-tail connector protein	head,tail	NA	NA	NA	NA
WP_015640689.1|2047188_2048241_-	hypothetical protein	NA	A0A0S0N2Q7	Pseudomonas_phage	30.5	1.2e-33
WP_015640690.1|2048257_2048905_-	DUF4355 domain-containing protein	NA	NA	NA	NA	NA
WP_015640691.1|2049011_2049956_-|capsid	minor capsid protein	capsid	NA	NA	NA	NA
WP_080316531.1|2049958_2051626_-|portal	phage portal protein	portal	D2IZF6	Enterococcus_phage	32.6	8.3e-66
WP_015640693.1|2051615_2052914_-|terminase	PBSX family phage terminase large subunit	terminase	B7T0C6	Staphylococcus_virus	50.1	3.7e-114
WP_041142772.1|2053117_2053627_-|terminase	terminase small subunit	terminase	O03926	Lactobacillus_phage	61.9	1.3e-46
WP_041142773.1|2053687_2053987_-	ImmA/IrrE family metallo-endopeptidase	NA	A0A1Q1PVT7	Staphylococcus_phage	36.0	2.8e-09
WP_041142774.1|2054119_2054320_-	hypothetical protein	NA	E9LUP6	Lactobacillus_phage	56.0	1.1e-06
WP_041142775.1|2054386_2054761_-	phage associated protein	NA	Q6SE87	Lactobacillus_prophage	48.4	1.4e-26
WP_041142776.1|2054738_2055797_-	hypothetical protein	NA	Q6SE88	Lactobacillus_prophage	41.6	6.4e-72
WP_129363737.1|2056816_2057284_-	hypothetical protein	NA	B4XYT9	Lactobacillus_phage	39.2	4.1e-15
WP_015640702.1|2057583_2058009_-	hypothetical protein	NA	A0A2K9VC36	Lactobacillus_phage	36.8	2.7e-13
WP_015640703.1|2057992_2058190_-	hypothetical protein	NA	NA	NA	NA	NA
WP_015640704.1|2058182_2058563_-	hypothetical protein	NA	NA	NA	NA	NA
WP_015640705.1|2058559_2059078_-	hypothetical protein	NA	O03915	Lactobacillus_phage	55.3	4.1e-40
WP_033611991.1|2059074_2059362_-	hypothetical protein	NA	NA	NA	NA	NA
WP_041142777.1|2059358_2060267_-	DnaD domain protein	NA	NA	NA	NA	NA
WP_015640708.1|2060346_2061312_-	hypothetical protein	NA	A6M982	Geobacillus_virus	54.5	1.2e-64
WP_041142778.1|2061323_2061857_-	host-nuclease inhibitor Gam family protein	NA	E9LUU0	Lactobacillus_phage	58.9	4.7e-55
WP_015640712.1|2062355_2062868_-	helix-turn-helix transcriptional regulator	NA	D6PST4	Lactobacillus_phage	43.5	1.8e-27
WP_011101775.1|2062935_2063241_-	DUF771 domain-containing protein	NA	NA	NA	NA	NA
WP_016511200.1|2063252_2063423_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016511201.1|2063435_2063666_-	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_016511202.1|2063838_2064201_+	helix-turn-helix domain-containing protein	NA	A0A0U4KKM4	Exiguobacterium_phage	32.0	2.6e-09
WP_015640714.1|2064212_2064626_+	ImmA/IrrE family metallo-endopeptidase	NA	A0A0M4RD70	Bacillus_phage	31.3	2.6e-05
WP_041142780.1|2064656_2066153_+	TerB N-terminal domain-containing protein	NA	NA	NA	NA	NA
WP_015640716.1|2066407_2067127_+	hypothetical protein	NA	NA	NA	NA	NA
WP_080316532.1|2067399_2067576_+	hypothetical protein	NA	A0A2P0ZL93	Lactobacillus_phage	51.7	2.6e-10
WP_015640717.1|2068048_2069170_+|integrase	site-specific integrase	integrase	D6PSS4	Lactobacillus_phage	32.4	1.3e-46
WP_003642774.1|2069520_2069727_-	hypothetical protein	NA	NA	NA	NA	NA
2070034:2070055	attL	AGTCAGCCAAAAGGACAGCCAA	NA	NA	NA	NA
WP_016527219.1|2070146_2070452_-	hypothetical protein	NA	NA	NA	NA	NA
WP_041142782.1|2070534_2070906_-	hypothetical protein	NA	NA	NA	NA	NA
WP_015640719.1|2071087_2071357_-|head,tail	phage gp6-like head-tail connector protein	head,tail	NA	NA	NA	NA
WP_015640720.1|2071496_2073023_-|capsid	phage major capsid protein	capsid	B8R651	Lactobacillus_phage	26.2	1.2e-42
WP_041142783.1|2073019_2074120_-|portal	phage portal protein	portal	A0A2H4J9Q5	uncultured_Caudovirales_phage	34.6	5.1e-48
WP_015640723.1|2074274_2075978_-|terminase	terminase large subunit	terminase	A0A2H4JBN3	uncultured_Caudovirales_phage	40.5	2.7e-120
WP_015640724.1|2075974_2076448_-|terminase	phage terminase small subunit P27 family	terminase	NA	NA	NA	NA
WP_015640725.1|2077237_2077456_+	hypothetical protein	NA	NA	NA	NA	NA
WP_041142784.1|2077511_2077901_-	HNH endonuclease	NA	A0A1J0MFT4	Staphylococcus_phage	44.7	3.0e-19
WP_041142875.1|2077893_2078232_-|head	phage head closure protein	head	A0A2P0ZLF0	Lactobacillus_phage	33.7	5.1e-07
WP_015640728.1|2078218_2078503_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003645297.1|2078527_2078947_-	hypothetical protein	NA	NA	NA	NA	NA
WP_015640730.1|2079090_2080485_-	helicase	NA	Q4ZD27	Staphylococcus_phage	35.8	4.6e-70
WP_015640731.1|2080484_2081285_-	bifunctional DNA primase/polymerase	NA	NA	NA	NA	NA
WP_015640732.1|2081281_2081500_-	hypothetical protein	NA	NA	NA	NA	NA
WP_015640734.1|2081781_2081961_-	helix-turn-helix domain-containing protein	NA	E9LUT5	Lactobacillus_phage	87.9	4.3e-21
WP_003643618.1|2082109_2082754_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_041142786.1|2082832_2083990_+|integrase	site-specific integrase	integrase	Q938N9	Temperate_phage	34.8	6.6e-54
WP_003642773.1|2084469_2084703_+	hypothetical protein	NA	NA	NA	NA	NA
2084157:2084178	attR	AGTCAGCCAAAAGGACAGCCAA	NA	NA	NA	NA
WP_003642772.1|2084727_2085000_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003642771.1|2085048_2085534_-	MarR family transcriptional regulator	NA	NA	NA	NA	NA
WP_003642770.1|2085588_2087565_-	hypothetical protein	NA	NA	NA	NA	NA
WP_041142787.1|2087664_2090805_-	MucBP domain-containing protein	NA	NA	NA	NA	NA
WP_015640740.1|2091494_2091638_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003646621.1|2092572_2094336_-	ABC transporter ATP-binding protein	NA	W8CYL7	Bacillus_phage	40.5	6.9e-95
WP_015640741.1|2095903_2097898_-	ATP-binding cassette domain-containing protein	NA	G9BWD6	Planktothrix_phage	41.3	7.2e-32
WP_003646619.1|2098302_2098494_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003642759.1|2098919_2100272_-	glucose-6-phosphate isomerase	NA	NA	NA	NA	NA
WP_015640743.1|2100497_2101427_+|transposase	IS30-like element ISLpl1 family transposase	transposase	H7BW61	unidentified_phage	29.9	1.1e-19
>prophage 7
NC_021224	Lactobacillus plantarum subsp. plantarum P-8, complete sequence	3035719	2275520	2284031	3035719		Synechococcus_phage(33.33%)	9	NA	NA
WP_003645867.1|2275520_2276099_-	phosphoribosylglycinamide formyltransferase	NA	M4QRX9	Synechococcus_phage	33.9	1.3e-21
WP_003645866.1|2276091_2277117_-	phosphoribosylformylglycinamidine cyclo-ligase	NA	A0A0E3F760	Synechococcus_phage	41.0	2.7e-59
WP_041142795.1|2277113_2278568_-	amidophosphoribosyltransferase	NA	A0A0M3SGR2	Mollivirus	34.0	3.3e-50
WP_003645864.1|2278552_2280772_-	phosphoribosylformylglycinamidine synthase subunit PurL	NA	A6N228	Microbacterium_phage	39.3	4.5e-144
WP_011101895.1|2280764_2281445_-	phosphoribosylformylglycinamidine synthase subunit PurQ	NA	NA	NA	NA	NA
WP_003642588.1|2281444_2281699_-	phosphoribosylformylglycinamidine synthase subunit PurS	NA	NA	NA	NA	NA
WP_003642587.1|2281700_2282432_-	phosphoribosylaminoimidazolesuccinocarboxamide synthase	NA	M4SM18	Cyanophage	37.3	1.6e-37
WP_015380738.1|2282434_2283565_-	5-(carboxyamino)imidazole ribonucleotide synthase	NA	NA	NA	NA	NA
WP_003645861.1|2283548_2284031_-	5-(carboxyamino)imidazole ribonucleotide mutase	NA	A0A2P0VNU7	Tetraselmis_virus	41.0	2.3e-16
>prophage 8
NC_021224	Lactobacillus plantarum subsp. plantarum P-8, complete sequence	3035719	2942671	3014382	3035719	transposase,protease	unidentified_phage(37.5%)	58	NA	NA
WP_015641123.1|2942671_2943601_-|transposase	IS30-like element ISLpl1 family transposase	transposase	H7BW61	unidentified_phage	29.9	8.5e-20
WP_001748085.1|2944384_2945560_-|transposase	IS256 family transposase	transposase	NA	NA	NA	NA
WP_003646199.1|2946077_2946893_-	sugar-phosphatase	NA	NA	NA	NA	NA
WP_003646200.1|2946965_2948963_-	transketolase	NA	NA	NA	NA	NA
WP_003646201.1|2948992_2949646_-	fructose-6-phosphate aldolase	NA	R9TM64	Synechococcus_phage	49.3	3.3e-50
WP_003642902.1|2949712_2951083_-	PTS ascorbate transporter subunit IIC	NA	NA	NA	NA	NA
WP_003642903.1|2951106_2951403_-	PTS sugar transporter subunit IIB	NA	NA	NA	NA	NA
WP_003646203.1|2951415_2951874_-	PTS sugar transporter subunit IIA	NA	NA	NA	NA	NA
WP_003642905.1|2952044_2954096_+	PTS sugar transporter subunit IIA	NA	NA	NA	NA	NA
WP_003646204.1|2954235_2954859_-	HAD family hydrolase	NA	NA	NA	NA	NA
WP_003643576.1|2954963_2956022_-	zinc-binding dehydrogenase	NA	NA	NA	NA	NA
WP_003642908.1|2956102_2957374_-	PTS galactitol transporter subunit IIC	NA	NA	NA	NA	NA
WP_003642909.1|2957408_2957705_-	PTS sugar transporter subunit IIB	NA	NA	NA	NA	NA
WP_003642910.1|2957739_2958210_-	PTS sugar transporter subunit IIA	NA	NA	NA	NA	NA
WP_003646205.1|2958536_2959304_+	DeoR/GlpR transcriptional regulator	NA	NA	NA	NA	NA
WP_041142843.1|2959470_2961861_+	phosphoketolase family protein	NA	NA	NA	NA	NA
WP_003646207.1|2962018_2962840_+	MurR/RpiR family transcriptional regulator	NA	NA	NA	NA	NA
WP_003646208.1|2962888_2963296_-	YueI family protein	NA	NA	NA	NA	NA
WP_003646210.1|2964154_2964991_-	alpha/beta hydrolase	NA	NA	NA	NA	NA
WP_003646211.1|2965168_2966677_-	sodium:solute symporter	NA	A0A219Y9P9	Aeromonas_phage	25.3	1.5e-18
WP_003646212.1|2966673_2967870_-	cation:proton antiporter	NA	NA	NA	NA	NA
WP_003646213.1|2967884_2968616_-	sugar phosphate isomerase/epimerase	NA	NA	NA	NA	NA
WP_041142844.1|2968821_2969685_-	ROK family protein	NA	NA	NA	NA	NA
WP_003646215.1|2969957_2970836_+	N-acetylneuraminate lyase	NA	NA	NA	NA	NA
WP_015641133.1|2970869_2971556_+	N-acetylmannosamine-6-phosphate 2-epimerase	NA	NA	NA	NA	NA
WP_003646217.1|2971694_2972900_-	FAD-dependent oxidoreductase	NA	NA	NA	NA	NA
WP_015473476.1|2973172_2974102_-|transposase	IS30-like element ISLpl1 family transposase	transposase	H7BW61	unidentified_phage	29.9	8.5e-20
WP_003642922.1|2974413_2974785_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003646218.1|2976474_2977023_-	folate family ECF transporter S component	NA	NA	NA	NA	NA
WP_003643582.1|2977368_2977614_-	GlsB/YeaQ/YmgE family stress response membrane protein	NA	NA	NA	NA	NA
WP_003646219.1|2977959_2979414_+	catalase	NA	A0A2K9L572	Tupanvirus	46.7	5.1e-104
WP_003642927.1|2979571_2980009_-	transcriptional regulator Spx	NA	NA	NA	NA	NA
WP_003646220.1|2980364_2981108_-	response regulator transcription factor	NA	NA	NA	NA	NA
WP_003642929.1|2981100_2982363_-	GHKL domain-containing protein	NA	NA	NA	NA	NA
WP_003643585.1|2982372_2982501_-	cyclic lactone autoinducer peptide	NA	NA	NA	NA	NA
WP_015641137.1|2982481_2983078_-	accessory gene regulator AgrB	NA	NA	NA	NA	NA
WP_015641138.1|2983445_2985560_-|protease	ATP-dependent Clp protease ATP-binding subunit	protease	K4FB40	Cronobacter_phage	38.9	3.1e-118
WP_003642932.1|2985950_2986184_-	hypothetical protein	NA	NA	NA	NA	NA
WP_015379577.1|2987947_2989702_-	pyruvate oxidase	NA	NA	NA	NA	NA
WP_003642935.1|2989783_2990209_-	Rrf2 family transcriptional regulator	NA	NA	NA	NA	NA
WP_003646223.1|2990381_2992193_-	pyruvate oxidase	NA	NA	NA	NA	NA
WP_003641596.1|2992563_2992941_-	PTS glucitol/sorbitol transporter subunit IIA	NA	NA	NA	NA	NA
WP_003646224.1|2992968_2993988_-	PTS glucitol/sorbitol transporter subunit IIB	NA	NA	NA	NA	NA
WP_003641598.1|2994011_2994563_-	PTS glucitol/sorbitol transporter subunit IIC	NA	NA	NA	NA	NA
WP_003641599.1|2994567_2995074_-	transcriptional regulator GutM	NA	NA	NA	NA	NA
WP_015641142.1|2995073_2996939_-	HTH domain-containing protein	NA	NA	NA	NA	NA
WP_003646226.1|2996972_2997776_-	SDR family oxidoreductase	NA	Q06VL0	Trichoplusia_ni_ascovirus	28.1	1.0e-08
WP_003641602.1|2998080_2998965_-	GRP family sugar transporter	NA	NA	NA	NA	NA
WP_015641145.1|2998994_2999390_-	D-ribose pyranase	NA	NA	NA	NA	NA
WP_003646227.1|2999392_3000313_-	ribokinase	NA	NA	NA	NA	NA
WP_003643604.1|3000416_3001415_-	LacI family DNA-binding transcriptional regulator	NA	NA	NA	NA	NA
WP_015641147.1|3001820_3002036_-	hypothetical protein	NA	NA	NA	NA	NA
WP_015641148.1|3002288_3004349_-	hypothetical protein	NA	NA	NA	NA	NA
WP_129556420.1|3007163_3007938_+|transposase	IS5 family transposase	transposase	NA	NA	NA	NA
WP_003643605.1|3008978_3011582_-	bifunctional acetaldehyde-CoA/alcohol dehydrogenase	NA	NA	NA	NA	NA
WP_003641607.1|3011870_3012332_-	universal stress protein	NA	NA	NA	NA	NA
WP_003641608.1|3012522_3013068_-	PadR family transcriptional regulator	NA	NA	NA	NA	NA
WP_015641155.1|3013452_3014382_+|transposase	IS30-like element ISLpl1 family transposase	transposase	H7BW61	unidentified_phage	29.9	1.1e-19
>prophage 1
NC_021234	Lactobacillus plantarum subsp. plantarum P-8 plasmid LBPp4, complete sequence	37042	0	5225	37042	transposase	Staphylococcus_phage(100.0%)	2	NA	NA
WP_128383811.1|1134_1922_-|transposase	IS5 family transposase	transposase	NA	NA	NA	NA
WP_015640271.1|4049_5225_+|transposase	IS256 family transposase	transposase	A0A0N9STL0	Staphylococcus_phage	29.2	1.8e-27
>prophage 2
NC_021234	Lactobacillus plantarum subsp. plantarum P-8 plasmid LBPp4, complete sequence	37042	11587	14028	37042	transposase	unidentified_phage(50.0%)	3	NA	NA
WP_041142930.1|11587_12517_-|transposase	IS30 family transposase	transposase	H7BW47	unidentified_phage	33.7	1.3e-23
WP_041142931.1|12890_13226_-	DUF5388 domain-containing protein	NA	NA	NA	NA	NA
WP_021730693.1|13218_14028_-	AAA family ATPase	NA	F0PIG8	Enterococcus_phage	43.8	1.6e-51
>prophage 3
NC_021234	Lactobacillus plantarum subsp. plantarum P-8 plasmid LBPp4, complete sequence	37042	20006	30033	37042	holin,transposase	Staphylococcus_phage(50.0%)	7	NA	NA
WP_041142936.1|20006_22142_+	type IA DNA topoisomerase	NA	A0A1X9I6W8	Streptococcus_phage	46.2	7.3e-107
WP_015639658.1|22263_22479_+	hypothetical protein	NA	NA	NA	NA	NA
WP_015639659.1|22482_23607_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_021353390.1|23764_23854_-|holin	putative holin-like toxin	holin	NA	NA	NA	NA
WP_041142937.1|24040_25240_-	restriction endonuclease subunit S	NA	A0A2H4PQP5	Staphylococcus_phage	26.6	3.7e-23
WP_015639661.1|25229_26852_-	type I restriction-modification system subunit M	NA	A0A2H4PQP4	Staphylococcus_phage	49.7	1.4e-126
WP_015639662.1|26865_30033_-	type I restriction endonuclease subunit R	NA	A0A220A398	Liberibacter_phage	22.6	3.1e-21
