The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
NC_021173	Burkholderia thailandensis MSMB121 chromosome 1, complete sequence	3967794	246324	307537	3967794	portal,transposase,holin,plate	Burkholderia_phage(27.27%)	59	NA	NA
WP_041861551.1|246324_247587_-|transposase	IS110 family transposase	transposase	NA	NA	NA	NA
WP_006029871.1|248694_249810_-|transposase	ISAs1 family transposase	transposase	NA	NA	NA	NA
WP_155246022.1|250154_250316_-	hypothetical protein	NA	NA	NA	NA	NA
WP_015602062.1|251204_252110_-|plate	baseplate assembly protein	plate	K4NZR5	Burkholderia_phage	95.7	7.2e-157
WP_041861800.1|252106_252469_-|plate	baseplate assembly protein	plate	K4PAX6	Burkholderia_phage	85.0	1.0e-53
WP_075644724.1|253679_254135_-	hypothetical protein	NA	F2Y385	Organic_Lake_phycodnavirus	38.0	2.3e-18
WP_041861553.1|255297_256335_+|portal	phage portal protein	portal	A4JWQ2	Burkholderia_virus	96.8	4.8e-197
WP_004202809.1|256378_256735_-	putative addiction module antidote protein	NA	A4JWV1	Burkholderia_virus	100.0	3.9e-42
WP_015600654.1|256948_258043_-	DUF3396 domain-containing protein	NA	A9YX32	Burkholderia_phage	60.6	1.8e-93
WP_015600472.1|258772_259309_-	PAAR domain-containing protein	NA	A4JWV5	Burkholderia_virus	62.9	4.1e-59
WP_138110399.1|259470_259758_-	hypothetical protein	NA	NA	NA	NA	NA
WP_015601433.1|259829_259979_-	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_015601016.1|260111_260336_-	hypothetical protein	NA	NA	NA	NA	NA
WP_015601972.1|261098_261416_+	hypothetical protein	NA	NA	NA	NA	NA
WP_015601293.1|261939_262584_+	chitin-binding protein	NA	NA	NA	NA	NA
WP_015600518.1|262775_264440_+	FAD-binding oxidoreductase	NA	NA	NA	NA	NA
WP_015602085.1|264660_266466_+	methyl-accepting chemotaxis protein	NA	A0A2H4J162	uncultured_Caudovirales_phage	52.6	2.9e-08
WP_009913936.1|266590_267406_-	alpha/beta fold hydrolase	NA	NA	NA	NA	NA
WP_009913933.1|268131_268809_+	curli production assembly protein CsgG	NA	NA	NA	NA	NA
WP_015602080.1|268869_269289_+	DUF4810 domain-containing protein	NA	NA	NA	NA	NA
WP_075644930.1|269285_269972_+	DUF799 domain-containing protein	NA	NA	NA	NA	NA
WP_138110401.1|270054_270243_+	hypothetical protein	NA	NA	NA	NA	NA
WP_075644931.1|270197_271892_+	acid phosphatase	NA	NA	NA	NA	NA
WP_138110403.1|272778_272958_+	hypothetical protein	NA	NA	NA	NA	NA
WP_015600857.1|273057_273459_+	hypothetical protein	NA	NA	NA	NA	NA
WP_138110405.1|273503_273821_+	hypothetical protein	NA	NA	NA	NA	NA
WP_041861554.1|273851_274166_-	flagellar protein FliT	NA	NA	NA	NA	NA
WP_015600718.1|274179_275700_-	flagellar filament capping protein FliD	NA	NA	NA	NA	NA
WP_006023840.1|275849_277019_-	flagellin	NA	NA	NA	NA	NA
WP_004198205.1|277580_277793_+	30S ribosomal protein S21	NA	NA	NA	NA	NA
WP_015602144.1|278187_278796_-	DNA-3-methyladenine glycosylase I	NA	NA	NA	NA	NA
WP_015600856.1|278947_279838_+	putative N-acetylglucosamine kinase	NA	NA	NA	NA	NA
WP_006023835.1|279949_280771_+	Cof-type HAD-IIB family hydrolase	NA	NA	NA	NA	NA
WP_009913923.1|280894_281599_-	aquaporin Z	NA	NA	NA	NA	NA
WP_006023832.1|281905_282202_+	H-NS histone family protein	NA	NA	NA	NA	NA
WP_006023831.1|282305_283370_-	glycosyltransferase family 4 protein	NA	NA	NA	NA	NA
WP_075644726.1|283439_283613_+	hypothetical protein	NA	NA	NA	NA	NA
WP_075644727.1|283616_284285_+	flagellar transcriptional regulator FlhD	NA	NA	NA	NA	NA
WP_015601808.1|284378_284930_+	flagellar transcriptional regulator FlhC	NA	NA	NA	NA	NA
WP_009913920.1|285103_285964_+	flagellar motor stator protein MotA	NA	NA	NA	NA	NA
WP_006023827.1|285980_287003_+	flagellar motor protein MotB	NA	NA	NA	NA	NA
WP_006023826.1|287033_287414_+	response regulator	NA	NA	NA	NA	NA
WP_015600565.1|287445_289725_+	chemotaxis protein CheA	NA	NA	NA	NA	NA
WP_006023824.1|289755_290283_+	chemotaxis protein CheW	NA	NA	NA	NA	NA
WP_015600241.1|290323_292333_+	methyl-accepting chemotaxis protein	NA	A0A2H4J162	uncultured_Caudovirales_phage	57.7	5.9e-10
WP_015602267.1|292336_293278_+	chemotaxis protein methyltransferase	NA	NA	NA	NA	NA
WP_006023821.1|293274_293979_+	chemoreceptor glutamine deamidase CheD	NA	NA	NA	NA	NA
WP_041861556.1|293975_295079_+	chemotaxis response regulator protein-glutamate methylesterase	NA	NA	NA	NA	NA
WP_004185006.1|295154_295550_+	chemotaxis protein CheY	NA	Q56AR1	Bacillus_thuringiensis_phage	32.8	2.7e-07
WP_015601094.1|295551_296280_+	protein phosphatase CheZ	NA	NA	NA	NA	NA
WP_006023816.1|296478_296982_+	DUF2844 domain-containing protein	NA	NA	NA	NA	NA
WP_015601888.1|297004_298288_+	DUF3443 domain-containing protein	NA	NA	NA	NA	NA
WP_075644932.1|298647_299865_+	flagellar type III secretion system protein FlhB	NA	NA	NA	NA	NA
WP_015602362.1|299861_301964_+	flagellar biosynthesis protein FlhA	NA	NA	NA	NA	NA
WP_015600910.1|301960_303727_+	flagellar biosynthesis protein FlhF	NA	NA	NA	NA	NA
WP_006023810.1|303719_304532_+	flagellar biosynthesis protein FlhG	NA	NA	NA	NA	NA
WP_006023809.1|304553_305288_+	RNA polymerase sigma factor FliA	NA	NA	NA	NA	NA
WP_015601770.1|305597_307019_+	adenosylhomocysteinase	NA	S4VPF6	Pandoravirus	29.5	1.3e-43
WP_006023807.1|307183_307537_+|holin	phage holin family protein	holin	NA	NA	NA	NA
>prophage 2
NC_021173	Burkholderia thailandensis MSMB121 chromosome 1, complete sequence	3967794	485564	532622	3967794	protease,transposase,plate	Liberibacter_phage(40.0%)	43	NA	NA
WP_075644733.1|485564_486074_+|protease	ClpXP protease specificity-enhancing factor	protease	A0A1S5R3H3	Pseudomonas_phage	51.9	8.5e-22
WP_015601523.1|486366_487569_+	DUF4102 domain-containing protein	NA	B7SYF8	Stenotrophomonas_phage	49.6	1.3e-105
WP_015601576.1|487576_488428_+	hypothetical protein	NA	NA	NA	NA	NA
WP_096746704.1|488363_489014_-	inovirus-type Gp2 protein	NA	NA	NA	NA	NA
WP_015600629.1|490004_491600_-	DUF3987 domain-containing protein	NA	NA	NA	NA	NA
WP_015601012.1|491649_491940_-	hypothetical protein	NA	NA	NA	NA	NA
WP_015600837.1|491988_492261_-	hypothetical protein	NA	NA	NA	NA	NA
WP_015602378.1|492257_492467_-	hypothetical protein	NA	NA	NA	NA	NA
WP_015601042.1|493517_494573_-	hypothetical protein	NA	NA	NA	NA	NA
WP_015601496.1|494733_496515_-	hypothetical protein	NA	A0A1L7N0M1	Ralstonia_phage	32.4	7.3e-52
WP_041861568.1|496690_497032_+	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_015600692.1|497397_498003_+	putative lipoprotein	NA	NA	NA	NA	NA
WP_096746686.1|498004_498619_+	hypothetical protein	NA	NA	NA	NA	NA
WP_138110407.1|498689_498983_+	hypothetical protein	NA	NA	NA	NA	NA
WP_015601920.1|499409_500051_-	hypothetical protein	NA	NA	NA	NA	NA
WP_015602002.1|500052_500352_-	hypothetical protein	NA	NA	NA	NA	NA
WP_015600590.1|500462_501269_-	DUF4942 domain-containing protein	NA	NA	NA	NA	NA
WP_015601312.1|501337_502414_-	hypothetical protein	NA	NA	NA	NA	NA
WP_015601601.1|502410_503316_-	hypothetical protein	NA	NA	NA	NA	NA
WP_015601628.1|503371_503599_-	hypothetical protein	NA	NA	NA	NA	NA
WP_015601499.1|503611_504607_-	phage-type endonuclease	NA	A6XMH8	Bacillus_virus	39.1	2.0e-51
WP_041861811.1|504684_505650_-	DUF932 domain-containing protein	NA	A0A0H4INH5	Stenotrophomonas_phage	40.5	5.0e-55
WP_006029871.1|505741_506857_+|transposase	ISAs1 family transposase	transposase	NA	NA	NA	NA
WP_102812160.1|507012_507231_-	hypothetical protein	NA	NA	NA	NA	NA
WP_015600937.1|507992_508190_+	hypothetical protein	NA	NA	NA	NA	NA
WP_015602385.1|508186_509689_+	SAM-dependent DNA methyltransferase	NA	A0A220A2U4	Liberibacter_phage	53.9	9.8e-151
WP_041861812.1|509778_511317_+	SAM-dependent DNA methyltransferase	NA	A0A220A2U5	Liberibacter_phage	57.1	1.8e-139
WP_096746687.1|511354_512512_+	restriction endonuclease	NA	A0A240FAT6	Liberibacter_phage	37.6	1.1e-21
WP_015601397.1|512501_515486_+	HsdR family type I site-specific deoxyribonuclease	NA	A0A220A398	Liberibacter_phage	40.8	1.3e-210
WP_015601243.1|515495_518357_+	PHP domain protein	NA	A0A1B1IUG5	uncultured_Mediterranean_phage	22.9	1.5e-14
WP_015601963.1|518358_519627_+	divergent AAA domain protein	NA	NA	NA	NA	NA
WP_011883089.1|520405_520891_-	hypothetical protein	NA	NA	NA	NA	NA
WP_015602426.1|520902_522036_-	HigA family addiction module antidote protein	NA	NA	NA	NA	NA
WP_006029380.1|522576_523362_-	DotU family type IV/VI secretion system protein	NA	NA	NA	NA	NA
WP_006029381.1|523358_524705_-|plate	type VI secretion system baseplate subunit TssK	plate	NA	NA	NA	NA
WP_015600452.1|524813_525428_-	type VI secretion system lipoprotein TssJ	NA	NA	NA	NA	NA
WP_015601514.1|525801_526467_+	tetratricopeptide repeat protein	NA	NA	NA	NA	NA
WP_006029385.1|526503_527022_+	type VI secretion system contractile sheath small subunit	NA	NA	NA	NA	NA
WP_006029386.1|527039_528530_+	type VI secretion system contractile sheath large subunit	NA	NA	NA	NA	NA
WP_006029387.1|528602_529106_+	type VI secretion system tube protein Hcp	NA	NA	NA	NA	NA
WP_075644735.1|529133_529640_+|plate	type VI secretion system baseplate subunit TssE	plate	NA	NA	NA	NA
WP_075644942.1|529731_531558_+|plate	type VI secretion system baseplate subunit TssF	plate	NA	NA	NA	NA
WP_015601719.1|531521_532622_+|plate	type VI secretion system baseplate subunit TssG	plate	NA	NA	NA	NA
>prophage 3
NC_021173	Burkholderia thailandensis MSMB121 chromosome 1, complete sequence	3967794	843993	853168	3967794		Hokovirus(16.67%)	7	NA	NA
WP_015601574.1|843993_845934_+	molecular chaperone DnaK	NA	A0A1V0SH73	Hokovirus	50.3	8.5e-147
WP_015601848.1|846197_847331_+	molecular chaperone DnaJ	NA	E3T4P7	Cafeteria_roenbergensis_virus	38.2	9.1e-24
WP_015602361.1|847362_849324_+	bifunctional anthranilate synthase component I family protein/class IV aminotransferase	NA	S4VT78	Pandoravirus	32.3	3.8e-54
WP_006025369.1|849489_850305_-	3-methyl-2-oxobutanoate hydroxymethyltransferase	NA	A0A0N7HVJ8	Ostreococcus_lucimarinus_virus	32.1	9.7e-36
WP_015602420.1|850369_851053_-	deoxynucleoside kinase	NA	A0A249XZR7	Enterococcus_phage	26.0	6.7e-06
WP_006025371.1|851049_851577_-	2-amino-4-hydroxy-6- hydroxymethyldihydropteridine diphosphokinase	NA	NA	NA	NA	NA
WP_015602021.1|851614_853168_-	polynucleotide adenylyltransferase PcnB	NA	H7BUW3	unidentified_phage	31.2	4.3e-24
>prophage 4
NC_021173	Burkholderia thailandensis MSMB121 chromosome 1, complete sequence	3967794	1209763	1218198	3967794		Bacillus_phage(16.67%)	8	NA	NA
WP_015600060.1|1209763_1211164_+	UDP-glucose/GDP-mannose dehydrogenase family protein	NA	A0A127AXI2	Bacillus_phage	38.3	1.2e-78
WP_015601685.1|1211195_1212119_+	D-glycero-beta-D-manno-heptose-7-phosphate kinase	NA	A0A2H4N7X4	Lake_Baikal_phage	27.5	5.7e-16
WP_006025721.1|1212177_1213170_+	ADP-glyceromanno-heptose 6-epimerase	NA	R9S880	Prochlorococcus_phage	30.6	1.0e-26
WP_015601656.1|1213241_1213559_+	hypothetical protein	NA	NA	NA	NA	NA
WP_009916396.1|1213897_1214800_+	cysteine synthase CysM	NA	A0A1X9I5K7	Streptococcus_phage	40.2	2.3e-54
WP_096746693.1|1214894_1216172_-	lytic murein transglycosylase B	NA	NA	NA	NA	NA
WP_006025725.1|1216299_1217223_+	histone deacetylase family protein	NA	A0A2K9KZC4	Tupanvirus	35.9	2.4e-43
WP_041861829.1|1217343_1218198_-	alpha/beta hydrolase	NA	A7XCB7	Tanapox_virus	26.4	3.3e-18
>prophage 5
NC_021173	Burkholderia thailandensis MSMB121 chromosome 1, complete sequence	3967794	1641840	1743524	3967794	portal,integrase,tRNA,tail,protease,capsid,terminase,head	Ralstonia_phage(28.95%)	105	1682526:1682553	1729863:1729890
WP_041861634.1|1641840_1642425_+|tRNA	tRNA adenosine(34) deaminase TadA	tRNA	S4VYT2	Pandoravirus	31.3	2.2e-05
WP_015601805.1|1642478_1643420_+	muramoyltetrapeptide carboxypeptidase	NA	NA	NA	NA	NA
WP_006026108.1|1643743_1644439_+	GntR family transcriptional regulator	NA	NA	NA	NA	NA
WP_075644797.1|1644552_1646085_+	NCS1 family nucleobase:cation symporter-1	NA	NA	NA	NA	NA
WP_015600169.1|1646095_1646908_+	aspartate/glutamate racemase family protein	NA	NA	NA	NA	NA
WP_015601713.1|1647053_1648007_+	allantoinase PuuE	NA	NA	NA	NA	NA
WP_075644798.1|1648003_1648528_+	2-oxo-4-hydroxy-4-carboxy-5-ureidoimidazoline decarboxylase	NA	NA	NA	NA	NA
WP_006026113.1|1648651_1649665_+	allantoicase	NA	NA	NA	NA	NA
WP_015601651.1|1649661_1650174_+	ureidoglycolate lyase	NA	NA	NA	NA	NA
WP_015600419.1|1650381_1651746_+	hypothetical protein	NA	NA	NA	NA	NA
WP_015600367.1|1652136_1653339_-	cytochrome c family protein	NA	NA	NA	NA	NA
WP_006026117.1|1653388_1653748_-	hydroxyisourate hydrolase	NA	NA	NA	NA	NA
WP_015600161.1|1654239_1655652_+	8-oxoguanine deaminase	NA	A0A291ATQ6	Pandoravirus	24.4	1.5e-07
WP_006026119.1|1655846_1656776_-	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_009912804.1|1657284_1657494_-	dodecin domain-containing protein	NA	NA	NA	NA	NA
WP_015600404.1|1657635_1658523_+	NAD(P)-dependent oxidoreductase	NA	NA	NA	NA	NA
WP_004527255.1|1658681_1659170_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004192898.1|1659492_1659924_-	large conductance mechanosensitive channel protein MscL	NA	NA	NA	NA	NA
WP_015600473.1|1660108_1661317_-	tetratricopeptide repeat protein	NA	NA	NA	NA	NA
WP_006026123.1|1661429_1662110_-	PspA/IM30 family protein	NA	NA	NA	NA	NA
WP_075644986.1|1662379_1662673_-	hypothetical protein	NA	NA	NA	NA	NA
WP_075644800.1|1662589_1665148_+	penicillin-binding protein 1A	NA	NA	NA	NA	NA
WP_015601734.1|1665356_1665806_-	DUF3574 domain-containing protein	NA	NA	NA	NA	NA
WP_015601864.1|1666247_1667279_-	threonine/serine dehydratase	NA	NA	NA	NA	NA
WP_006026127.1|1667346_1668564_-	acetylornithine deacetylase	NA	NA	NA	NA	NA
WP_015600564.1|1668881_1669076_+	hypothetical protein	NA	NA	NA	NA	NA
WP_015600462.1|1669205_1672679_-	transcription-repair coupling factor	NA	NA	NA	NA	NA
WP_015600386.1|1672796_1673507_+	2-C-methyl-D-erythritol 4-phosphate cytidylyltransferase	NA	NA	NA	NA	NA
WP_006026131.1|1673547_1674036_+	2-C-methyl-D-erythritol 2,4-cyclodiphosphate synthase	NA	NA	NA	NA	NA
WP_006026132.1|1674227_1674755_-	carboxymuconolactone decarboxylase family protein	NA	NA	NA	NA	NA
WP_009912787.1|1674832_1675381_-	peroxiredoxin	NA	NA	NA	NA	NA
WP_015600436.1|1675578_1676937_-	HAMP domain-containing protein	NA	NA	NA	NA	NA
WP_004199523.1|1677029_1677755_-	two-component system response regulator OmpR	NA	W8CYM9	Bacillus_phage	36.7	8.1e-34
WP_009904927.1|1677842_1678025_+	hypothetical protein	NA	NA	NA	NA	NA
WP_075644801.1|1677976_1678315_+	hypothetical protein	NA	NA	NA	NA	NA
WP_015601607.1|1680078_1681332_+	DUF1501 domain-containing protein	NA	NA	NA	NA	NA
WP_006026138.1|1681390_1682227_-	presqualene diphosphate synthase HpnD	NA	NA	NA	NA	NA
1682526:1682553	attL	GCCGGTTCGAGTCCGGCCTCACGCACCA	NA	NA	NA	NA
WP_009941357.1|1682715_1683732_+|integrase	tyrosine-type recombinase/integrase	integrase	A0A0A0YR56	Pseudomonas_phage	39.8	9.6e-49
WP_015600418.1|1683965_1684286_-	hypothetical protein	NA	NA	NA	NA	NA
WP_015600944.1|1684285_1684555_-	hypothetical protein	NA	NA	NA	NA	NA
WP_015600229.1|1684568_1685285_-	hypothetical protein	NA	C7BGD6	Burkholderia_phage	47.1	6.7e-57
WP_015600604.1|1685593_1688995_-	host specificity protein J	NA	Q3HQU5	Burkholderia_phage	57.1	0.0e+00
WP_041861638.1|1688991_1689567_-|tail	tail assembly protein	tail	Q8W6T1	Burkholderia_virus	50.3	1.9e-46
WP_015602451.1|1689563_1690304_-	C40 family peptidase	NA	Q3HQU3	Burkholderia_phage	54.8	3.3e-75
WP_015600135.1|1690300_1690981_-|tail	phage minor tail protein L	tail	Q6JIL5	Burkholderia_virus	53.1	1.7e-62
WP_015601347.1|1691930_1692275_-|tail	phage tail protein	tail	C7BGC9	Burkholderia_phage	40.7	3.7e-13
WP_041861639.1|1692271_1695085_-|tail	phage tail tape measure protein	tail	A0A291AWX1	Escherichia_phage	22.7	1.8e-20
WP_075644802.1|1695081_1695525_-	hypothetical protein	NA	NA	NA	NA	NA
WP_041861641.1|1695855_1696191_-	hypothetical protein	NA	NA	NA	NA	NA
WP_015601485.1|1696339_1696777_-|tail	phage major tail 2 family protein	tail	NA	NA	NA	NA
WP_015601472.1|1696776_1697133_-	DUF3168 domain-containing protein	NA	NA	NA	NA	NA
WP_075644803.1|1697125_1697464_-|head	phage head closure protein	head	NA	NA	NA	NA
WP_015600215.1|1697496_1697787_-|head,tail	phage gp6-like head-tail connector protein	head,tail	NA	NA	NA	NA
WP_015600130.1|1697779_1699117_-|portal	phage portal protein	portal	A0A0R6PHI5	Moraxella_phage	43.6	4.3e-81
WP_015602462.1|1699113_1699284_-	hypothetical protein	NA	NA	NA	NA	NA
WP_015600962.1|1699343_1700678_-|capsid	phage major capsid protein	capsid	S4TNE3	Salmonella_phage	41.4	3.1e-79
WP_075644804.1|1700691_1701330_-	peptidase U35	NA	A0A0R6PHN0	Moraxella_phage	42.9	7.9e-33
WP_015601176.1|1701292_1702882_-|terminase	terminase large subunit	terminase	Q9MCV7	Escherichia_phage	65.1	6.5e-185
WP_155246026.1|1702878_1703286_-	TerS protein	NA	A0A0F7L441	uncultured_marine_virus	51.9	2.2e-28
WP_041861642.1|1704192_1704675_+	DUF2778 domain-containing protein	NA	NA	NA	NA	NA
WP_138110425.1|1705500_1705899_-	DUF2628 domain-containing protein	NA	NA	NA	NA	NA
WP_015601215.1|1705947_1706592_-	S24 family peptidase	NA	A5X9F5	Aeromonas_virus	28.8	9.7e-15
WP_138110427.1|1707060_1707507_+	hypothetical protein	NA	NA	NA	NA	NA
WP_015600095.1|1707724_1708450_+	phage antirepressor KilAC domain protein	NA	B3VGL7	Mycobacterium_virus	50.3	1.4e-33
WP_015600721.1|1708503_1708737_+	hypothetical protein	NA	NA	NA	NA	NA
WP_015600873.1|1709085_1709712_+	hypothetical protein	NA	NA	NA	NA	NA
WP_051139202.1|1710131_1710338_+	hypothetical protein	NA	B5BTU9	Ralstonia_phage	74.6	4.2e-20
WP_015600868.1|1710636_1711008_+	hypothetical protein	NA	NA	NA	NA	NA
WP_015600811.1|1711007_1711259_+	hypothetical protein	NA	NA	NA	NA	NA
WP_015601324.1|1711275_1711563_+	hypothetical protein	NA	NA	NA	NA	NA
WP_015600725.1|1711559_1711766_+	Fragile-X-F family protein	NA	NA	NA	NA	NA
WP_015602193.1|1712033_1712606_+	toprim domain protein	NA	A0A077KVN4	Ralstonia_phage	52.7	1.3e-47
WP_041861643.1|1712721_1714017_+	AAA family ATPase	NA	A0A068Q6G7	Ralstonia_phage	61.1	2.2e-151
WP_138110429.1|1713710_1714433_+	hypothetical protein	NA	A0A2I7SBG9	Pseudomonas_phage	42.2	3.7e-23
WP_015600078.1|1714578_1714851_+	hypothetical protein	NA	NA	NA	NA	NA
WP_015602147.1|1714953_1715862_+	ATP-dependent DNA ligase	NA	A0A068Q5W4	Ralstonia_phage	48.1	1.5e-66
WP_015601257.1|1716028_1716589_+	hypothetical protein	NA	A0A192Y8M4	Salmonella_phage	49.4	3.5e-37
WP_041861644.1|1716611_1719032_+	DNA polymerase A family protein	NA	A0A068Q7T8	Ralstonia_phage	64.6	2.3e-303
WP_015600626.1|1719052_1719883_+	hypothetical protein	NA	A0A077KTI9	Ralstonia_phage	55.9	1.7e-64
WP_015601124.1|1719882_1720098_+	hypothetical protein	NA	NA	NA	NA	NA
WP_015600772.1|1720256_1721030_+	phosphodiesterase I	NA	A0A1L7DQH5	Ralstonia_phage	52.0	1.8e-68
WP_102812144.1|1721031_1721391_+	hypothetical protein	NA	A0A1L7DQG2	Ralstonia_phage	58.6	6.4e-24
WP_015600542.1|1721387_1722176_+	RNase H superfamily protein	NA	A0A2P0VPF6	Ralstonia_phage	66.2	1.4e-100
WP_015602387.1|1722185_1722776_+	DNA polymerase III subunit beta, central domain protein	NA	A0A1L7DQD4	Ralstonia_phage	40.5	2.8e-24
WP_041861645.1|1722899_1723127_+	hypothetical protein	NA	NA	NA	NA	NA
WP_041861845.1|1723260_1723563_+	hypothetical protein	NA	D2EBS7	Pseudomonas_phage	71.1	1.9e-29
WP_015602143.1|1723559_1723751_+	hypothetical protein	NA	NA	NA	NA	NA
WP_015600150.1|1725035_1727345_+	DNA-dependent RNA polymerase	NA	A0A2R2ZGE5	Ralstonia_phage	31.4	2.9e-77
WP_015601622.1|1727570_1728260_+	hypothetical protein	NA	Q3HQV2	Burkholderia_phage	59.0	1.9e-69
WP_009941408.1|1728345_1728537_+	hypothetical protein	NA	NA	NA	NA	NA
WP_102812145.1|1728619_1728826_+	hypothetical protein	NA	NA	NA	NA	NA
WP_041861647.1|1729037_1729583_-	lysozyme	NA	A0A0A1I5L5	Burkholderia_phage	44.2	2.5e-27
WP_015600769.1|1730345_1730807_+	MEKHLA domain-containing protein	NA	NA	NA	NA	NA
1729863:1729890	attR	GCCGGTTCGAGTCCGGCCTCACGCACCA	NA	NA	NA	NA
WP_015600742.1|1730901_1731525_-	phospholipase D family protein	NA	E9P5Z4	Wolbachia_endosymbiont_wVitA_of_Nasonia_vitripennis_phage	31.7	1.4e-18
WP_096746707.1|1731725_1732748_-	class II histone deacetylase	NA	A0A2K9L2T7	Tupanvirus	30.3	9.3e-36
WP_015601595.1|1732883_1734077_-	MFS transporter	NA	NA	NA	NA	NA
WP_015601149.1|1734100_1735162_-	porin	NA	NA	NA	NA	NA
WP_075644990.1|1735492_1736641_+	response regulator transcription factor	NA	NA	NA	NA	NA
WP_015600775.1|1736723_1737713_+	2-dehydropantoate 2-reductase	NA	NA	NA	NA	NA
WP_006026146.1|1737794_1738244_-	winged helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_015600780.1|1738334_1739498_-	glycerate kinase	NA	NA	NA	NA	NA
WP_075644809.1|1739800_1739926_+	hypothetical protein	NA	NA	NA	NA	NA
WP_015602421.1|1739945_1741295_+	trigger factor	NA	NA	NA	NA	NA
WP_006026149.1|1741439_1742093_+	ATP-dependent Clp endopeptidase proteolytic subunit ClpP	NA	A0A223W000	Agrobacterium_phage	57.0	1.1e-53
WP_004521258.1|1742252_1743524_+|protease	ATP-dependent Clp protease ATP-binding subunit ClpX	protease	G3M9Z9	Bacillus_virus	59.0	2.4e-134
>prophage 6
NC_021173	Burkholderia thailandensis MSMB121 chromosome 1, complete sequence	3967794	2121904	2162906	3967794	lysis,portal,plate,tail,transposase,capsid,terminase,head,holin	Burkholderia_virus(56.25%)	54	NA	NA
WP_015602418.1|2121904_2122264_+	type II toxin-antitoxin system HicB family antitoxin	NA	R4JJS9	Burkholderia_phage	81.5	2.1e-51
WP_015600260.1|2122591_2122921_-	helix-turn-helix domain-containing protein	NA	R4JEU7	Burkholderia_phage	92.7	1.2e-53
WP_015600134.1|2123153_2123306_+	hypothetical protein	NA	R4JMC2	Burkholderia_phage	70.0	1.8e-12
WP_041861674.1|2123293_2124163_+	DUF550 domain-containing protein	NA	R4JG80	Burkholderia_phage	71.8	1.4e-104
WP_015601415.1|2124159_2124660_+	hypothetical protein	NA	NA	NA	NA	NA
WP_015601027.1|2124690_2124876_+	hypothetical protein	NA	A4JWW7	Burkholderia_virus	90.2	8.3e-20
WP_009897093.1|2124872_2125094_+	hypothetical protein	NA	A4JWW6	Burkholderia_virus	100.0	1.6e-38
WP_041861676.1|2125097_2125313_+	hypothetical protein	NA	A4JWW5	Burkholderia_virus	97.0	9.7e-28
WP_006027274.1|2125321_2125459_+	hypothetical protein	NA	A4JWW4	Burkholderia_virus	97.8	6.2e-20
WP_006027273.1|2125616_2125835_+	hypothetical protein	NA	NA	NA	NA	NA
WP_015600181.1|2126087_2127404_+	DNA cytosine methyltransferase	NA	A0A1B0V7P0	Salmonella_phage	37.6	2.0e-67
WP_015601913.1|2129174_2129381_+	putative gp16, DNA methyltransferase	NA	A4JWW1	Burkholderia_virus	95.6	4.0e-31
WP_015600741.1|2129380_2131174_+	replication endonuclease	NA	A4JWW0	Burkholderia_virus	92.0	0.0e+00
WP_015600468.1|2131189_2131456_+	ogr/Delta-like zinc finger family protein	NA	A4JWV9	Burkholderia_virus	95.3	8.6e-42
WP_004532731.1|2131452_2131659_+	bacteriophage-acquired protein	NA	A4JWV8	Burkholderia_virus	100.0	8.7e-34
WP_075644822.1|2131745_2132402_+	AAA family ATPase	NA	A4JWV7	Burkholderia_virus	99.5	4.2e-114
WP_041861677.1|2132635_2132758_+	CopG family transcriptional regulator	NA	A4JWV6	Burkholderia_virus	97.5	2.9e-13
WP_015600440.1|2132861_2133395_+	PAAR domain-containing protein	NA	A4JWV5	Burkholderia_virus	96.0	5.6e-93
WP_015601730.1|2133391_2134129_+	VRR-NUC domain-containing protein	NA	A4JWV4	Burkholderia_virus	96.3	5.2e-129
WP_075644823.1|2134137_2135259_+	DUF3396 domain-containing protein	NA	A4JWV3	Burkholderia_virus	97.9	5.5e-215
WP_075644997.1|2135915_2136239_+	type II toxin-antitoxin system RelE/ParE family toxin	NA	A4JWV2	Burkholderia_virus	97.2	2.4e-54
WP_004202809.1|2136241_2136598_+	putative addiction module antidote protein	NA	A4JWV1	Burkholderia_virus	100.0	3.9e-42
WP_015600601.1|2136641_2137697_-|portal	phage portal protein	portal	A4JWQ2	Burkholderia_virus	97.7	1.6e-203
WP_015602129.1|2137693_2139463_-|terminase	terminase ATPase subunit family protein	terminase	A4JWQ1	Burkholderia_virus	98.5	0.0e+00
WP_041861863.1|2139641_2140094_+|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_082252628.1|2140100_2140625_+	hypothetical protein	NA	NA	NA	NA	NA
WP_075644826.1|2140698_2141295_+	hypothetical protein	NA	NA	NA	NA	NA
WP_138110445.1|2141336_2141660_+	hypothetical protein	NA	NA	NA	NA	NA
WP_015602349.1|2142141_2142951_+|capsid	GPO family capsid scaffolding protein	capsid	K4PAW2	Burkholderia_phage	98.5	1.1e-145
WP_015601766.1|2142984_2143998_+|capsid	phage major capsid protein, P2 family	capsid	A4JWP9	Burkholderia_virus	96.1	3.8e-183
WP_015600205.1|2143994_2144684_+|terminase	terminase endonuclease subunit	terminase	K4NX86	Burkholderia_phage	99.1	1.0e-115
WP_015602371.1|2144783_2145263_+|head	head completion/stabilization protein	head	K4NZV5	Burkholderia_phage	97.5	5.4e-79
WP_015601733.1|2145262_2145514_+	hypothetical protein	NA	K4NXI9	Burkholderia_phage	98.8	1.7e-39
WP_004524438.1|2145510_2145717_+|tail	tail protein	tail	K4PAW7	Burkholderia_phage	100.0	2.4e-31
WP_004553021.1|2145731_2146076_+	membrane protein	NA	K4NZQ3	Burkholderia_phage	99.1	6.5e-50
WP_015602400.1|2146077_2146350_+|holin	phage holin family protein	holin	K4NX91	Burkholderia_phage	98.9	2.5e-41
WP_015600152.1|2146346_2147159_+	DUF3380 domain-containing protein	NA	A4JWZ0	Burkholderia_virus	98.1	1.4e-148
WP_015600594.1|2147155_2147596_+|lysis	LysB family phage lysis regulatory protein	lysis	K4NXJ2	Burkholderia_phage	91.8	1.8e-65
WP_015601830.1|2147700_2148117_+|tail	phage tail protein	tail	A4JWT7	Burkholderia_virus	96.4	2.0e-69
WP_015600143.1|2148113_2148581_+	phage virion morphogenesis protein	NA	K4NZQ8	Burkholderia_phage	94.8	5.1e-74
WP_075644827.1|2149591_2150494_-	site-specific DNA-methyltransferase	NA	A4JWY5	Burkholderia_virus	93.8	8.8e-155
WP_015601241.1|2150568_2151249_+|plate	phage baseplate assembly protein V	plate	K4NXJ5	Burkholderia_phage	96.5	3.4e-119
WP_015600511.1|2151245_2151608_+	lysozyme family protein	NA	K4PAX6	Burkholderia_phage	95.0	4.7e-59
WP_015600644.1|2151604_2152510_+|plate	baseplate assembly protein	plate	K4NZR5	Burkholderia_phage	95.3	1.2e-156
WP_015602232.1|2152502_2153057_+|tail	phage tail protein I	tail	A4JWT0	Burkholderia_virus	96.2	8.7e-97
WP_075644828.1|2153058_2155431_+|tail	phage tail protein	tail	Q45YG3	Burkholderia_virus	90.6	0.0e+00
WP_006027244.1|2155447_2156119_+|tail	tail assembly chaperone	tail	A4JWS8	Burkholderia_virus	97.3	5.6e-106
WP_015600222.1|2156175_2157348_+|tail	phage tail sheath protein	tail	Q45YG5	Burkholderia_virus	98.5	1.3e-219
WP_015601762.1|2157363_2157873_+|tail	phage major tail tube protein	tail	K4NZR9	Burkholderia_phage	98.2	9.2e-93
WP_015600156.1|2157930_2158275_+|tail	phage tail assembly protein	tail	K4NXA3	Burkholderia_phage	98.2	9.7e-54
WP_009914998.1|2158283_2158400_+|tail	GpE family phage tail protein	tail	A0A089FGX3	Burkholderia_phage	86.8	8.3e-10
WP_075644829.1|2158396_2161363_+	hypothetical protein	NA	Q45YG8	Burkholderia_virus	95.3	0.0e+00
WP_015601642.1|2161380_2161806_+|tail	phage tail protein	tail	A4JWS2	Burkholderia_virus	98.6	9.7e-72
WP_015602174.1|2161805_2162906_+	phage late control D family protein	NA	K4PAY4	Burkholderia_phage	96.2	1.8e-194
>prophage 7
NC_021173	Burkholderia thailandensis MSMB121 chromosome 1, complete sequence	3967794	3208262	3219172	3967794	protease	Agrobacterium_phage(16.67%)	9	NA	NA
WP_006024809.1|3208262_3210563_-|protease	ATP-dependent Clp protease ATP-binding subunit ClpA	protease	A0A223W0B1	Agrobacterium_phage	42.2	2.3e-167
WP_006024808.1|3210559_3210874_-|protease	ATP-dependent Clp protease adapter ClpS	protease	A0A218MMY6	uncultured_virus	45.8	1.2e-13
WP_004196460.1|3211403_3211607_+	cold-shock protein	NA	A0A2H4N7Y6	Lake_Baikal_phage	81.8	6.8e-23
WP_015601231.1|3211730_3213329_-	multicopper oxidase family protein	NA	NA	NA	NA	NA
WP_006024806.1|3213499_3214759_-	NADP-dependent isocitrate dehydrogenase	NA	Q77Z09	Phage_21	63.0	8.9e-12
WP_006024805.1|3215023_3215602_+	pseudouridine synthase	NA	NA	NA	NA	NA
WP_071810810.1|3215862_3216081_+	hypothetical protein	NA	NA	NA	NA	NA
WP_015601971.1|3216273_3216783_+	DUF192 domain-containing protein	NA	A0A1B1IUW8	uncultured_Mediterranean_phage	40.2	3.2e-13
WP_006024803.1|3217057_3219172_+	elongation factor G	NA	E4ZFJ7	Streptococcus_phage	26.5	1.5e-56
>prophage 1
NC_021174	Burkholderia thailandensis MSMB121 chromosome 2, complete sequence	2763585	311888	378156	2763585	holin,tail,plate	Escherichia_phage(30.0%)	57	NA	NA
WP_006028749.1|311888_313586_+|holin	choline dehydrogenase	holin	A0A1V0S9M4	Catovirus	29.3	1.3e-50
WP_015603035.1|314505_317877_+	hypothetical protein	NA	NA	NA	NA	NA
WP_015603567.1|318062_319490_+	MFS transporter	NA	NA	NA	NA	NA
WP_015603436.1|319553_321032_-	PAS domain-containing protein	NA	NA	NA	NA	NA
WP_006028753.1|321028_321481_-	response regulator	NA	NA	NA	NA	NA
WP_015603602.1|321506_323657_-	PAS domain S-box protein	NA	A0A1V0SGX0	Hokovirus	26.1	1.7e-18
WP_006028755.1|324141_324627_-	peroxiredoxin	NA	NA	NA	NA	NA
WP_015603598.1|324666_325599_-	2-hydroxyacid dehydrogenase	NA	A0A285PXZ1	Cedratvirus	33.6	1.7e-20
WP_006028757.1|325710_325971_-	hypothetical protein	NA	NA	NA	NA	NA
WP_015603731.1|326231_326465_+	hypothetical protein	NA	NA	NA	NA	NA
WP_015603000.1|326517_326970_-	dihydroneopterin aldolase	NA	NA	NA	NA	NA
WP_015603514.1|326969_327605_-	sarcosine oxidase gamma subunit	NA	NA	NA	NA	NA
WP_015602562.1|327594_330603_-	sarcosine oxidase subunit alpha family protein	NA	NA	NA	NA	NA
WP_075645202.1|330599_330887_-	sarcosine oxidase subunit delta	NA	NA	NA	NA	NA
WP_015603114.1|331070_332315_-	sarcosine oxidase subunit beta family protein	NA	NA	NA	NA	NA
WP_015603843.1|332331_333717_-	L-serine ammonia-lyase	NA	NA	NA	NA	NA
WP_015603081.1|334006_335152_+	GlxA family transcriptional regulator	NA	NA	NA	NA	NA
WP_041861934.1|335163_335349_-	hypothetical protein	NA	NA	NA	NA	NA
WP_015603113.1|335427_336129_-	DUF480 domain-containing protein	NA	NA	NA	NA	NA
WP_015603238.1|336313_337042_-	glutathione S-transferase	NA	NA	NA	NA	NA
WP_015603283.1|337743_338751_+	sigma-54-dependent Fis family transcriptional regulator	NA	NA	NA	NA	NA
WP_015603497.1|339080_339350_+	hypothetical protein	NA	NA	NA	NA	NA
WP_006028770.1|339564_339954_+	hypothetical protein	NA	NA	NA	NA	NA
WP_015603339.1|339976_341458_+|tail	phage tail sheath family protein	tail	A0A1J0GW47	Streptomyces_phage	30.4	2.6e-34
WP_006028772.1|341491_342016_+|tail	phage tail protein	tail	NA	NA	NA	NA
WP_075645060.1|342074_342803_+	hypothetical protein	NA	NA	NA	NA	NA
WP_041861935.1|342799_343636_+	hypothetical protein	NA	NA	NA	NA	NA
WP_015603125.1|343632_344982_+	DUF4255 domain-containing protein	NA	NA	NA	NA	NA
WP_015602575.1|344978_346907_+	ATP-binding protein	NA	A0A2D2W2C3	Stenotrophomonas_phage	34.3	8.2e-09
WP_015603041.1|346903_347350_+	hypothetical protein	NA	NA	NA	NA	NA
WP_015603571.1|347346_348612_+	DUF4157 domain-containing protein	NA	NA	NA	NA	NA
WP_015603071.1|348608_348782_+	hypothetical protein	NA	NA	NA	NA	NA
WP_015603540.1|348778_351574_+	DUF4157 domain-containing protein	NA	NA	NA	NA	NA
WP_006028782.1|351570_352230_+	hypothetical protein	NA	NA	NA	NA	NA
WP_006028783.1|352363_352714_+	hypothetical protein	NA	NA	NA	NA	NA
WP_015603911.1|352727_353852_+	hypothetical protein	NA	NA	NA	NA	NA
WP_006028785.1|353848_354361_+	hypothetical protein	NA	NA	NA	NA	NA
WP_015602894.1|354363_354681_+	hypothetical protein	NA	NA	NA	NA	NA
WP_006028787.1|354691_355060_+	GPW/gp25 family protein	NA	NA	NA	NA	NA
WP_102812148.1|355092_357591_+|plate	putative baseplate assembly protein	plate	A0A1Q1PVP2	Phage_DP-2017a	21.4	1.6e-09
WP_041862105.1|357713_360329_+|plate	putative baseplate assembly protein	plate	NA	NA	NA	NA
WP_015602716.1|360325_362368_+	hypothetical protein	NA	NA	NA	NA	NA
WP_102812147.1|362402_365642_+	hypothetical protein	NA	NA	NA	NA	NA
WP_015602957.1|365663_366212_+	hypothetical protein	NA	NA	NA	NA	NA
WP_006028793.1|366325_366793_-	cupin domain-containing protein	NA	NA	NA	NA	NA
WP_015602755.1|366852_367467_-	HAD family phosphatase	NA	NA	NA	NA	NA
WP_015603993.1|367657_368362_+	FadR family transcriptional regulator	NA	NA	NA	NA	NA
WP_015603177.1|368433_369324_+	NAD(P)-dependent oxidoreductase	NA	A0A077SLF7	Escherichia_phage	57.3	1.9e-77
WP_015603703.1|369343_370687_+	four-carbon acid sugar kinase family protein	NA	A0A077SLJ7	Escherichia_phage	45.6	8.1e-88
WP_015603522.1|370683_371325_+	aldolase	NA	A0A077SK32	Escherichia_phage	45.1	3.3e-39
WP_009915291.1|371426_372749_+	MFS transporter	NA	NA	NA	NA	NA
WP_015603788.1|372810_373587_+	hydroxypyruvate isomerase family protein	NA	NA	NA	NA	NA
WP_006028801.1|373614_374586_+	SDR family oxidoreductase	NA	NA	NA	NA	NA
WP_015603926.1|375053_375746_+	aspartyl/asparaginyl beta-hydroxylase domain-containing protein	NA	S4VR59	Pandoravirus	36.8	2.0e-21
WP_015603322.1|375938_376913_+	hypothetical protein	NA	NA	NA	NA	NA
WP_015603265.1|376963_377131_-	aspartyl/asparaginyl beta-hydroxylase	NA	NA	NA	NA	NA
WP_009915293.1|377205_378156_-|holin	choline ABC transporter substrate-binding protein	holin	NA	NA	NA	NA
