The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
NC_021194	Mycobacterium tuberculosis EAI5/NITR206, complete genome	4390306	2928468	2970576	4390306	head,protease,terminase,integrase,capsid,tRNA	Mycobacterium_phage(30.0%)	55	2957268:2957295	2966893:2966920
WP_003413486.1|2928468_2930547_-|tRNA	threonine--tRNA ligase	tRNA	A0A2K9L6B6	Tupanvirus	34.9	2.5e-104
WP_003413487.1|2930655_2930883_+	hypothetical protein	NA	NA	NA	NA	NA
WP_009938541.1|2930879_2932265_-	PE family protein	NA	NA	NA	NA	NA
WP_003413569.1|2932609_2933110_+	DUF1990 family protein	NA	NA	NA	NA	NA
WP_003413574.1|2933126_2933567_-	DoxX family membrane protein	NA	NA	NA	NA	NA
WP_003901437.1|2933713_2934391_+	transcriptional regulator	NA	NA	NA	NA	NA
WP_015631461.1|2934375_2934729_-	cupin domain-containing protein	NA	NA	NA	NA	NA
WP_003413586.1|2934741_2935167_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003413588.1|2935163_2935838_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_003413589.1|2935915_2936737_+	class I SAM-dependent methyltransferase	NA	NA	NA	NA	NA
WP_003413592.1|2936872_2937766_+	universal stress protein	NA	NA	NA	NA	NA
WP_003413594.1|2937768_2938587_-	universal stress protein	NA	NA	NA	NA	NA
WP_003899401.1|2938601_2939783_-|protease	site-2 protease family protein	protease	NA	NA	NA	NA
WP_003413598.1|2939841_2940273_-	CBS domain-containing protein	NA	A0A2I6B2H4	Macacine_betaherpesvirus	100.0	1.9e-75
WP_003899402.1|2940786_2942028_-	alpha/beta hydrolase	NA	NA	NA	NA	NA
WP_003413600.1|2942337_2942700_+	hypothetical protein	NA	NA	NA	NA	NA
WP_015630479.1|2943046_2944171_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003413614.1|2944172_2944712_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003413616.1|2944850_2946149_+	RNA-splicing ligase RtcB	NA	A2RQD0	Archaeal_BJ1_virus	43.3	3.8e-90
WP_003413619.1|2946187_2946469_-	DUF1876 domain-containing protein	NA	NA	NA	NA	NA
WP_003413625.1|2946613_2947099_-	hemerythrin domain-containing protein	NA	NA	NA	NA	NA
WP_003902325.1|2947125_2947383_-	hypothetical protein	NA	NA	NA	NA	NA
WP_009938544.1|2947383_2949720_-	PE family protein	NA	NA	NA	NA	NA
WP_003899405.1|2949748_2949991_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003899406.1|2949991_2950669_+	membrane protein	NA	NA	NA	NA	NA
WP_015631462.1|2950864_2951521_+	DedA family protein	NA	NA	NA	NA	NA
WP_003413657.1|2951683_2952130_+	anti-sigma factor antagonist	NA	NA	NA	NA	NA
WP_003413663.1|2952304_2952637_-	YnfA family protein	NA	NA	NA	NA	NA
WP_003413665.1|2952756_2953116_-	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_003413675.1|2953217_2953676_+	glyoxalase/bleomycin resistance/dioxygenase family protein	NA	NA	NA	NA	NA
WP_003899407.1|2953811_2954192_+	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_003413686.1|2954188_2955685_+	ACR3 family arsenite efflux transporter	NA	A0A2H4PQT9	Staphylococcus_phage	39.7	5.1e-14
WP_085972563.1|2955874_2956111_+	antitoxin MazE family protein	NA	NA	NA	NA	NA
WP_077365235.1|2956183_2956357_+	hypothetical protein	NA	NA	NA	NA	NA
2957268:2957295	attL	ACTGGTTCAATCCCAGTATCGCGCACCA	NA	NA	NA	NA
WP_003899409.1|2957401_2957833_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003900539.1|2958839_2959304_+	hypothetical protein	NA	NA	NA	NA	NA
WP_015631465.1|2959291_2959546_+	hypothetical protein	NA	NA	NA	NA	NA
WP_009935349.1|2959716_2961156_-|capsid	phage major capsid protein	capsid	A0A1B3AYS4	Gordonia_phage	40.6	1.4e-66
WP_003899412.1|2961163_2961697_-|head,protease	HK97 family phage prohead protease	head,protease	A0A2H4JB68	uncultured_Caudovirales_phage	32.9	3.1e-06
WP_003899413.1|2961849_2962476_-|terminase	phage terminase small subunit P27 family	terminase	V9H0V4	Actinophage	47.2	1.6e-17
WP_003899414.1|2962507_2962831_-	type II toxin-antitoxin system toxin	NA	NA	NA	NA	NA
WP_003899415.1|2962910_2963156_-	antitoxin	NA	NA	NA	NA	NA
WP_003899416.1|2963152_2964580_-	DUF3631 domain-containing protein	NA	NA	NA	NA	NA
WP_003899417.1|2964581_2964974_-	DUF2742 domain-containing protein	NA	NA	NA	NA	NA
WP_003899418.1|2964970_2965231_-	helix-turn-helix domain-containing protein	NA	A0A2P1CHK7	Mycobacterium_phage	64.6	3.0e-15
WP_003900543.1|2965247_2965610_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003899420.1|2965612_2966740_-|integrase	site-specific integrase	integrase	A0A1X9SFC1	Mycobacterium_phage	40.4	1.5e-66
WP_003899421.1|2966884_2967112_-	hypothetical protein	NA	NA	NA	NA	NA
2966893:2966920	attR	ACTGGTTCAATCCCAGTATCGCGCACCA	NA	NA	NA	NA
WP_003899422.1|2967108_2967498_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003900544.1|2967403_2967676_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003413717.1|2967774_2968008_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003413719.1|2968018_2968273_+	hypothetical protein	NA	NA	NA	NA	NA
WP_085334930.1|2968269_2968443_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003899423.1|2968620_2968902_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003413845.1|2969817_2970576_+|protease	ATP-dependent Clp protease ATP-binding subunit	protease	A0A249XSS8	Mycobacterium_phage	40.8	4.7e-16
