The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
NC_021151	Salmonella enterica subsp. enterica serovar Typhimurium str. U288, complete sequence	4852606	280940	391862	4852606	tRNA,tail,protease,lysis,holin,terminase,integrase,portal	Salmonella_phage(38.33%)	114	278163:278179	341405:341421
278163:278179	attL	GCTTTCAGCGTGGAAAA	NA	NA	NA	NA
WP_000560527.1|280940_281363_+|tRNA	aminoacyl-tRNA hydrolase	tRNA	NA	NA	NA	NA
WP_001260683.1|282173_283892_-|tRNA	proline--tRNA ligase	tRNA	NA	NA	NA	NA
WP_000093986.1|284002_284710_-|tRNA	tRNA (N6-threonylcarbamoyladenosine(37)-N6)-methyltransferase TrmO	tRNA	NA	NA	NA	NA
WP_001202315.1|284706_285111_-	Rcs stress response system protein RcsF	NA	NA	NA	NA	NA
WP_000874215.1|285229_286045_-	methionine ABC transporter substrate-binding lipoprotein MetQ	NA	NA	NA	NA	NA
WP_001287486.1|286083_286737_-	methionine ABC transporter permease MetI	NA	NA	NA	NA	NA
WP_000594021.1|286729_287761_-	methionine ABC transporter ATP-binding protein MetN	NA	G9BWD6	Planktothrix_phage	40.2	5.5e-36
WP_001051726.1|287950_288517_+	D-glycero-beta-D-manno-heptose 1,7-bisphosphate 7-phosphatase	NA	NA	NA	NA	NA
WP_000985653.1|294551_295007_+	DUF4385 domain-containing protein	NA	E3SMI8	Prochlorococcus_phage	50.0	3.0e-34
WP_000807809.1|295110_296412_+	MFS transporter	NA	Q6JIH2	Burkholderia_virus	30.4	6.9e-44
WP_001264473.1|296408_296732_-	YfiM family lipoprotein	NA	NA	NA	NA	NA
WP_000949286.1|296776_298132_-	CDP-diacylglycerol--serine O-phosphatidyltransferase	NA	NA	NA	NA	NA
WP_000082639.1|298246_300907_-	protein lysine acetyltransferase	NA	NA	NA	NA	NA
WP_000183639.1|300960_301641_-	DTW domain-containing protein	NA	NA	NA	NA	NA
WP_001098732.1|301713_302133_-	thioredoxin TrxC	NA	A0A0K2FIM3	Achromobacter_phage	40.6	1.2e-16
WP_000997368.1|302336_303374_+|tRNA	tRNA/rRNA methyltransferase	tRNA	NA	NA	NA	NA
WP_000179978.1|303489_304179_-	uracil-DNA glycosylase	NA	A0A172DS90	Canid_alphaherpesvirus	49.5	4.6e-55
WP_000627811.1|304497_304881_+	autonomous glycyl radical cofactor GrcA	NA	Q7Y524	Enterobacteria_phage	74.0	6.1e-33
WP_000188414.1|304942_305530_-	cysteine/O-acetylserine transporter	NA	NA	NA	NA	NA
WP_001526875.1|305632_306532_+	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_000219174.1|306549_307884_-	ATP-dependent RNA helicase SrmB	NA	A0A1B1IS59	uncultured_Mediterranean_phage	29.7	1.6e-43
WP_000083343.1|308014_308752_+|tRNA	tRNA(1)(Val) (adenine(37)-N(6))-methyltransferase TrmN	tRNA	NA	NA	NA	NA
WP_000989177.1|308736_310359_-	L-aspartate oxidase	NA	NA	NA	NA	NA
WP_014344135.1|310622_310787_+	rpoE leader peptide RseD	NA	NA	NA	NA	NA
WP_000003307.1|310783_311359_+	RNA polymerase sigma factor RpoE	NA	NA	NA	NA	NA
WP_001168374.1|311390_312041_+	anti-sigma-E factor RseA	NA	NA	NA	NA	NA
WP_000812017.1|312040_312997_+	sigma-E factor regulatory protein RseB	NA	NA	NA	NA	NA
WP_000589087.1|312993_313473_+	SoxR-reducing system protein RseC	NA	NA	NA	NA	NA
WP_001007939.1|313970_315200_+|integrase	site-specific integrase	integrase	H6WRW7	Salmonella_phage	94.4	2.9e-233
WP_001670787.1|315177_315462_-	excisionase Xis	NA	H6WRW8	Salmonella_phage	86.2	3.1e-42
WP_001237031.1|315502_315742_-	DUF4060 family protein	NA	S4TR31	Salmonella_phage	100.0	2.0e-37
WP_000017133.1|316905_319791_-	exodeoxyribonuclease	NA	S4TNL0	Salmonella_phage	97.3	0.0e+00
WP_001668146.1|319917_320217_-	hypothetical protein	NA	S4TSN6	Salmonella_phage	84.5	8.1e-49
WP_051106644.1|320238_320430_-	hypothetical protein	NA	H6WRX3	Salmonella_phage	92.2	1.9e-19
WP_010989002.1|320390_320651_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001038966.1|320700_321111_-	helix-turn-helix domain-containing protein	NA	A0A1B5FPF4	Escherichia_phage	42.4	8.1e-07
WP_000370145.1|321230_321470_+	helix-turn-helix domain-containing protein	NA	H6WRX5	Salmonella_phage	47.2	8.3e-12
WP_001574095.1|321435_321810_+	hypothetical protein	NA	S4TTD7	Salmonella_phage	99.2	3.9e-64
WP_000062941.1|321894_322878_+	hypothetical protein	NA	H6WRX7	Salmonella_phage	100.0	1.9e-163
WP_000800010.1|322880_323630_+	ATP-binding protein	NA	S4TNF5	Salmonella_phage	99.6	3.6e-138
WP_000113629.1|323640_323988_+	DUF977 family protein	NA	H6WRX9	Salmonella_phage	89.6	5.4e-52
WP_000065108.1|323984_324296_+	ead/Ea22-like family protein	NA	A0A220NQV2	Salmonella_phage	97.2	7.2e-32
WP_010989003.1|324373_324664_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001217665.1|324955_325189_+	DinI family protein	NA	H6WRY5	Salmonella_phage	98.7	2.1e-36
WP_000807548.1|325300_325522_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000929805.1|325604_326207_+	DUF1367 family protein	NA	S4TTI0	Salmonella_phage	98.5	8.3e-109
WP_001096547.1|326415_327027_+	hypothetical protein	NA	A0A0M4RU10	Salmonella_phage	99.5	4.2e-92
WP_001617856.1|327023_327170_+	YlcG family protein	NA	A0A0M5M7B2	Salmonella_phage	97.9	4.3e-19
WP_001047631.1|327159_327957_+	antitermination protein	NA	A0A0M4S661	Salmonella_phage	99.6	2.3e-151
WP_001534733.1|328513_328639_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000798705.1|328774_329224_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001141973.1|329584_330271_-|protease	type III secretion system effector protease GtgA	protease	Q9MBM0	Phage_Gifsy-2	100.0	2.1e-132
WP_001574216.1|330546_330876_+|holin	phage holin, lambda family	holin	A0A0M3ULK9	Salmonella_phage	100.0	5.8e-56
WP_000984586.1|330859_331312_+	lysozyme	NA	A0A0M4R365	Salmonella_phage	97.3	2.3e-79
WP_001541990.1|331329_331809_+|lysis	lysis protein	lysis	Q56118	Enterobacteria_phage	77.0	1.4e-55
WP_000371784.1|332015_332549_+	DUF1441 family protein	NA	A0A291AWV8	Escherichia_phage	48.1	1.0e-33
WP_000989241.1|332505_334644_+|terminase	phage terminase large subunit family protein	terminase	A5LH27	Enterobacteria_phage	72.6	3.4e-290
WP_000196190.1|334640_334847_+	hypothetical protein	NA	A0A1W6JT66	Pseudomonas_phage	53.3	2.9e-05
WP_001009207.1|334843_336391_+|portal	phage portal protein	portal	A0A291AWU2	Escherichia_phage	64.3	2.8e-177
WP_010989008.1|336314_338396_+|protease	Clp protease ClpP	protease	A0A291AWT6	Escherichia_phage	69.5	4.8e-265
WP_001107908.1|338486_338810_+	DUF2190 family protein	NA	K7PLV6	Enterobacteria_phage	61.3	7.7e-29
WP_000774239.1|338802_339102_+	ATP-binding protein	NA	K7PH43	Enterobacteria_phage	45.1	4.5e-15
WP_000453194.1|339082_339649_+|tail	phage tail protein	tail	Q9G063	Phage_Gifsy-2	97.8	9.5e-14
WP_000196702.1|339645_340047_+|tail	tail protein	tail	K7PHM6	Enterobacterial_phage	60.9	1.5e-42
WP_000132756.1|340058_340808_+|tail	tail protein	tail	A0A291AWU6	Escherichia_phage	68.6	3.7e-90
WP_000478859.1|340853_341252_+|tail	phage minor tail protein G	tail	K7PLV8	Enterobacteria_phage	56.8	8.6e-30
WP_010989009.1|341248_341578_+|tail	phage tail assembly protein T	tail	A5LH37	Enterobacteria_phage	50.9	5.0e-23
341405:341421	attR	TTTTCCACGCTGAAAGC	NA	NA	NA	NA
WP_010989010.1|341657_344645_+|tail	phage tail tape measure protein	tail	A0A291AWX1	Escherichia_phage	62.1	8.2e-266
WP_000978296.1|344641_344974_+|tail	phage tail protein	tail	A5LH39	Enterobacteria_phage	61.5	3.3e-35
WP_000725267.1|345072_345570_+	outer membrane beta-barrel protein	NA	A0A1B0VBR9	Salmonella_phage	36.6	1.4e-16
WP_000877926.1|345686_346220_-	superoxide dismutase [Cu-Zn]	NA	Q9MC02	Salmonella_phage	54.0	1.8e-46
WP_001152415.1|346309_347005_+|tail	phage minor tail protein L	tail	A0A0K2FJ01	Enterobacteria_phage	66.7	1.3e-89
WP_000606351.1|347014_347752_+|tail	phage tail protein	tail	A0A0P0ZE89	Stx2-converting_phage	76.1	1.6e-114
WP_000246065.1|347649_348354_+|tail	tail assembly protein	tail	A5LH42	Enterobacteria_phage	62.6	9.2e-67
WP_001541992.1|348425_350873_+	host specificity protein J	NA	Q687E8	Enterobacteria_phage	68.0	0.0e+00
WP_001687102.1|350899_351775_+	DUF1983 domain-containing protein	NA	K7PKJ2	Enterobacteria_phage	77.1	1.1e-48
WP_000178849.1|351813_352056_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001144679.1|352109_354548_+|tail	tail protein	tail	A0A0K2FIZ6	Escherichia_phage	63.4	2.9e-91
WP_000143167.1|354547_355129_+|tail	tail fiber assembly protein	tail	A0A0M4RTP2	Salmonella_phage	89.5	1.7e-95
WP_001533476.1|355604_356573_+	SPI-2 type III secretion system effector SseI	NA	Q9MBL9	Phage_Gifsy-2	99.7	7.9e-194
WP_000334547.1|357220_357847_-	SOS response-associated peptidase	NA	A0A2H4J5W2	uncultured_Caudovirales_phage	63.2	1.4e-66
WP_010989011.1|357915_358215_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001525490.1|358199_358886_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000497441.1|359156_359348_-	DinI-like family protein	NA	S4TNM0	Salmonella_phage	95.2	6.2e-26
WP_000193784.1|359774_362387_+	aminopeptidase N	NA	A0A0P0IY26	Acinetobacter_phage	22.6	6.3e-20
WP_000291723.1|362594_363605_+	quinone-dependent dihydroorotate dehydrogenase	NA	NA	NA	NA	NA
WP_001220671.1|363770_364313_+	cell division protein ZapC	NA	NA	NA	NA	NA
WP_000224069.1|364309_365419_-	MOSC domain-containing protein	NA	NA	NA	NA	NA
WP_001086485.1|365517_367626_+	bifunctional 23S rRNA (guanine(2069)-N(7))-methyltransferase RlmK/23S rRNA (guanine(2445)-N(2))-methyltransferase RlmL	NA	NA	NA	NA	NA
WP_000053044.1|367638_369546_+	ABC transporter ATP-binding protein	NA	A0A2K9L3Z8	Tupanvirus	29.8	2.4e-53
WP_000333152.1|369560_370814_+	membrane integrity-associated transporter subunit PqiA	NA	NA	NA	NA	NA
WP_000433414.1|370818_372459_+	intermembrane transport protein PqiB	NA	NA	NA	NA	NA
WP_000759136.1|372455_373019_+	membrane integrity-associated transporter subunit PqiC	NA	NA	NA	NA	NA
WP_001537784.1|373274_373442_+	ribosome modulation factor	NA	NA	NA	NA	NA
WP_000227928.1|373541_374060_-	bifunctional 3-hydroxydecanoyl-ACP dehydratase/trans-2-decenoyl-ACP isomerase	NA	NA	NA	NA	NA
WP_000156454.1|374128_375889_-|protease	Lon protease family protein	protease	NA	NA	NA	NA
WP_000877172.1|376074_376527_+	macrodomain Ter protein MatP	NA	NA	NA	NA	NA
WP_001674965.1|376598_377651_-	porin OmpA	NA	NA	NA	NA	NA
WP_000288732.1|378007_378517_-	cell division inhibitor SulA	NA	NA	NA	NA	NA
WP_001202375.1|378733_379339_+	TfoX/Sxy family DNA transformation protein	NA	NA	NA	NA	NA
WP_000950880.1|379325_381479_-	TIGR01666 family membrane protein	NA	NA	NA	NA	NA
WP_001261222.1|381497_381944_-	YccF domain-containing protein	NA	NA	NA	NA	NA
WP_000420505.1|382067_384122_+	DNA helicase IV	NA	A7KV33	Bacillus_phage	27.6	8.5e-20
WP_000424187.1|384157_384616_-	methylglyoxal synthase	NA	NA	NA	NA	NA
WP_000847719.1|384710_385373_-	DUF2057 family protein	NA	NA	NA	NA	NA
WP_001537782.1|385546_385960_+	CoA-binding protein	NA	NA	NA	NA	NA
WP_000561983.1|386004_386322_-	heat shock protein HspQ	NA	NA	NA	NA	NA
WP_000140480.1|386379_387591_-	23S rRNA (cytosine(1962)-C(5))-methyltransferase RlmI	NA	NA	NA	NA	NA
WP_000859419.1|387805_388354_+	YbhB/YbcL family Raf kinase inhibitor-like protein	NA	NA	NA	NA	NA
WP_000548082.1|388379_389159_+	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_000072884.1|389207_389489_+	acylphosphatase	NA	NA	NA	NA	NA
WP_000904446.1|389485_389815_-	sulfurtransferase TusE	NA	NA	NA	NA	NA
WP_000374050.1|389901_390561_-|protease	FtsH protease modulator YccA	protease	A0A2H4JFM9	uncultured_Caudovirales_phage	51.9	2.3e-43
WP_000938191.1|391181_391862_-|protease	type III secretion system effector protease PipA	protease	Q9MBM0	Phage_Gifsy-2	70.6	8.3e-81
>prophage 2
NC_021151	Salmonella enterica subsp. enterica serovar Typhimurium str. U288, complete sequence	4852606	1178231	1185040	4852606	integrase,tail	Salmonella_phage(33.33%)	11	1173094:1173116	1182809:1182831
1173094:1173116	attL	AAAAAGAGACCGAATACGATTCC	NA	NA	NA	NA
WP_000275418.1|1178231_1179113_-|tail	tail assembly protein	tail	A0A0M4RTP2	Salmonella_phage	76.0	2.2e-65
WP_001521334.1|1179585_1179774_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000789530.1|1179838_1180006_+	lytic enzyme	NA	NA	NA	NA	NA
WP_001050882.1|1180262_1180796_-	DUF2514 domain-containing protein	NA	A0A291LBG9	Klebsiella_phage	48.3	1.4e-11
WP_001013467.1|1180849_1181080_-	hypothetical protein	NA	Q8HA86	Salmonella_phage	93.7	6.1e-28
WP_010989030.1|1181269_1181764_+	hypothetical protein	NA	A0A0U2I1R6	Escherichia_phage	68.9	8.2e-22
WP_001520095.1|1181823_1182678_+|integrase	tyrosine-type recombinase/integrase	integrase	A0A2H4IYC8	uncultured_Caudovirales_phage	50.9	3.6e-73
WP_000722368.1|1183051_1183405_-	YebY family protein	NA	NA	NA	NA	NA
1182809:1182831	attR	AAAAAGAGACCGAATACGATTCC	NA	NA	NA	NA
WP_000979702.1|1183421_1184297_-	copper homeostasis membrane protein CopD	NA	NA	NA	NA	NA
WP_000168393.1|1184297_1184672_-	CopC domain-containing protein YobA	NA	NA	NA	NA	NA
WP_000856224.1|1184809_1185040_+	DNA polymerase III subunit theta	NA	H9C187	Pectobacterium_phage	60.3	2.9e-14
>prophage 3
NC_021151	Salmonella enterica subsp. enterica serovar Typhimurium str. U288, complete sequence	4852606	1289086	1299689	4852606		Morganella_phage(25.0%)	12	NA	NA
WP_001157322.1|1289086_1290517_-	DNA cytosine methyltransferase	NA	E5E3X6	Burkholderia_phage	57.4	1.0e-104
WP_000377041.1|1290590_1291286_-	phosphohydrolase	NA	A0A1D6Y7U0	Golden_Marseillevirus	27.1	2.8e-07
WP_000107430.1|1291377_1291677_-	membrane protein	NA	NA	NA	NA	NA
WP_001080680.1|1292326_1293523_+	porin OmpS1	NA	Q1MVN1	Enterobacteria_phage	56.1	1.8e-110
WP_024131109.1|1293783_1293972_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000208509.1|1293982_1294195_-	cold-shock protein	NA	A0A1W6JNX5	Morganella_phage	70.0	3.9e-21
WP_000457662.1|1294649_1295918_-	Y-family DNA polymerase	NA	I6RSM4	Salmonella_phage	92.2	4.2e-227
WP_000394196.1|1295920_1296340_-	translesion error-prone DNA polymerase V autoproteolytic subunit	NA	A0A1W6JNS2	Morganella_phage	60.5	8.5e-36
WP_000500831.1|1296466_1296628_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000598920.1|1297108_1297906_+	DgsA anti-repressor MtfA	NA	NA	NA	NA	NA
WP_001738920.1|1298277_1298568_+	DUF4102 domain-containing protein	NA	H2BDA3	Pseudomonas_phage	49.1	3.0e-08
WP_001219015.1|1299215_1299689_+	peptidase	NA	A0A0F6TJ61	Escherichia_coli_O157_typing_phage	77.6	7.1e-39
>prophage 4
NC_021151	Salmonella enterica subsp. enterica serovar Typhimurium str. U288, complete sequence	4852606	1384365	1394871	4852606		Enterobacteria_phage(37.5%)	10	NA	NA
WP_000126349.1|1384365_1385679_-	lipopolysaccharide biosynthesis protein RfbH	NA	H8ZJ36	Ostreococcus_tauri_virus	35.1	7.0e-52
WP_000565905.1|1385705_1386785_-	CDP-glucose 4,6-dehydratase	NA	A0A222YY99	Synechococcus_phage	24.1	6.6e-16
WP_000648784.1|1386789_1387563_-	glucose-1-phosphate cytidylyltransferase	NA	NA	NA	NA	NA
WP_000018226.1|1387559_1388552_-	CDP-6-deoxy-delta-3,4-glucoseen reductase	NA	NA	NA	NA	NA
WP_000973708.1|1388557_1389109_-	dTDP-4-dehydrorhamnose 3,5-epimerase	NA	I7HJC4	Enterobacteria_phage	58.0	2.2e-52
WP_000857529.1|1389109_1389988_-	glucose-1-phosphate thymidylyltransferase RfbA	NA	I7I009	Enterobacteria_phage	65.5	9.3e-109
WP_001023662.1|1390035_1390935_-	dTDP-4-dehydrorhamnose reductase	NA	A0A291LA50	Escherichia_phage	36.3	1.4e-30
WP_000697840.1|1390934_1392020_-	dTDP-glucose 4,6-dehydratase	NA	I7HTA3	Enterobacteria_phage	53.9	1.2e-102
WP_000981469.1|1392396_1393290_-	GalU regulator GalF	NA	A0A127AW70	Bacillus_phage	42.2	4.8e-44
WP_001111841.1|1393467_1394871_-	colanic acid biosynthesis protein WcaM	NA	A0A291LBB9	Klebsiella_phage	27.1	3.1e-21
>prophage 5
NC_021151	Salmonella enterica subsp. enterica serovar Typhimurium str. U288, complete sequence	4852606	1491757	1558152	4852606	holin,tail,lysis	Salmonella_phage(28.57%)	60	NA	NA
WP_000989296.1|1491757_1492453_+|lysis	CidB/LrgB family autolysis modulator	lysis	NA	NA	NA	NA
WP_000553526.1|1492606_1493491_+	cytidine deaminase	NA	NA	NA	NA	NA
WP_000920081.1|1493667_1494387_+	outer membrane permeability protein SanA	NA	NA	NA	NA	NA
WP_000605187.1|1494383_1494629_+	DUF2542 family protein	NA	NA	NA	NA	NA
WP_001136409.1|1494833_1496075_+	NAD(P)-dependent oxidoreductase	NA	NA	NA	NA	NA
WP_000956095.1|1496068_1497304_+	NAD-dependent dihydropyrimidine dehydrogenase subunit PreA	NA	NA	NA	NA	NA
WP_001275101.1|1497378_1498389_-	galactose/methyl galactoside ABC transporter permease MglC	NA	NA	NA	NA	NA
WP_000535907.1|1498404_1499925_-	galactose/methyl galactoside ABC transporter ATP-binding protein MglA	NA	F2Y2R6	Organic_Lake_phycodnavirus	31.9	1.0e-09
WP_001036943.1|1500058_1501057_-	galactose/glucose ABC transporter substrate-binding protein MglB	NA	NA	NA	NA	NA
WP_000628631.1|1501555_1502578_-	HTH-type transcriptional regulator GalS	NA	NA	NA	NA	NA
WP_001526153.1|1502727_1503870_-	DUF418 family protein	NA	NA	NA	NA	NA
WP_001540445.1|1503884_1504553_-	GTP cyclohydrolase I FolE	NA	M1Q6X8	Cellulophaga_phage	55.8	1.2e-55
WP_000425488.1|1504882_1505740_+	S-formylglutathione hydrolase	NA	NA	NA	NA	NA
WP_000876817.1|1505728_1506118_-	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_000443208.1|1506122_1507490_-	L-serine ammonia-lyase	NA	NA	NA	NA	NA
WP_000022915.1|1507706_1508594_+	phosphoserine phosphatase SerB	NA	NA	NA	NA	NA
WP_000023807.1|1508626_1509949_+	MFS transporter	NA	NA	NA	NA	NA
WP_000488255.1|1509992_1511984_-	catecholate siderophore receptor CirA	NA	A0A0P0I887	Acinetobacter_phage	37.9	6.7e-14
WP_000535000.1|1512329_1513799_-	lysine-specific permease	NA	NA	NA	NA	NA
WP_000548308.1|1513988_1514852_-	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_000137960.1|1514972_1516022_+	YeiH family protein	NA	NA	NA	NA	NA
WP_000873909.1|1516100_1516958_+	deoxyribonuclease IV	NA	A0A1V0SBL9	Catovirus	28.5	2.2e-22
WP_000854414.1|1517022_1518711_-	PTS fructose transporter subunit IIBC	NA	NA	NA	NA	NA
WP_000091249.1|1518727_1519666_-	1-phosphofructokinase	NA	NA	NA	NA	NA
WP_000487287.1|1519665_1520796_-	fused PTS fructose transporter subunit IIA/HPr protein	NA	NA	NA	NA	NA
WP_000551937.1|1521164_1522346_+	sugar efflux transporter SetB	NA	NA	NA	NA	NA
WP_001213882.1|1522410_1523076_-	membrane protein	NA	NA	NA	NA	NA
WP_001519564.1|1523077_1523200_-	membrane protein	NA	NA	NA	NA	NA
WP_010989043.1|1523587_1523842_-	YkgJ family cysteine cluster protein	NA	NA	NA	NA	NA
WP_001136822.1|1524165_1524738_+	elongation factor P-like protein YeiP	NA	NA	NA	NA	NA
WP_000169350.1|1524950_1525937_+	GTP-binding protein	NA	NA	NA	NA	NA
WP_000178095.1|1525966_1526686_+	phosphatase PAP2 family protein	NA	NA	NA	NA	NA
WP_000241015.1|1527099_1527672_+	bifunctional murein DD-endopeptidase/murein LD-carboxypeptidase	NA	A0A1V0DZX6	Clostridioides_phage	38.9	8.1e-13
WP_000957746.1|1527997_1529554_+	cyclic di-GMP phosphodiesterase	NA	NA	NA	NA	NA
WP_000561747.1|1529660_1531466_+	ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_000501623.1|1531475_1532570_+	microcin C ABC transporter permease YejB	NA	NA	NA	NA	NA
WP_001137764.1|1532569_1533595_+	ABC transporter permease	NA	NA	NA	NA	NA
WP_000203622.1|1533596_1535186_+	microcin C ABC transporter ATP-binding protein YejF	NA	G9BWD6	Planktothrix_phage	32.5	8.5e-20
WP_001094639.1|1535189_1535534_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000213347.1|1535924_1537115_-	Bcr/CflA family multidrug efflux MFS transporter	NA	S4TR35	Salmonella_phage	22.2	2.4e-19
WP_001234836.1|1537142_1537838_-	16S rRNA pseudouridine(516) synthase RsuA	NA	NA	NA	NA	NA
WP_000578121.1|1537989_1539750_+	DEAD/DEAH box helicase	NA	M4Q3N1	Vibrio_phage	41.6	1.9e-100
WP_000494192.1|1539874_1540159_+	50S ribosomal protein L25	NA	NA	NA	NA	NA
WP_000033437.1|1540267_1540888_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000050806.1|1540915_1541923_-	nucleoid-associated protein YejK	NA	A0A1V0E8C0	Vibrio_phage	48.3	4.5e-83
WP_001135904.1|1542102_1542330_+	YejL family protein	NA	NA	NA	NA	NA
WP_000256150.1|1542361_1544122_+	cardiolipin transport protein PbgA	NA	NA	NA	NA	NA
WP_000806401.1|1544402_1544906_-	LexA family transcriptional regulator	NA	Q1MVE7	Enterobacteria_phage	71.3	9.5e-50
WP_000884778.1|1544933_1545224_+	DinI family protein	NA	S4TND2	Salmonella_phage	83.3	4.7e-25
WP_000639473.1|1545571_1547401_+	acyltransferase	NA	C6ZR20	Salmonella_phage	29.6	3.0e-61
WP_000022213.1|1547454_1547898_-|tail	tail fiber assembly protein	tail	A0A0F7LDZ0	Escherichia_phage	43.9	1.4e-28
WP_001215679.1|1548275_1548803_-|tail	tail fiber assembly protein	tail	A0A1S6KZZ1	Salmonella_phage	31.3	3.1e-11
WP_000554739.1|1548805_1550047_-	hypothetical protein	NA	Q8HAB4	Salmonella_phage	95.3	1.0e-52
WP_001120499.1|1550639_1550969_-|holin	phage holin, lambda family	holin	Q8SBE1	Shigella_phage	94.6	3.9e-36
WP_000894640.1|1551265_1552597_+	AAA family ATPase	NA	R9TRQ8	Vibrio_phage	28.5	2.1e-19
WP_010989045.1|1552625_1552994_-	antitermination protein Q	NA	A5LH77	Enterobacteria_phage	81.7	7.4e-52
WP_001202279.1|1553008_1553998_-	DUF968 domain-containing protein	NA	A0A1C9IHZ5	Salmonella_phage	97.3	6.0e-189
WP_001115840.1|1554326_1556693_-	SPI-2 type III secretion system effector E3 ubiquitin transferase SspH2	NA	Q9MBL9	Phage_Gifsy-2	88.7	2.9e-72
WP_001113462.1|1556861_1557065_-|tail	tail protein	tail	NA	NA	NA	NA
WP_000624225.1|1557360_1558152_-|tail	tail protein	tail	Q1MVL8	Enterobacteria_phage	31.6	1.7e-48
>prophage 6
NC_021151	Salmonella enterica subsp. enterica serovar Typhimurium str. U288, complete sequence	4852606	1896314	1999120	4852606	tRNA,transposase,head,tail,protease,lysis,terminase,holin,capsid,integrase,portal	Salmonella_phage(35.0%)	104	1934771:1934788	2005842:2005859
WP_000940032.1|1896314_1897046_-|tRNA	tRNA (cytosine(32)/uridine(32)-2'-O)-methyltransferase TrmJ	tRNA	NA	NA	NA	NA
WP_000553467.1|1897164_1897968_+	inositol-1-monophosphatase	NA	NA	NA	NA	NA
WP_000174944.1|1898112_1898991_+	alpha/beta hydrolase	NA	A0A1C9C5K3	Heterosigma_akashiwo_virus	24.7	3.5e-15
WP_000985204.1|1899172_1900216_+	anaerobic sulfite reductase subunit A	NA	NA	NA	NA	NA
WP_000017587.1|1900219_1901038_+	anaerobic sulfite reductase subunit B	NA	NA	NA	NA	NA
WP_000020685.1|1901048_1902062_+	sulfite reductase subunit C	NA	NA	NA	NA	NA
WP_000111027.1|1902062_1903049_-	nickel/cobalt transporter	NA	NA	NA	NA	NA
WP_000805728.1|1903039_1903678_-	DUF1007 family protein	NA	NA	NA	NA	NA
WP_000982961.1|1903803_1905081_+	stationary phase inducible protein CsiE	NA	NA	NA	NA	NA
WP_001173729.1|1905075_1906215_-	3-phenylpropionate MFS transporter	NA	NA	NA	NA	NA
WP_000919178.1|1906410_1907664_-	serine hydroxymethyltransferase	NA	A0A240F3L3	Aeromonas_phage	53.0	1.3e-100
WP_000883149.1|1907988_1909179_+	NO-inducible flavohemoprotein	NA	NA	NA	NA	NA
WP_001187150.1|1909360_1910905_+	CadC family transcriptional regulator	NA	NA	NA	NA	NA
WP_000100008.1|1911265_1912597_+	cadaverine/lysine antiporter	NA	NA	NA	NA	NA
WP_001100652.1|1912679_1914824_+	lysine decarboxylase CadA	NA	NA	NA	NA	NA
WP_000856793.1|1914879_1916340_+	MFS transporter	NA	A0A0P0IY73	Acinetobacter_phage	28.8	1.7e-46
WP_000717694.1|1916388_1916727_-	nitrogen regulatory protein P-II	NA	NA	NA	NA	NA
WP_000625591.1|1916803_1918141_-	two-component system response regulator GlrR	NA	W8CYM9	Bacillus_phage	29.2	1.8e-10
WP_001054236.1|1918137_1918902_-	two-component system QseEF-associated lipoprotein QseG	NA	NA	NA	NA	NA
WP_001670672.1|1918903_1920334_-	two component system sensor histidine kinase QseE/GlrK	NA	W8CYF6	Bacillus_phage	26.1	2.0e-15
WP_000970045.1|1920983_1924871_-	phosphoribosylformylglycinamidine synthase	NA	A9YX36	Burkholderia_phage	57.6	1.4e-127
WP_001747289.1|1924892_1925126_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000734248.1|1925126_1926671_+	membrane-bound lytic murein transglycosylase MltF	NA	NA	NA	NA	NA
WP_001134566.1|1926721_1927273_-|tRNA	tRNA adenosine(34) deaminase TadA	tRNA	NA	NA	NA	NA
WP_000253558.1|1927297_1927933_-	phosphatidylglycerophosphatase C	NA	NA	NA	NA	NA
WP_000361663.1|1927936_1929298_-	PTS transporter subunit EIIC	NA	NA	NA	NA	NA
WP_001048530.1|1929308_1930202_-	N-acetylmuramic acid 6-phosphate etherase	NA	NA	NA	NA	NA
WP_000995703.1|1930317_1931166_+	MurR/RpiR family transcriptional regulator	NA	NA	NA	NA	NA
WP_000684022.1|1931204_1932122_-	oxidoreductase	NA	NA	NA	NA	NA
WP_001276365.1|1932143_1933340_-	OFA family MFS transporter	NA	NA	NA	NA	NA
WP_001022463.1|1933455_1934382_+	LysR family transcriptional regulator	NA	A0A2P0ZL89	Lactobacillus_phage	24.4	3.0e-09
WP_001196290.1|1934419_1934680_+	YfhL family 4Fe-4S dicluster ferredoxin	NA	A0A1B1IWY9	uncultured_Mediterranean_phage	52.3	1.4e-17
1934771:1934788	attL	TTACGCCGCCATCCGGCA	NA	NA	NA	NA
WP_000986043.1|1934791_1935172_-	holo-ACP synthase	NA	NA	NA	NA	NA
WP_000818972.1|1935171_1935903_-	pyridoxine 5'-phosphate synthase	NA	NA	NA	NA	NA
WP_000399380.1|1935914_1936643_-	DNA repair protein RecO	NA	NA	NA	NA	NA
WP_000102232.1|1936654_1937560_-	GTPase Era	NA	NA	NA	NA	NA
WP_001068341.1|1937556_1938237_-	ribonuclease III	NA	A0A2K9L5P0	Tupanvirus	31.8	7.4e-21
WP_000002559.1|1938510_1939485_-	signal peptidase I	NA	NA	NA	NA	NA
WP_000790154.1|1939501_1941301_-	elongation factor 4	NA	E4ZFJ7	Streptococcus_phage	24.9	7.2e-23
WP_010989047.1|1941706_1943200_+	type III secretion effector GogB	NA	Q9MBM1	Phage_Gifsy-1	100.0	3.4e-260
WP_001542312.1|1943678_1943816_+	hypothetical protein	NA	NA	NA	NA	NA
WP_015589559.1|1944528_1944693_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_015701342.1|1945272_1945338_-	DUF4113 domain-containing protein	NA	NA	NA	NA	NA
WP_001738443.1|1945400_1945613_-	helix-turn-helix domain-containing protein	NA	S4TTF2	Salmonella_phage	90.6	3.8e-08
WP_010989049.1|1945719_1945947_+	PagK-like protein	NA	NA	NA	NA	NA
WP_000143154.1|1946043_1946622_-|tail	tail fiber assembly protein	tail	A0A0M4RTP2	Salmonella_phage	88.9	3.6e-93
WP_000593433.1|1946611_1947436_-|tail	tail protein	tail	A0A0M4QWS3	Salmonella_phage	92.0	1.2e-145
WP_001144691.1|1947432_1949805_-|tail	tail protein	tail	A0A0K2FIZ6	Escherichia_phage	65.6	1.1e-90
WP_000178853.1|1949858_1950101_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000514917.1|1950139_1953502_-	host specificity protein J	NA	K7PKJ2	Enterobacteria_phage	79.7	0.0e+00
WP_000246126.1|1953563_1954211_-|tail	tail assembly protein	tail	A5LH42	Enterobacteria_phage	77.7	2.1e-89
WP_000662739.1|1954108_1954846_-|tail	phage tail protein	tail	K7PLW1	Enterobacteria_phage	85.0	5.2e-129
WP_001152689.1|1954852_1955551_-|tail	phage minor tail protein L	tail	A0A1B5FP81	Escherichia_phage	76.3	5.5e-104
WP_000447369.1|1955560_1955890_-|tail	phage tail protein	tail	A5LH39	Enterobacteria_phage	70.4	1.3e-42
WP_000372072.1|1955892_1958988_-|tail	phage tail tape measure protein	tail	A0A291AWX1	Escherichia_phage	62.3	6.1e-280
WP_010989052.1|1958959_1959298_-|tail	phage tail assembly protein T	tail	A5LH37	Enterobacteria_phage	62.4	1.3e-31
WP_000479607.1|1959294_1959690_-|tail	phage minor tail protein G	tail	A5LH36	Enterobacteria_phage	56.5	2.3e-30
WP_000971954.1|1959740_1960487_-|tail	tail protein	tail	A0A291AWU6	Escherichia_phage	76.9	1.9e-99
WP_000033885.1|1960494_1960896_-|tail	tail protein	tail	Q9G0F3	Phage_Gifsy-1	100.0	8.1e-52
WP_000817263.1|1961004_1962135_+|transposase	IS200/IS605 family element transposase accessory protein TnpB	transposase	Q9G0F2	Phage_Gifsy-1	100.0	9.2e-218
WP_000677089.1|1962183_1962762_-|tail	phage tail protein	tail	A5LH33	Enterobacteria_phage	80.2	3.7e-82
WP_000083294.1|1962789_1963173_-|tail	tail attachment protein	tail	A0A0K2FJB7	Enterobacteria_phage	55.6	9.2e-29
WP_000201486.1|1963183_1963543_-	DNA packaging protein	NA	NA	NA	NA	NA
WP_000522566.1|1963600_1964629_-|capsid	major capsid protein	capsid	C6ZCY2	Enterobacteria_phage	61.1	1.7e-114
WP_000011260.1|1964683_1965031_-|head	head decoration protein	head	A0A2R9YJN3	Escherichia_phage	52.7	9.2e-20
WP_001189503.1|1965043_1966540_-	S49 family peptidase	NA	A0A0K2FI53	Enterobacteria_phage	52.2	8.1e-97
WP_000831821.1|1966529_1968110_-|portal	phage portal protein	portal	K7P6U7	Enterobacteria_phage	62.8	9.6e-189
WP_000201415.1|1968106_1968310_-|head,tail	head-tail joining protein	head,tail	K7PM10	Enterobacteria_phage	73.8	1.9e-17
WP_000623091.1|1968293_1970225_-|terminase	phage terminase large subunit family protein	terminase	A0A0K2FJ14	Enterobacteria_phage	65.7	6.3e-259
WP_001102153.1|1970196_1970742_-|terminase	terminase small subunit	terminase	A0A0U2S671	Escherichia_phage	80.6	1.5e-56
WP_000669690.1|1971028_1971430_+	hypothetical protein	NA	NA	NA	NA	NA
WP_024135675.1|1971665_1972124_-|lysis	lysis protein	lysis	A0A0M4RD57	Salmonella_phage	86.2	2.6e-62
WP_000984581.1|1972141_1972594_-	lysozyme	NA	A0A0M4R365	Salmonella_phage	97.3	5.1e-79
WP_001574216.1|1972577_1972907_-|holin	phage holin, lambda family	holin	A0A0M3ULK9	Salmonella_phage	100.0	5.8e-56
WP_015589560.1|1973182_1973863_+|protease	type III secretion system effector protease GogA	protease	Q9MBM2	Phage_Gifsy-1	99.6	8.7e-131
WP_000624622.1|1975479_1975827_-	IS66 family insertion sequence element accessory protein TnpB	NA	A0A0P0ZDM8	Stx2-converting_phage	76.6	2.6e-46
WP_015589562.1|1975826_1976504_-	IS66 family insertion sequence hypothetical protein	NA	A0A0P0ZCV4	Stx2-converting_phage	46.0	7.3e-21
WP_000657897.1|1976789_1976978_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000211409.1|1977484_1978048_-	ORF6N domain-containing protein	NA	A0A0P0ZC44	Stx2-converting_phage	92.2	7.6e-56
WP_001097241.1|1978320_1978998_-	antitermination protein	NA	I6PDF8	Cronobacter_phage	54.0	7.7e-63
WP_000801757.1|1978994_1979135_-	YlcG family protein	NA	A0A0M5M7B2	Salmonella_phage	78.9	7.2e-08
WP_001096550.1|1979131_1979743_-	recombination protein NinG	NA	A0A0M4RU10	Salmonella_phage	99.0	1.2e-91
WP_000807548.1|1980635_1980857_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001217665.1|1980968_1981202_-	DinI family protein	NA	H6WRY5	Salmonella_phage	98.7	2.1e-36
WP_010989003.1|1981493_1981784_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000065108.1|1981861_1982173_-	ead/Ea22-like family protein	NA	A0A220NQV2	Salmonella_phage	97.2	7.2e-32
WP_000113629.1|1982169_1982517_-	DUF977 family protein	NA	H6WRX9	Salmonella_phage	89.6	5.4e-52
WP_000800010.1|1982527_1983277_-	ATP-binding protein	NA	S4TNF5	Salmonella_phage	99.6	3.6e-138
WP_000062941.1|1983279_1984263_-	hypothetical protein	NA	H6WRX7	Salmonella_phage	100.0	1.9e-163
WP_001574095.1|1984347_1984722_-	hypothetical protein	NA	S4TTD7	Salmonella_phage	99.2	3.9e-64
WP_000370145.1|1984687_1984927_-	helix-turn-helix domain-containing protein	NA	H6WRX5	Salmonella_phage	47.2	8.3e-12
WP_001038966.1|1985046_1985457_+	helix-turn-helix domain-containing protein	NA	A0A1B5FPF4	Escherichia_phage	42.4	8.1e-07
WP_010989002.1|1985506_1985767_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001539619.1|1985938_1986289_+	hypothetical protein	NA	S4TSN6	Salmonella_phage	97.4	1.1e-60
WP_015589565.1|1986415_1989343_+	gifsy-1 prophage RecE	NA	S4TNL0	Salmonella_phage	99.4	0.0e+00
WP_001539618.1|1989305_1990463_+	recombinase RecT	NA	S4TTE8	Salmonella_phage	100.0	1.6e-217
WP_001237031.1|1990505_1990745_+	DUF4060 family protein	NA	S4TR31	Salmonella_phage	100.0	2.0e-37
WP_000065276.1|1990785_1991034_+	excisionase family protein	NA	S4TND0	Salmonella_phage	100.0	4.7e-42
WP_001262306.1|1991078_1992371_+|integrase	site-specific integrase	integrase	S4TSP2	Salmonella_phage	99.8	1.0e-252
WP_000191399.1|1992565_1993768_+	nicotinate phosphoribosyltransferase	NA	NA	NA	NA	NA
WP_000893207.1|1993845_1995282_-	sodium:alanine symporter family protein	NA	NA	NA	NA	NA
WP_000544849.1|1995526_1996741_-	diaminopropionate ammonia-lyase	NA	NA	NA	NA	NA
WP_000762342.1|1997057_1997519_+	Lrp/AsnC family transcriptional regulator	NA	NA	NA	NA	NA
WP_000117870.1|1997719_1999120_+|tRNA	asparagine--tRNA ligase	tRNA	A0A167RLM0	Powai_lake_megavirus	35.1	4.5e-81
2005842:2005859	attR	TGCCGGATGGCGGCGTAA	NA	NA	NA	NA
>prophage 7
NC_021151	Salmonella enterica subsp. enterica serovar Typhimurium str. U288, complete sequence	4852606	2063256	2071988	4852606	transposase,protease	Enterobacteria_phage(14.29%)	7	NA	NA
WP_085983316.1|2063256_2064511_+|transposase	IS3-like element ISSen1 family transposase	transposase	Q6H9S3	Enterobacteria_phage	33.9	5.4e-17
WP_000502119.1|2064974_2065433_-|transposase	IS200/IS605-like element IS200F family transposase	transposase	I4AZI8	Saccharomonospora_phage	31.5	1.0e-13
WP_000934063.1|2065624_2067901_-|protease	ATP-dependent Clp protease ATP-binding subunit ClpA	protease	A0A223W0B1	Agrobacterium_phage	42.3	6.2e-165
WP_000520789.1|2067931_2068252_-|protease	ATP-dependent Clp protease adapter ClpS	protease	A0A1B1IT64	uncultured_Mediterranean_phage	45.7	4.5e-13
WP_000447499.1|2068575_2068797_+	cold shock-like protein CspD	NA	A0A2H4N7Y6	Lake_Baikal_phage	64.2	9.3e-18
WP_000125877.1|2068926_2070873_-	macrolide ABC transporter ATP-binding protein/permease MacB	NA	G9BWD6	Planktothrix_phage	43.1	2.0e-39
WP_001201751.1|2070869_2071988_-	macrolide transporter subunit MacA	NA	A0A140XAI1	Dickeya_phage	38.9	1.4e-08
>prophage 8
NC_021151	Salmonella enterica subsp. enterica serovar Typhimurium str. U288, complete sequence	4852606	2679178	2724120	4852606	coat,protease,lysis,terminase,integrase,portal	Enterobacteria_phage(77.27%)	67	2670572:2670588	2733335:2733351
2670572:2670588	attL	ACGCGAATTTCAATATC	NA	NA	NA	NA
WP_000915528.1|2679178_2679541_+	GtrA family protein	NA	A0A192Y6N5	Salmonella_phage	100.0	5.0e-61
WP_000703639.1|2679537_2680470_+	glycosyltransferase family 2 protein	NA	A8CG95	Salmonella_phage	100.0	5.5e-176
WP_000671496.1|2680459_2681917_+	hypothetical protein	NA	A8CG94	Salmonella_phage	100.0	1.3e-240
WP_000129933.1|2681975_2683979_-	endorhamnosidase	NA	Q76H47	Enterobacteria_phage	100.0	0.0e+00
WP_000532177.1|2684114_2684363_+	Arc family DNA-binding protein	NA	Q76H48	Enterobacteria_phage	100.0	1.8e-38
WP_071533035.1|2684383_2684677_-	hypothetical protein	NA	Q76H12	Enterobacteria_phage	100.0	3.2e-50
WP_001029860.1|2684815_2686792_-	hypothetical protein	NA	Q76H13	Enterobacteria_phage	100.0	0.0e+00
WP_000246977.1|2686791_2688228_-	phage DNA ejection protein	NA	Q76H14	Enterobacteria_phage	100.0	7.7e-246
WP_000964904.1|2688238_2688928_-	hypothetical protein	NA	A0A2H5BFK5	Salmonella_phage	100.0	2.9e-118
WP_000627593.1|2688930_2689386_-	DUF2824 family protein	NA	Q76H16	Enterobacteria_phage	100.0	1.8e-87
WP_000774917.1|2689385_2690087_-	hypothetical protein	NA	Q76H17	Enterobacteria_phage	100.0	1.7e-76
WP_001122420.1|2690090_2691509_-	Packaged DNA stabilization protein gp10	NA	Q76H18	Enterobacteria_phage	100.0	6.4e-277
WP_001166103.1|2691468_2691969_-	packaged DNA stabilization protein p27	NA	Q76H19	Enterobacteria_phage	100.0	4.2e-90
WP_000538670.1|2691952_2692513_-	hypothetical protein	NA	C6ZR11	Salmonella_phage	100.0	9.8e-104
WP_001196937.1|2692553_2693846_-|coat	coat protein	coat	Q76H21	Enterobacteria_phage	100.0	1.1e-243
WP_015589573.1|2693845_2694757_-	scaffolding protein	NA	Q76H22	Enterobacteria_phage	99.7	3.4e-162
WP_000774652.1|2694770_2696948_-|portal	portal protein	portal	Q76H23	Enterobacteria_phage	100.0	0.0e+00
WP_015589574.1|2696947_2698456_-|terminase	terminase large subunit	terminase	Q76H24	Enterobacteria_phage	99.4	2.0e-305
WP_000729923.1|2698433_2698922_-	hypothetical protein	NA	Q76H25	Enterobacteria_phage	100.0	1.0e-88
WP_001687044.1|2698925_2699330_-	hypothetical protein	NA	Q76H26	Enterobacteria_phage	100.0	1.1e-67
WP_001140562.1|2699329_2699719_-	hypothetical protein	NA	Q76H27	Enterobacteria_phage	100.0	3.9e-75
WP_000808099.1|2699722_2699965_-	DUF2560 family protein	NA	Q76H60	Enterobacteria_phage	100.0	1.7e-33
WP_000877028.1|2700187_2700718_-	KilA-N domain-containing protein	NA	Q76H61	Enterobacteria_phage	100.0	1.3e-94
WP_001687043.1|2700930_2701398_-|lysis	lysis protein	lysis	Q76H63	Enterobacteria_phage	100.0	1.7e-77
WP_024136257.1|2701394_2701892_-	lysozyme	NA	B8K1G9	Salmonella_phage	100.0	4.5e-92
WP_000286100.1|2701869_2702073_-	hypothetical protein	NA	I6R0S9	Salmonella_phage	100.0	1.1e-33
WP_015589575.1|2702503_2703277_-	antitermination protein	NA	Q76H66	Enterobacteria_phage	99.6	1.2e-131
WP_000219133.1|2703273_2703453_-	hypothetical protein	NA	Q76H67	Enterobacteria_phage	100.0	1.9e-24
WP_000149882.1|2703433_2703637_-	protein ninH	NA	I6RSQ6	Salmonella_phage	100.0	7.2e-33
WP_000036320.1|2703633_2703858_-	hypothetical protein	NA	Q76H69	Enterobacteria_phage	100.0	6.3e-38
WP_001108073.1|2703854_2704466_-	recombination protein NinG	NA	Q76H70	Enterobacteria_phage	100.0	7.9e-99
WP_000950963.1|2704458_2704635_-	protein ninF	NA	Q76H71	Enterobacteria_phage	100.0	6.7e-27
WP_001532927.1|2704627_2704969_-	DUF2591 family protein	NA	Q76H72	Enterobacteria_phage	100.0	2.1e-64
WP_000113770.1|2704971_2705148_-	NinE family protein	NA	Q76H73	Enterobacteria_phage	100.0	1.0e-27
WP_000679703.1|2705114_2705288_-	hypothetical protein	NA	Q76H74	Enterobacteria_phage	100.0	2.3e-32
WP_000736891.1|2705284_2705722_-	recombination protein NinB	NA	Q76H49	Enterobacteria_phage	100.0	4.5e-80
WP_001036030.1|2705795_2706065_-	hypothetical protein	NA	Q76H50	Enterobacteria_phage	100.0	4.9e-45
WP_001248410.1|2706061_2707438_-	AAA family ATPase	NA	Q76H51	Enterobacteria_phage	100.0	1.9e-254
WP_000539342.1|2707434_2708256_-	replication protein	NA	Q76H52	Enterobacteria_phage	100.0	5.2e-154
WP_001103492.1|2708438_2708720_-	hypothetical protein	NA	Q76H54	Enterobacteria_phage	100.0	4.3e-44
WP_000182204.1|2708830_2709046_-	helix-turn-helix domain-containing protein	NA	Q76H55	Enterobacteria_phage	100.0	1.3e-32
WP_000712403.1|2709156_2709846_+	helix-turn-helix transcriptional regulator	NA	Q76H56	Enterobacteria_phage	100.0	1.3e-126
WP_001532928.1|2710010_2711090_+	hypothetical protein	NA	A0A192Y6S0	Salmonella_phage	100.0	1.5e-193
WP_000834175.1|2711128_2711332_-	hypothetical protein	NA	A0A2H5BFH9	Salmonella_phage	100.0	2.0e-27
WP_000216178.1|2711695_2711998_+	hypothetical protein	NA	Q76H58	Enterobacteria_phage	100.0	9.7e-50
WP_001066179.1|2712010_2712598_-	superinfection exclusion protein B	NA	Q76H59	Enterobacteria_phage	100.0	1.4e-100
WP_000213982.1|2712811_2713006_+	Restriction inhibitor protein ral	NA	Q76H34	Enterobacteria_phage	100.0	1.9e-30
WP_071845574.1|2713089_2713719_+	pentapeptide repeat-containing protein	NA	Q76H35	Enterobacteria_phage	96.7	7.2e-47
WP_000713613.1|2713752_2714040_+	hypothetical protein	NA	Q76H36	Enterobacteria_phage	100.0	2.7e-49
WP_000776963.1|2714315_2714630_+	Superinfection exclusion protein	NA	Q76H37	Enterobacteria_phage	100.0	1.5e-56
WP_000141641.1|2714714_2714873_+|protease	protease FtsH-inhibitory lysogeny factor CIII	protease	Q76H38	Enterobacteria_phage	100.0	2.4e-23
WP_000156731.1|2714853_2715042_+	DUF5444 family protein	NA	I6S647	Salmonella_phage	100.0	3.7e-31
WP_000902092.1|2715031_2715175_+	hypothetical protein	NA	A0A2H5BFM6	Salmonella_phage	100.0	6.4e-20
WP_001046968.1|2715171_2715879_+	recombinase	NA	Q76H40	Enterobacteria_phage	100.0	3.1e-139
WP_001253476.1|2715878_2716163_+	sigma-70 family RNA polymerase sigma factor	NA	Q76H41	Enterobacteria_phage	100.0	1.4e-45
WP_001111291.1|2716209_2716503_+	DUF2856 family protein	NA	Q76H42	Enterobacteria_phage	100.0	1.4e-48
WP_001214777.1|2716513_2716684_+	DUF2737 family protein	NA	Q76H43	Enterobacteria_phage	100.0	1.6e-25
WP_000812203.1|2716680_2717190_+	hypothetical protein	NA	Q76H44	Enterobacteria_phage	100.0	2.8e-89
WP_071533029.1|2717186_2717420_+	hypothetical protein	NA	NA	NA	NA	NA
WP_025617570.1|2717406_2718051_+	DUF551 domain-containing protein	NA	Q76H45	Enterobacteria_phage	99.5	1.4e-122
WP_000371199.1|2718050_2718335_+	DUF4752 family protein	NA	Q76H46	Enterobacteria_phage	100.0	1.6e-49
WP_000002104.1|2718327_2718612_+	ASCH domain-containing protein	NA	Q76H28	Enterobacteria_phage	100.0	1.4e-50
WP_155675089.1|2718680_2718821_+	hypothetical protein	NA	A0A0M4QWX3	Salmonella_phage	97.8	4.2e-16
WP_000051897.1|2719050_2720214_+|integrase	site-specific integrase	integrase	Q76H30	Enterobacteria_phage	100.0	3.7e-230
WP_000893231.1|2720419_2721670_-	glutamate-5-semialdehyde dehydrogenase	NA	A0A1X9I5D4	Streptococcus_phage	47.5	1.6e-98
WP_001285275.1|2721681_2722785_-	glutamate 5-kinase	NA	A0A1X9I5D0	Streptococcus_phage	39.8	6.9e-61
WP_001043675.1|2723067_2724120_+	phosphoporin PhoE	NA	Q1MVN1	Enterobacteria_phage	58.5	1.7e-112
2733335:2733351	attR	ACGCGAATTTCAATATC	NA	NA	NA	NA
>prophage 9
NC_021151	Salmonella enterica subsp. enterica serovar Typhimurium str. U288, complete sequence	4852606	2779983	2877333	4852606	tRNA,head,tail,lysis,terminase,plate,capsid,integrase,portal	Salmonella_phage(78.85%)	91	2802944:2802958	2878923:2878937
WP_000108007.1|2779983_2780478_+|plate	type VI secretion system baseplate subunit TssE	plate	NA	NA	NA	NA
WP_000371508.1|2780493_2782377_+|plate	type VI secretion system baseplate subunit TssF	plate	NA	NA	NA	NA
WP_000145244.1|2782373_2783369_+|plate	type VI secretion system baseplate subunit TssG	plate	NA	NA	NA	NA
WP_000367626.1|2783379_2784435_+	ImpA family type VI secretion system protein	NA	NA	NA	NA	NA
WP_001670675.1|2784966_2785698_-	DNA polymerase III subunit epsilon	NA	A0A1X9SH08	Bradyrhizobium_phage	39.9	6.4e-39
WP_000917872.1|2785761_2786229_+	ribonuclease HI	NA	J9Q745	Salmonella_phage	58.9	4.7e-51
WP_000801238.1|2786225_2786948_-	class I SAM-dependent methyltransferase	NA	NA	NA	NA	NA
WP_001052775.1|2786982_2787738_+	hydroxyacylglutathione hydrolase	NA	NA	NA	NA	NA
WP_000644706.1|2787809_2789177_+	murein transglycosylase D	NA	A0A0A7NU10	Lactobacillus_phage	33.0	1.4e-10
WP_000207224.1|2789232_2790003_-	class I SAM-dependent methyltransferase	NA	NA	NA	NA	NA
WP_001230968.1|2790080_2790881_-	endonuclease/exonuclease/phosphatase family protein	NA	NA	NA	NA	NA
WP_001127544.1|2791012_2792188_-	MFS transporter	NA	NA	NA	NA	NA
WP_000648534.1|2792292_2793207_+	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_000154872.1|2793227_2794031_-	2,5-didehydrogluconate reductase DkgB	NA	A0A1V0SDE7	Indivirus	35.0	7.8e-38
WP_001235094.1|2800033_2802607_-	ATP-dependent chaperone ClpB	NA	H6X3M6	Enterobacteria_phage	35.6	9.0e-128
WP_000992639.1|2802736_2803468_-	polyphenol oxidase	NA	NA	NA	NA	NA
2802944:2802958	attL	TTTTGCTAAAAATGC	NA	NA	NA	NA
WP_000079130.1|2803464_2804445_-	23S rRNA pseudouridine(1911/1915/1917) synthase RluD	NA	NA	NA	NA	NA
WP_000197660.1|2804576_2805314_+	outer membrane protein assembly factor BamD	NA	NA	NA	NA	NA
WP_000178449.1|2805585_2805924_+	ribosome-associated translation inhibitor RaiA	NA	NA	NA	NA	NA
WP_010989056.1|2806027_2806075_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000200080.1|2806174_2807335_+	bifunctional chorismate mutase/prephenate dehydratase	NA	NA	NA	NA	NA
WP_000210995.1|2807295_2808204_-	SMP-30/gluconolactonase/LRE family protein	NA	NA	NA	NA	NA
WP_000225191.1|2808261_2809383_-	bifunctional chorismate mutase/prephenate dehydrogenase	NA	NA	NA	NA	NA
WP_001168062.1|2809392_2810463_-	3-deoxy-7-phosphoheptulonate synthase AroF	NA	A0A0F6R6T6	Escherichia_coli_O157_typing_phage	51.8	2.4e-90
WP_001212379.1|2810902_2811421_+	YfiR family protein	NA	NA	NA	NA	NA
WP_001030985.1|2811413_2812634_+	diguanylate cyclase DgcN	NA	A0A2K8I9Y5	Pseudomonas_phage	36.2	5.8e-08
WP_000065257.1|2812790_2813138_-	50S ribosomal protein L19	NA	NA	NA	NA	NA
WP_000469804.1|2813178_2813946_-|tRNA	tRNA (guanosine(37)-N1)-methyltransferase TrmD	tRNA	NA	NA	NA	NA
WP_000043266.1|2813990_2814539_-	ribosome maturation factor RimM	NA	NA	NA	NA	NA
WP_000256453.1|2814557_2814806_-	30S ribosomal protein S16	NA	NA	NA	NA	NA
WP_000460052.1|2815119_2816481_-	signal recognition particle protein	NA	NA	NA	NA	NA
WP_001537507.1|2816646_2817438_+	inner membrane protein YpjD	NA	NA	NA	NA	NA
WP_127172650.1|2817457_2818744_+	HlyC/CorC family transporter	NA	NA	NA	NA	NA
WP_001287923.1|2818864_2819470_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001518875.1|2819504_2820095_-	nucleotide exchange factor GrpE	NA	NA	NA	NA	NA
WP_001059155.1|2820217_2821096_+	NAD(+) kinase	NA	NA	NA	NA	NA
WP_000880965.1|2821181_2822843_+	DNA repair protein RecN	NA	NA	NA	NA	NA
WP_001203445.1|2822991_2823330_+	outer membrane protein assembly factor BamE	NA	NA	NA	NA	NA
WP_001112990.1|2823495_2823786_-	RnfH family protein	NA	NA	NA	NA	NA
WP_000242603.1|2823775_2824252_-	type II toxin-antitoxin system RatA family toxin	NA	NA	NA	NA	NA
WP_001518569.1|2824401_2824884_+	SsrA-binding protein SmpB	NA	W5RAM5	Staphylococcus_phage	47.4	5.2e-29
WP_015589578.1|2825497_2836972_+	biofilm-associated protein BapA	NA	NA	NA	NA	NA
WP_000533858.1|2837036_2838446_+	TolC family outer membrane protein	NA	NA	NA	NA	NA
WP_000196159.1|2838442_2840623_+	type I secretion system permease/ATPase	NA	F2Y302	Organic_Lake_phycodnavirus	34.0	1.3e-18
WP_010989057.1|2840630_2841794_+	HlyD family type I secretion periplasmic adaptor subunit	NA	NA	NA	NA	NA
WP_000980498.1|2842345_2842564_-	hypothetical protein	NA	Q53ZE7	Salmonella_virus	100.0	2.1e-38
WP_001010543.1|2842632_2843733_-	phage late control D family protein	NA	A0A1S6KZZ5	Salmonella_phage	98.1	3.4e-193
WP_000980418.1|2843729_2844215_-|tail	phage tail protein	tail	E5G6Q2	Salmonella_phage	98.5	2.4e-66
WP_001282773.1|2844211_2847019_-|tail	phage tail tape measure protein	tail	A0A1S6L010	Salmonella_phage	99.7	0.0e+00
WP_000763317.1|2847011_2847131_-|tail	GpE family phage tail protein	tail	E5G6Q0	Salmonella_phage	97.4	8.8e-15
WP_001280967.1|2847145_2847448_-|tail	phage tail assembly protein	tail	A0A1S6KZZ9	Salmonella_phage	99.0	9.4e-45
WP_001207652.1|2847502_2848018_-|tail	phage major tail tube protein	tail	A0A1S6L002	Salmonella_phage	98.8	7.9e-92
WP_000046109.1|2848027_2849200_-|tail	phage tail sheath protein	tail	A0A1S6KZY7	Salmonella_phage	99.7	5.7e-223
WP_001165559.1|2849302_2849860_-	serine-type DNA invertase Fin	NA	A0A1S6L009	Salmonella_phage	97.8	8.0e-98
WP_010989058.1|2849829_2850909_+	hypothetical protein	NA	A0A1B0V7G4	Salmonella_phage	92.1	5.4e-183
WP_001287105.1|2850915_2851323_+|tail	tail assembly protein	tail	A0A1B0V844	Salmonella_phage	84.4	2.2e-60
WP_010989059.1|2851326_2851944_-|tail	tail fiber assembly protein	tail	A0A1B0VCD0	Salmonella_phage	84.6	4.1e-95
WP_001274647.1|2851913_2853488_-|tail	tail protein	tail	A0A1S6KZZ8	Salmonella_phage	60.7	2.1e-156
WP_001086807.1|2853484_2854090_-|tail	phage tail protein I	tail	A0A1S6L000	Salmonella_phage	98.0	4.1e-116
WP_000268333.1|2854082_2854991_-|plate	baseplate assembly protein	plate	E5G6N8	Salmonella_phage	99.0	7.7e-159
WP_000177403.1|2854977_2855337_-|plate	baseplate assembly protein	plate	E5G6N7	Salmonella_phage	98.3	8.0e-59
WP_000993751.1|2855333_2855912_-|plate	phage baseplate assembly protein V	plate	E5G6N6	Salmonella_phage	98.4	3.3e-107
WP_000343947.1|2855980_2856427_-	phage virion morphogenesis protein	NA	A0A1S6L001	Salmonella_phage	89.0	1.9e-65
WP_001039961.1|2856419_2856851_-|tail	phage tail protein	tail	A0A1S6KZY0	Salmonella_phage	99.3	1.1e-75
WP_001648763.1|2856946_2857375_-|lysis	LysB family phage lysis regulatory protein	lysis	A0A1S6KZX8	Salmonella_phage	95.0	2.6e-64
WP_001069932.1|2857751_2858261_-	lysozyme	NA	A0A1S6KZY9	Salmonella_phage	97.6	3.5e-92
WP_000171565.1|2858241_2858457_-	hypothetical protein	NA	E5G6N0	Salmonella_phage	100.0	5.9e-33
WP_000868168.1|2858460_2858664_-|tail	tail protein X	tail	E5G6M9	Salmonella_phage	98.5	1.1e-33
WP_000673534.1|2858663_2859128_-|head	head completion/stabilization protein	head	A0A1S6KZW8	Salmonella_phage	98.1	1.9e-84
WP_000059178.1|2859221_2859875_-|terminase	terminase endonuclease subunit	terminase	A0A1S6KZX1	Salmonella_phage	98.6	4.6e-113
WP_000730755.1|2859878_2860961_-|capsid	phage major capsid protein, P2 family	capsid	A0A1S6KZZ3	Salmonella_phage	97.7	1.6e-190
WP_000216276.1|2860977_2861811_-|capsid	GPO family capsid scaffolding protein	capsid	E5G6M5	Salmonella_phage	100.0	3.1e-130
WP_001098444.1|2861953_2863720_+|terminase	terminase ATPase subunit family protein	terminase	A0A1S6KZW3	Salmonella_phage	97.3	0.0e+00
WP_001292071.1|2863719_2864760_+|portal	phage portal protein	portal	A0A1S6KZW5	Salmonella_phage	93.0	2.4e-188
WP_071892914.1|2864845_2866597_-	AIPR family protein	NA	NA	NA	NA	NA
WP_014344476.1|2866810_2867488_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001217575.1|2867601_2867835_-	DinI family protein	NA	E5G6M1	Salmonella_phage	100.0	4.7e-36
WP_015589579.1|2867845_2868034_-	hypothetical protein	NA	E5G6M0	Salmonella_phage	98.4	1.9e-27
WP_000301161.1|2868186_2870616_-	replication endonuclease	NA	A0A1S6L028	Salmonella_phage	91.8	0.0e+00
WP_000104125.1|2870606_2871464_-	DNA adenine methylase	NA	A0A1S6L011	Salmonella_phage	80.4	2.7e-129
WP_000785509.1|2871460_2871688_-	TraR/DksA family transcriptional regulator	NA	A0A1S6L007	Salmonella_phage	93.3	1.3e-35
WP_001244234.1|2871687_2871921_-	DUF2732 domain-containing protein	NA	A0A1S6L021	Salmonella_phage	84.4	2.0e-26
WP_000963195.1|2871988_2872330_-	DUF5347 domain-containing protein	NA	E5G6L5	Salmonella_phage	85.0	4.2e-49
WP_000166366.1|2872549_2873008_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000957775.1|2872955_2873189_-	DUF2724 domain-containing protein	NA	E5G6L4	Salmonella_phage	59.1	3.6e-12
WP_000460862.1|2873196_2873706_-	phage regulatory CII family protein	NA	A0A1S6L008	Salmonella_phage	92.9	5.1e-83
WP_000102104.1|2873741_2873981_-	hypothetical protein	NA	A0A1S6KZZ6	Salmonella_phage	98.7	8.8e-38
WP_000052560.1|2874097_2874730_+	phage repressor protein	NA	A0A1S6KZZ7	Salmonella_phage	58.6	1.4e-66
WP_001536726.1|2874733_2875759_+|integrase	site-specific integrase	integrase	A0A1S6L016	Salmonella_phage	100.0	9.9e-203
WP_001542208.1|2876087_2877152_+|integrase	tyrosine-type recombinase/integrase	integrase	A0A1B5FPC6	Escherichia_phage	62.5	1.6e-118
WP_001542209.1|2877165_2877333_+	hypothetical protein	NA	A0A1B5FPC6	Escherichia_phage	61.9	1.1e-07
2878923:2878937	attR	TTTTGCTAAAAATGC	NA	NA	NA	NA
>prophage 10
NC_021151	Salmonella enterica subsp. enterica serovar Typhimurium str. U288, complete sequence	4852606	4412793	4433213	4852606	plate,tail	Burkholderia_phage(45.0%)	26	NA	NA
WP_000587738.1|4412793_4413522_-	hypothetical protein	NA	A0A077SLK3	Escherichia_phage	37.3	5.6e-35
WP_010989092.1|4413718_4414009_-	membrane protein	NA	NA	NA	NA	NA
WP_000084331.1|4414257_4414713_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001526208.1|4414709_4415315_-	DUF4376 domain-containing protein	NA	NA	NA	NA	NA
WP_000368196.1|4415319_4417065_-|tail	tail protein	tail	A0A0M3ULF6	Salmonella_phage	52.2	3.2e-52
WP_000359500.1|4417067_4417700_-|tail	phage tail protein I	tail	Q6QI98	Burkholderia_phage	56.4	6.6e-24
WP_000951736.1|4417692_4418808_-|plate	baseplate protein	plate	Q6QI99	Burkholderia_phage	52.2	1.8e-101
WP_001093501.1|4418798_4419158_-|plate	baseplate protein	plate	Q6QIA0	Burkholderia_phage	64.2	2.8e-35
WP_001095011.1|4419321_4420869_-	membrane protein	NA	B9UDL6	Salmonella_phage	29.9	1.9e-48
WP_000703632.1|4420868_4421798_-	glycosyltransferase family 2 protein	NA	S5FKN0	Shigella_phage	83.8	8.8e-150
WP_000593182.1|4421794_4422157_-	GtrA family protein	NA	I1TED9	Salmonella_phage	70.8	1.2e-43
WP_000679398.1|4422484_4423207_-|plate	phage baseplate assembly protein V	plate	A0A067ZIM2	Vibrio_phage	41.0	3.3e-11
WP_000818154.1|4423216_4424260_-	phage late control D family protein	NA	Q6QIA2	Burkholderia_phage	45.1	2.5e-76
WP_001269716.1|4424247_4424457_-	membrane protein	NA	A4JWL2	Burkholderia_virus	60.3	9.8e-17
WP_000271423.1|4424456_4425410_-	methyl-accepting chemotaxis protein	NA	A4JWL1	Burkholderia_virus	50.8	2.3e-36
WP_001262499.1|4425409_4427764_-|tail	phage tail tape measure protein	tail	A4JWL0	Burkholderia_virus	30.6	9.0e-66
WP_001185654.1|4427860_4427989_-|tail	GpE family phage tail protein	tail	NA	NA	NA	NA
WP_001003642.1|4427948_4428266_-|tail	phage tail assembly protein	tail	NA	NA	NA	NA
WP_000907494.1|4428317_4428842_-|tail	phage major tail tube protein	tail	Q6QIA9	Burkholderia_phage	69.5	2.8e-68
WP_000729852.1|4428841_4430269_-|tail	phage tail sheath family protein	tail	A4JWK5	Burkholderia_virus	70.9	1.1e-194
WP_000875314.1|4430258_4430456_-	hypothetical protein	NA	Q6QIB1	Burkholderia_phage	52.9	8.6e-07
WP_000449433.1|4430452_4430908_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000777266.1|4431067_4431382_-	membrane protein	NA	Q6QIC4	Burkholderia_phage	49.1	6.4e-20
WP_001270442.1|4431394_4432000_-	transglycosylase SLT domain-containing protein	NA	Q5ZQZ1	Pseudomonas_phage	59.9	4.2e-60
WP_001226442.1|4432002_4432290_-	membrane protein	NA	Q6QIC8	Burkholderia_phage	49.1	2.3e-16
WP_000615248.1|4432865_4433213_+	DNA-binding protein	NA	Q6QIE8	Burkholderia_phage	51.5	4.9e-21
>prophage 1
NC_021155	Salmonella enterica subsp. enterica serovar Typhimurium str. U288 plasmid pSTU288-1, complete sequence	148711	86986	133025	148711	transposase,integrase	Escherichia_phage(26.32%)	53	99921:99980	133029:133848
WP_000088645.1|86986_87667_-	DNA methylase	NA	A0A2I7RE86	Vibrio_phage	36.4	1.6e-28
WP_000369839.1|88048_88405_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000490265.1|88397_88868_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000925627.1|89378_89801_+	translesion error-prone DNA polymerase V autoproteolytic subunit	NA	A0A1W6JNS2	Morganella_phage	51.6	1.0e-28
WP_000457541.1|89800_91075_+	Y-family DNA polymerase	NA	F1C5A5	Cronobacter_phage	64.5	3.0e-156
WP_000064274.1|91156_92131_-	ParB/RepB/Spo0J family partition protein	NA	A0A1B0V750	Salmonella_phage	53.2	5.1e-84
WP_000427676.1|92130_93336_-	ParA family protein	NA	A0A077SL49	Escherichia_phage	69.3	1.5e-162
WP_000728917.1|93750_94692_+|transposase	Rpn family recombination-promoting nuclease/putative transposase	transposase	Q2A0A7	Sodalis_phage	54.3	2.0e-72
WP_001541562.1|94723_95290_-	DUF2913 family protein	NA	NA	NA	NA	NA
WP_001527010.1|95346_95682_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001541564.1|95865_96282_-	hypothetical protein	NA	O64348	Escherichia_phage	42.9	8.2e-07
WP_001247118.1|96367_97483_-	DNA-binding protein	NA	NA	NA	NA	NA
WP_001135407.1|97741_98230_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001541566.1|98884_99625_+	carbonic anhydrase	NA	NA	NA	NA	NA
99921:99980	attL	GGCACTGTTGCAAATAGTCGGTGGTGATAAACTTATCATCCCCTTTTGCTGATGGAGCTG	NA	NA	NA	NA
WP_001067855.1|99983_100688_+|transposase	IS6-like element IS26 family transposase	transposase	A0A077SL39	Escherichia_phage	100.0	1.8e-139
WP_011264039.1|100749_100989_+	macrolide transporter	NA	A0A2K5B2B5	Erysipelothrix_phage	46.2	9.5e-08
WP_000612791.1|101134_101998_+	SDR family oxidoreductase	NA	W8CYX9	Bacillus_phage	31.0	2.5e-05
WP_001354008.1|102035_102281_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000034420.1|102749_103541_+	sulfonamide-resistant dihydropteroate synthase Sul3	NA	A0A0B5J4J5	Pandoravirus	26.5	1.2e-14
WP_109023896.1|103543_103819_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000800531.1|104720_105053_-	quaternary ammonium compound efflux SMR transporter QacL	NA	NA	NA	NA	NA
WP_001206316.1|105222_106014_-	ANT(3'')-Ia family aminoglycoside nucleotidyltransferase AadA1	NA	NA	NA	NA	NA
WP_000095725.1|106106_107366_-	chloramphenicol efflux MFS transporter CmlA1	NA	S4TR35	Salmonella_phage	31.7	4.8e-26
WP_001206356.1|107627_108419_-	ANT(3'')-Ia family aminoglycoside nucleotidyltransferase AadA2	NA	NA	NA	NA	NA
WP_001336345.1|108424_108715_-	DUF1010 domain-containing protein	NA	NA	NA	NA	NA
WP_001083725.1|108826_109324_-	trimethoprim-resistant dihydrofolate reductase DfrA12	NA	A0A0A0PL85	Bacillus_phage	40.9	7.5e-23
WP_000845039.1|109468_110482_+|integrase	class 1 integron integrase IntI1	integrase	A0A1P8DJJ6	Virus_Rctr41k	45.5	1.0e-71
WP_000454193.1|110684_111035_+	DUF3330 domain-containing protein	NA	NA	NA	NA	NA
WP_000147567.1|111160_111721_+	recombinase family protein	NA	A0A1B0V7I5	Salmonella_phage	86.2	4.0e-49
WP_001138064.1|111723_114690_+|transposase	Tn3-like element TnAs3 family transposase	transposase	A0A1B0V7H9	Salmonella_phage	73.6	0.0e+00
WP_015589611.1|114658_114901_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001127573.1|115229_116333_+	nucleotide-binding protein	NA	NA	NA	NA	NA
WP_000542417.1|116362_117493_+	DUF4238 domain-containing protein	NA	NA	NA	NA	NA
WP_001229373.1|117492_117783_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000545983.1|118301_119435_+	DUF3800 domain-containing protein	NA	NA	NA	NA	NA
WP_000642771.1|119454_119739_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000074712.1|119909_120557_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000628093.1|120544_120880_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000139427.1|121059_121641_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000813641.1|122354_122573_+	type II toxin-antitoxin system antitoxin CcdA	NA	NA	NA	NA	NA
WP_001159863.1|122574_122880_+	type II toxin-antitoxin system toxin CcdB	NA	NA	NA	NA	NA
WP_001266176.1|122881_123172_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000198608.1|123168_123690_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000082169.1|123724_124507_+|integrase	phage integrase family protein	integrase	I3WFA4	Macacine_betaherpesvirus	91.1	1.6e-51
WP_001541544.1|125232_125742_+	CaiF/GrlA family transcriptional regulator	NA	NA	NA	NA	NA
WP_000905606.1|125735_126221_+	membrane protein	NA	NA	NA	NA	NA
WP_071530243.1|126497_126785_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000900095.1|126940_127501_+	inverse autotransporter beta domain-containing protein	NA	NA	NA	NA	NA
WP_001541541.1|127567_127918_-	helix-turn-helix domain-containing protein	NA	A0A077SLN2	Escherichia_phage	80.5	1.9e-44
WP_001575489.1|128525_129176_-	SPI-2 type III secretion system effector cysteine hydrolase SpvD	NA	NA	NA	NA	NA
WP_015589612.1|129436_130162_-	type III secretion system effector phosphothreonine lyase SpvC	NA	NA	NA	NA	NA
WP_001676648.1|130443_132219_-	SPI-2 type III secretion system effector NAD(+)--protein-arginine ADP-ribosyltransferase SpvB	NA	NA	NA	NA	NA
WP_001067855.1|132320_133025_-|transposase	IS6-like element IS26 family transposase	transposase	A0A077SL39	Escherichia_phage	100.0	1.8e-139
133029:133848	attR	CAGCTCCATCAGCAAAAGGGGATGATAAGTTTATCACCACCGACTATTTGCAACAGTGCCGCTGAAAGGAATCAAATTTGGCCGCAGGCGTACCGTGGACAGGAACGTCGTGCTGACGCTTCATCAGAAGGGCACTGGTGCAACGGAAATTGCTCATCAGCTCAGTATTGCCCGCTCCACGGTTTATAAAATTCTTGAAGACGAAAGGGCCTCGTGATACGCCTATTTTTATAGGTTAATGTCATGATAATAATGGTTTCTTAGACGTCAGGTGGCACTTTTCGGGGAAATGTGCGCGGAACCCCTATTTGTTTATTTTTCTAAATACATTCAAATATGTATCCGCTCATGAGACAATAACCCTGGTAAATGCTTCAATAATATTGAAAAAGGAAGAGTATGAGTATTCAACATTTTCGTGTCGCCCTTATTCCCTTTTTTGCGGCATTTTGCCTTCCTGTTTTTGCTCACCCAGAAACGCTGGTGAAAGTAAAAGATGCTGAAGATCAGTTGGGTGCACGAGTGGGTTACATCGAACTGGATCTCAACAGCGGTAAGATCCTTGAGAGTTTTCGCCCCGAAGAACGTTTTCCAATGATGAGCACTTTTAAAGTTCTGCTATGTGGTGCGGTATTATCCCGTGTTGACGCCGGGCAAGAGCAACTCGGTCGCCGCATACACTATTCTCAGAATGACTTGGTTGAGTACTCACCAGTCACAGAAAAGCATCTTACGGATGGCATGACAGTAAGAGAATTATGCAGTGCTGCCATAACCATGAGTGATAACACTGCTGCCAACTTACTTCTGACAACGATCG	NA	NA	NA	NA
