The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
NZ_CP015230	Epibacterium mobile F1926 chromosome, complete genome	3260769	806888	839539	3260769	head,integrase	Thiobacimonas_phage(59.26%)	40	805387:805407	845666:845686
805387:805407	attL	GGGATTGAAGGGGCGTTTAAG	NA	NA	NA	NA
WP_065317470.1|806888_811412_-	hypothetical protein	NA	G8DH58	Emiliania_huxleyi_virus	37.0	1.3e-04
WP_005650793.1|811408_811822_-	hypothetical protein	NA	G8DH57	Emiliania_huxleyi_virus	37.8	4.5e-13
WP_005650796.1|811809_812400_-	hypothetical protein	NA	A0A0U2C133	Paracoccus_phage	44.6	7.8e-35
WP_052699555.1|812402_813053_-	hypothetical protein	NA	NA	NA	NA	NA
WP_046002805.1|813052_815611_-	hypothetical protein	NA	A0A291AUU3	Sinorhizobium_phage	39.0	5.8e-18
WP_005651794.1|815613_815889_-	hypothetical protein	NA	NA	NA	NA	NA
WP_005651792.1|815966_816296_-	hypothetical protein	NA	NA	NA	NA	NA
WP_046002806.1|816311_817244_-	hypothetical protein	NA	A0A1B0T6E1	Thiobacimonas_phage	57.4	3.5e-98
WP_009176313.1|817244_817388_-	hypothetical protein	NA	NA	NA	NA	NA
WP_005650023.1|817384_817816_-	hypothetical protein	NA	NA	NA	NA	NA
WP_005650021.1|817815_818244_-	DUF1320 domain-containing protein	NA	A0A1B0T6F3	Thiobacimonas_phage	54.9	9.3e-38
WP_005650018.1|818353_818869_-	hypothetical protein	NA	NA	NA	NA	NA
WP_005650015.1|818880_819777_-|head	phage head protein	head	M4SRT6	Rhodobacter_phage	69.1	2.0e-119
WP_005650011.1|819788_820220_-	hypothetical protein	NA	M4ST95	Rhodobacter_phage	56.0	1.4e-38
WP_040643310.1|820219_821302_-	hypothetical protein	NA	A0A1B0T6E7	Thiobacimonas_phage	39.0	4.6e-57
WP_005650006.1|821589_823182_+	hypothetical protein	NA	NA	NA	NA	NA
WP_005650005.1|823184_823658_-	phage virion morphogenesis protein	NA	A0A1B0T6E8	Thiobacimonas_phage	42.4	2.3e-29
WP_046002807.1|823660_824797_-	virion morphogenesis protein	NA	A0A1B0T6H8	Thiobacimonas_phage	59.2	5.2e-88
WP_005615236.1|824789_826451_-	DUF935 domain-containing protein	NA	A0A1B0T6F2	Thiobacimonas_phage	61.3	5.3e-182
WP_005615237.1|826454_826745_-	hypothetical protein	NA	NA	NA	NA	NA
WP_005615239.1|826757_828449_-	hypothetical protein	NA	M4SRU6	Rhodobacter_phage	54.2	4.2e-166
WP_005615243.1|828445_828643_-	hypothetical protein	NA	NA	NA	NA	NA
WP_005615246.1|828639_829197_-	DUF3486 family protein	NA	A0A1B0T6G0	Thiobacimonas_phage	57.3	4.8e-34
WP_005615249.1|829200_829497_-	hypothetical protein	NA	A0A1B0T6F4	Thiobacimonas_phage	68.4	2.6e-31
WP_005615251.1|829504_829876_-	DUF2730 family protein	NA	A0A1B0T6F6	Thiobacimonas_phage	39.8	1.1e-13
WP_005615252.1|829875_830415_-	hypothetical protein	NA	A0A2I7R2S9	Vibrio_phage	32.5	1.0e-17
WP_005615253.1|830428_831298_-	N-acetylmuramoyl-L-alanine amidase	NA	A0A1B0T6G1	Thiobacimonas_phage	60.0	2.3e-96
WP_005615254.1|831383_831788_-	hypothetical protein	NA	M4SNV1	Rhodobacter_phage	52.5	4.5e-26
WP_005615255.1|831784_832240_-	regulatory protein GemA	NA	A0A1B0T6H1	Thiobacimonas_phage	62.6	8.3e-45
WP_110590786.1|832241_832490_-	hypothetical protein	NA	NA	NA	NA	NA
WP_005615257.1|832499_832775_-	hypothetical protein	NA	NA	NA	NA	NA
WP_005615260.1|832788_833466_-	DUF3164 family protein	NA	M4STB6	Rhodobacter_phage	64.0	5.2e-75
WP_005615263.1|833532_833907_-	hypothetical protein	NA	A0A1B0T6G8	Thiobacimonas_phage	55.4	1.5e-28
WP_005615265.1|833903_834452_-	hypothetical protein	NA	A0A1B0T6J7	Thiobacimonas_phage	47.5	4.1e-38
WP_005615268.1|834448_835237_-	ATP-binding protein	NA	A0A1B0T6H3	Thiobacimonas_phage	70.4	7.1e-92
WP_005615272.1|835249_837358_-|integrase	integrase	integrase	A0A1B0T6H2	Thiobacimonas_phage	61.0	3.2e-240
WP_005615274.1|837357_838212_-	ParB N-terminal domain-containing protein	NA	A0A1B0T6H9	Thiobacimonas_phage	60.7	1.1e-85
WP_005615276.1|838229_838487_-	hypothetical protein	NA	NA	NA	NA	NA
WP_005615279.1|838486_838783_-	hypothetical protein	NA	NA	NA	NA	NA
WP_065317482.1|838870_839539_+	helix-turn-helix transcriptional regulator	NA	A5X9F5	Aeromonas_virus	34.1	1.2e-23
845666:845686	attR	GGGATTGAAGGGGCGTTTAAG	NA	NA	NA	NA
>prophage 2
NZ_CP015230	Epibacterium mobile F1926 chromosome, complete genome	3260769	1651092	1686108	3260769	capsid,protease,head,tail,portal,tRNA	Paracoccus_phage(21.43%)	35	NA	NA
WP_005658666.1|1651092_1652142_-|tRNA	tRNA preQ1(34) S-adenosylmethionine ribosyltransferase-isomerase QueA	tRNA	NA	NA	NA	NA
WP_046002139.1|1652226_1655748_-	hypothetical protein	NA	NA	NA	NA	NA
WP_040644290.1|1655809_1656271_+	peroxiredoxin	NA	NA	NA	NA	NA
WP_046002138.1|1656519_1657362_+	ferritin-like domain-containing protein	NA	NA	NA	NA	NA
WP_005645675.1|1657599_1658931_+	peptidoglycan DD-metalloendopeptidase family protein	NA	G9BW84	Planktothrix_phage	47.7	5.0e-21
WP_005645679.1|1658920_1659451_+	polymer-forming cytoskeletal protein	NA	NA	NA	NA	NA
WP_005645682.1|1659788_1660319_+	hypothetical protein	NA	NA	NA	NA	NA
WP_005634592.1|1660526_1661075_-	peptidylprolyl isomerase	NA	A0A1B1IVS0	uncultured_Mediterranean_phage	55.6	7.0e-38
WP_005634594.1|1661067_1661574_-	peptidylprolyl isomerase	NA	A0A1B1IVS0	uncultured_Mediterranean_phage	59.4	2.1e-44
WP_046002137.1|1661855_1663046_+	phosphoglycerate kinase	NA	NA	NA	NA	NA
WP_046002136.1|1663257_1665030_+	HAMP domain-containing protein	NA	NA	NA	NA	NA
WP_005654255.1|1665260_1665584_+	hypothetical protein	NA	NA	NA	NA	NA
WP_005654258.1|1665812_1666112_+	septum formation initiator	NA	NA	NA	NA	NA
WP_005654260.1|1666501_1667515_+	pyruvate dehydrogenase (acetyl-transferring) E1 component subunit alpha	NA	NA	NA	NA	NA
WP_046002135.1|1667531_1668911_+	pyruvate dehydrogenase complex E1 component subunit beta	NA	NA	NA	NA	NA
WP_046002134.1|1668922_1670248_+	pyruvate dehydrogenase complex dihydrolipoamide acetyltransferase	NA	NA	NA	NA	NA
WP_005633353.1|1670442_1671249_-	serine O-acetyltransferase	NA	NA	NA	NA	NA
WP_005633355.1|1671610_1671817_+	cold-shock protein	NA	A0A1X9IGI9	Lactococcus_phage	49.2	3.9e-10
WP_046002187.1|1671858_1672185_-	hypothetical protein	NA	NA	NA	NA	NA
WP_046002133.1|1672193_1676114_-	phage host specificity protein	NA	A0A0B5A7K5	Paracoccus_phage	40.2	2.0e-235
WP_046002132.1|1676172_1676601_-	peptidase	NA	A0A1V0DYB6	Dinoroseobacter_phage	46.2	3.2e-30
WP_046002131.1|1676597_1677476_-	DUF2163 domain-containing protein	NA	A0A0B5A5B8	Paracoccus_phage	45.0	2.5e-61
WP_005676643.1|1677475_1678108_-	DUF2460 domain-containing protein	NA	A0A0K1Y6G4	Rhodobacter_phage	45.5	7.3e-47
WP_046002130.1|1678121_1678781_-|tail	phage tail tape measure protein	tail	A0A1W6JP49	Morganella_phage	31.0	1.8e-11
WP_046002129.1|1678784_1679000_-|tail	phage tail assembly chaperone	tail	NA	NA	NA	NA
WP_046002128.1|1678996_1679320_-	gene transfer agent family protein	NA	NA	NA	NA	NA
WP_011538405.1|1679323_1679737_-|tail	phage major tail protein, TP901-1 family	tail	A0A1J0GVL1	Pseudoalteromonas_phage	34.2	1.4e-06
WP_046002127.1|1679772_1680180_-	DUF3168 domain-containing protein	NA	NA	NA	NA	NA
WP_046002126.1|1680176_1680515_-|head,tail	head-tail adaptor protein	head,tail	NA	NA	NA	NA
WP_046002125.1|1680511_1681114_-	hypothetical protein	NA	NA	NA	NA	NA
WP_046002124.1|1681289_1682486_-|capsid	phage major capsid protein	capsid	B0VK33	Azospirillum_phage	44.3	2.7e-66
WP_046002123.1|1682506_1683079_-|head,protease	HK97 family phage prohead protease	head,protease	A0A0U2BX10	Paracoccus_phage	50.0	6.8e-28
WP_005685939.1|1683114_1683339_-	hypothetical protein	NA	NA	NA	NA	NA
WP_046002122.1|1683331_1684537_-|portal	phage portal protein	portal	W8ECU7	Geobacillus_phage	36.9	4.0e-62
WP_046002186.1|1684821_1686108_-	DNA-packaging protein	NA	A0A1V0DY66	Dinoroseobacter_phage	39.0	2.0e-72
>prophage 3
NZ_CP015230	Epibacterium mobile F1926 chromosome, complete genome	3260769	2964908	3079090	3260769	transposase,capsid,protease,head,tail,portal,integrase,tRNA,terminase	Rhodobacter_phage(15.62%)	120	2996513:2996530	3080563:3080580
WP_005619588.1|2964908_2965184_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_005619585.1|2965684_2965903_+	hypothetical protein	NA	NA	NA	NA	NA
WP_005619582.1|2965902_2967366_+	TolC family protein	NA	NA	NA	NA	NA
WP_009177812.1|2967376_2968735_+	copper oxidase	NA	NA	NA	NA	NA
WP_005619578.1|2968781_2969498_+	cupredoxin	NA	NA	NA	NA	NA
WP_040642164.1|2969567_2970806_+	ABC transporter ATP-binding protein	NA	NA	NA	NA	NA
WP_005619572.1|2971980_2974131_-	HAMP domain-containing protein	NA	NA	NA	NA	NA
WP_040642177.1|2975301_2975625_+	DUF3768 domain-containing protein	NA	NA	NA	NA	NA
WP_052032010.1|2975697_2976063_+	DUF3768 domain-containing protein	NA	L7TKV8	Rhizobium_phage	39.2	2.5e-15
WP_005619563.1|2977002_2977284_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_005619561.1|2977487_2978639_+	hypothetical protein	NA	NA	NA	NA	NA
WP_080929567.1|2979203_2979560_+	nuclease	NA	NA	NA	NA	NA
WP_005619555.1|2979741_2983683_-	tetratricopeptide repeat protein	NA	NA	NA	NA	NA
WP_110590720.1|2983870_2984185_+	hypothetical protein	NA	NA	NA	NA	NA
WP_005619551.1|2984408_2984909_+	hypothetical protein	NA	NA	NA	NA	NA
WP_005619549.1|2985052_2985373_-	H-NS histone family protein	NA	NA	NA	NA	NA
WP_040642153.1|2986439_2986619_-	hypothetical protein	NA	NA	NA	NA	NA
WP_110590715.1|2987245_2987410_+	CopG family transcriptional regulator	NA	NA	NA	NA	NA
WP_005619545.1|2987419_2987902_+	hypothetical protein	NA	NA	NA	NA	NA
WP_005619543.1|2987906_2988683_+	deoxycytidine deaminase-like protein	NA	NA	NA	NA	NA
WP_040642149.1|2989355_2990027_-	hypothetical protein	NA	NA	NA	NA	NA
WP_005619536.1|2990039_2990528_-	TIR domain-containing protein	NA	NA	NA	NA	NA
WP_005619533.1|2990655_2991084_-	hypothetical protein	NA	NA	NA	NA	NA
WP_080929566.1|2991899_2992082_-	hypothetical protein	NA	NA	NA	NA	NA
WP_005619529.1|2992381_2992633_-	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_005619527.1|2992765_2993167_+	DUF805 domain-containing protein	NA	NA	NA	NA	NA
WP_131664960.1|2993228_2994140_+	hypothetical protein	NA	NA	NA	NA	NA
WP_157888506.1|2994270_2995057_+|transposase	IS5 family transposase	transposase	A0A0N9SHJ4	Paenibacillus_phage	36.7	3.4e-17
WP_005620366.1|2995323_2995623_-	phospholipase	NA	G4KK81	Yersinia_phage	39.8	1.1e-08
WP_005620364.1|2995625_2996789_-	hypothetical protein	NA	NA	NA	NA	NA
2996513:2996530	attL	CCCATGCGCCGACTCCAT	NA	NA	NA	NA
WP_052699558.1|2997133_2999287_-	type VI secretion system tip protein VgrG	NA	A0A077K8Q4	Ralstonia_phage	29.2	1.0e-44
WP_040641282.1|2999455_3000631_-|integrase	tyrosine-type recombinase/integrase	integrase	A0A221SAN4	Ralstonia_phage	35.5	3.2e-48
WP_005608770.1|3001114_3001798_+	UPF0149 family protein	NA	NA	NA	NA	NA
WP_005608772.1|3002012_3002570_-	hypothetical protein	NA	NA	NA	NA	NA
WP_040641283.1|3002703_3003747_+	Hint domain-containing protein	NA	NA	NA	NA	NA
WP_005628341.1|3004169_3005135_+|integrase	site-specific integrase	integrase	A0A1B1P9F9	Acinetobacter_phage	45.6	1.9e-67
WP_005628339.1|3005668_3005851_+	hypothetical protein	NA	NA	NA	NA	NA
WP_005628336.1|3005859_3006414_+	hypothetical protein	NA	NA	NA	NA	NA
WP_005628333.1|3006410_3006929_+	hypothetical protein	NA	NA	NA	NA	NA
WP_040642804.1|3006915_3008832_+	AAA family ATPase	NA	NA	NA	NA	NA
WP_005628327.1|3009029_3010262_-	type II restriction enzyme	NA	E5E3X4	Burkholderia_phage	45.7	1.4e-94
WP_005628323.1|3010280_3010736_-	DNA mismatch endonuclease Vsr	NA	E5E3X5	Burkholderia_phage	54.4	7.8e-43
WP_005628321.1|3010728_3011961_-	DNA (cytosine-5-)-methyltransferase	NA	E5E3X6	Burkholderia_phage	57.7	4.9e-124
WP_005628319.1|3012232_3012469_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_046002360.1|3012529_3013036_-	hypothetical protein	NA	NA	NA	NA	NA
WP_046002361.1|3013053_3013335_-	hypothetical protein	NA	NA	NA	NA	NA
WP_005623529.1|3013645_3013909_-	helix-turn-helix transcriptional regulator	NA	F8TUW4	EBPR_podovirus	64.1	5.2e-23
WP_110590981.1|3013995_3014217_+	hypothetical protein	NA	NA	NA	NA	NA
WP_005623523.1|3014213_3014537_+	hypothetical protein	NA	NA	NA	NA	NA
WP_005623519.1|3014533_3014800_+	hypothetical protein	NA	NA	NA	NA	NA
WP_005623515.1|3014824_3015451_+	hypothetical protein	NA	NA	NA	NA	NA
WP_005623511.1|3015447_3016101_+	hypothetical protein	NA	NA	NA	NA	NA
WP_005623508.1|3016296_3016881_+	hypothetical protein	NA	NA	NA	NA	NA
WP_005623504.1|3016877_3017609_+	hypothetical protein	NA	NA	NA	NA	NA
WP_005623501.1|3017863_3018061_-	hypothetical protein	NA	NA	NA	NA	NA
WP_005623498.1|3018101_3018371_-	DUF982 domain-containing protein	NA	NA	NA	NA	NA
WP_046002362.1|3018929_3019136_-	cold-shock protein	NA	A0A1X9IGI9	Lactococcus_phage	55.6	1.0e-13
WP_046002363.1|3019464_3019827_+	HNH endonuclease	NA	Q3HR06	Burkholderia_phage	41.0	1.0e-08
WP_039983245.1|3019944_3020424_+|terminase	P27 family phage terminase small subunit	terminase	NA	NA	NA	NA
WP_046002364.1|3020420_3022256_+|terminase	terminase	terminase	A0A0U2C138	Paracoccus_phage	48.4	3.9e-141
WP_052699535.1|3022255_3023572_+|portal	phage portal protein	portal	A0A0F7L418	uncultured_marine_virus	43.2	3.4e-83
WP_009177939.1|3023583_3024177_+|head,protease	HK97 family phage prohead protease	head,protease	A0A0F7L115	uncultured_marine_virus	54.6	3.5e-43
WP_046002367.1|3024262_3025546_+|capsid	phage major capsid protein	capsid	B4UTP3	Rhizobium_phage	42.0	1.2e-80
WP_005636639.1|3025549_3026122_+	hypothetical protein	NA	NA	NA	NA	NA
WP_110590724.1|3026124_3026451_+|head,tail	head-tail adaptor protein	head,tail	NA	NA	NA	NA
WP_005636646.1|3026453_3026906_+	HK97 gp10 family phage protein	NA	A0A0U2C0P4	Paracoccus_phage	41.6	2.8e-24
WP_005636649.1|3026908_3027301_+	DUF3168 domain-containing protein	NA	NA	NA	NA	NA
WP_005636651.1|3027293_3027713_+	hypothetical protein	NA	A0A0U2BX03	Paracoccus_phage	51.4	1.8e-30
WP_005636653.1|3027712_3028057_+	hypothetical protein	NA	NA	NA	NA	NA
WP_157859741.1|3028197_3028353_+	hypothetical protein	NA	NA	NA	NA	NA
WP_052699537.1|3028349_3030329_+	hypothetical protein	NA	A0A1J0GUY9	Halomonas_phage	30.4	7.6e-18
WP_005665322.1|3030328_3030991_+	hypothetical protein	NA	NA	NA	NA	NA
WP_005665323.1|3030987_3031575_+	hypothetical protein	NA	I3UM13	Rhodobacter_phage	42.6	4.8e-37
WP_005665325.1|3031571_3031997_+	hypothetical protein	NA	I3UM14	Rhodobacter_phage	39.7	3.3e-19
WP_046002369.1|3032064_3033804_+	fibronectin type III domain-containing protein	NA	H6WBM7	Rhodobacter_phage	34.3	1.3e-61
WP_005629795.1|3034996_3035320_+	hypothetical protein	NA	A0A2I7QJM6	Vibrio_phage	66.2	1.0e-17
WP_040642880.1|3035361_3035697_+	hypothetical protein	NA	NA	NA	NA	NA
WP_005629800.1|3035753_3036080_+	hypothetical protein	NA	NA	NA	NA	NA
WP_052699560.1|3036142_3036865_+	lysozyme	NA	A0A0K1Y6F2	Rhodobacter_phage	53.9	2.3e-41
WP_046002899.1|3036861_3037137_+	hypothetical protein	NA	NA	NA	NA	NA
WP_080929655.1|3037612_3038131_+	acyloxyacyl hydrolase	NA	NA	NA	NA	NA
WP_005616412.1|3038823_3039627_-	metallophosphoesterase	NA	NA	NA	NA	NA
WP_005616415.1|3039623_3040574_-	diacylglycerol kinase catalytic subunit	NA	NA	NA	NA	NA
WP_005616417.1|3040754_3042137_+	NAD-dependent succinate-semialdehyde dehydrogenase	NA	NA	NA	NA	NA
WP_005616421.1|3042230_3043736_-	aldehyde dehydrogenase (NADP(+))	NA	NA	NA	NA	NA
WP_005616424.1|3043732_3044740_-	4-hydroxythreonine-4-phosphate dehydrogenase PdxA	NA	NA	NA	NA	NA
WP_005616427.1|3044742_3045462_-	GntR family transcriptional regulator	NA	NA	NA	NA	NA
WP_005616429.1|3045463_3046375_-	dihydrodipicolinate synthase family protein	NA	NA	NA	NA	NA
WP_005616431.1|3046371_3047547_-	L-rhamnonate dehydratase	NA	Q6A202	Oenococcus_phage	27.8	2.7e-31
WP_005616433.1|3047785_3048769_+	TRAP transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_009177759.1|3048825_3049389_+	TRAP transporter small permease subunit	NA	NA	NA	NA	NA
WP_005616437.1|3049385_3050666_+	TRAP transporter large permease	NA	NA	NA	NA	NA
WP_005616440.1|3050750_3052244_-	tetratricopeptide repeat protein	NA	NA	NA	NA	NA
WP_065317481.1|3052254_3053556_-	hypothetical protein	NA	NA	NA	NA	NA
WP_052032036.1|3053606_3054344_-	uroporphyrinogen-III synthase	NA	NA	NA	NA	NA
WP_005651894.1|3054418_3055516_+|tRNA	tRNA (adenosine(37)-N6)-threonylcarbamoyltransferase complex transferase subunit TsaD	tRNA	A0A0R6PI74	Moraxella_phage	42.1	5.3e-69
WP_005651893.1|3055512_3056475_+	NAD(P)-dependent glycerol-3-phosphate dehydrogenase	NA	NA	NA	NA	NA
WP_005651891.1|3056476_3056749_+	YciI family protein	NA	NA	NA	NA	NA
WP_005651888.1|3056748_3057171_+	EVE domain-containing protein	NA	NA	NA	NA	NA
WP_005651885.1|3057228_3057624_+	DUF1761 domain-containing protein	NA	NA	NA	NA	NA
WP_005651880.1|3057824_3058166_-	DUF2853 family protein	NA	NA	NA	NA	NA
WP_157859732.1|3058236_3058386_-	hypothetical protein	NA	NA	NA	NA	NA
WP_005651878.1|3058394_3059780_-	adenosylhomocysteinase	NA	S4W1G4	Pandoravirus	33.0	8.2e-43
WP_040643365.1|3059918_3060233_-	hypothetical protein	NA	F4YXP2	Roseobacter_phage	34.1	1.0e-09
WP_040643363.1|3060475_3061072_+	HD family hydrolase	NA	A0A0K1Y6I9	Rhodobacter_phage	48.1	1.0e-18
WP_046002031.1|3061074_3062292_-	glycosyltransferase family 61 protein	NA	NA	NA	NA	NA
WP_005627563.1|3062299_3062854_-	ActR/PrrA/RegA family redox response regulator transcription factor	NA	NA	NA	NA	NA
WP_005627565.1|3062935_3063559_-	SCO family protein	NA	NA	NA	NA	NA
WP_005627567.1|3063677_3065075_+	ActS/PrrB/RegB family redox-sensitive histidine kinase	NA	NA	NA	NA	NA
WP_005627569.1|3065160_3066711_+	hypothetical protein	NA	NA	NA	NA	NA
WP_005627572.1|3066752_3067229_+|tRNA	tRNA (adenosine(37)-N6)-threonylcarbamoyltransferase complex ATPase subunit type 1 TsaE	tRNA	NA	NA	NA	NA
WP_005627574.1|3067225_3068224_+	phosphotransferase	NA	NA	NA	NA	NA
WP_040642777.1|3068241_3068910_+	nucleotidyltransferase family protein	NA	NA	NA	NA	NA
WP_046002032.1|3068902_3071836_+	double-strand break repair protein AddB	NA	NA	NA	NA	NA
WP_046002033.1|3071832_3075198_+	double-strand break repair helicase AddA	NA	U5PSZ2	Bacillus_phage	60.0	1.1e-05
WP_152334345.1|3075254_3075581_+	thioredoxin	NA	A0A1J0GW78	Streptomyces_phage	50.0	5.6e-19
WP_005616102.1|3075725_3075920_-	DUF1127 domain-containing protein	NA	NA	NA	NA	NA
WP_005616104.1|3076154_3076712_+|protease	ATP-dependent protease subunit HslV	protease	NA	NA	NA	NA
WP_005616105.1|3076708_3077764_+	hypothetical protein	NA	NA	NA	NA	NA
WP_005616107.1|3077779_3079090_+|protease	ATP-dependent protease ATPase subunit HslU	protease	A0A173GFL6	Erwinia_phage	28.3	5.0e-42
3080563:3080580	attR	CCCATGCGCCGACTCCAT	NA	NA	NA	NA
>prophage 4
NZ_CP015230	Epibacterium mobile F1926 chromosome, complete genome	3260769	3248438	3257803	3260769		Cedratvirus(14.29%)	8	NA	NA
WP_005608801.1|3248438_3250034_+	phosphoglycerate dehydrogenase	NA	A0A2R8FCS0	Cedratvirus	38.3	7.0e-46
WP_005608803.1|3250215_3250953_+	serine/threonine protein phosphatase	NA	K4JNE2	Caulobacter_virus	35.3	7.2e-30
WP_005608806.1|3251170_3252202_-	L-threonine 3-dehydrogenase	NA	R9TPW0	Vibrio_phage	64.7	1.7e-13
WP_005608809.1|3252218_3253403_-	glycine C-acetyltransferase	NA	G9E4Q1	Emiliania_huxleyi_virus	29.7	1.4e-35
WP_005608813.1|3253567_3254134_-	helix-turn-helix transcriptional regulator	NA	I3VYZ1	Thermoanaerobacterium_phage	43.3	2.1e-05
WP_005608815.1|3254242_3255418_+	acetyl-CoA C-acyltransferase family protein	NA	NA	NA	NA	NA
WP_005608817.1|3255520_3257047_-	2-polyprenylphenol 6-hydroxylase	NA	A0A2P0VMP1	Tetraselmis_virus	28.7	4.8e-20
WP_005608820.1|3257050_3257803_-	bifunctional demethylmenaquinone methyltransferase/2-methoxy-6-polyprenyl-1,4-benzoquinol methylase UbiE	NA	A0A097BYE1	Leuconostoc_phage	26.7	7.9e-08
>prophage 1
NZ_CP015231	Epibacterium mobile F1926 plasmid unnamed1, complete sequence	1256329	2580	27194	1256329	terminase,head,tail,portal,capsid,protease	Methylophilaceae_phage(28.57%)	25	NA	NA
WP_005613709.1|2580_4269_+|terminase	terminase large subunit	terminase	A0A2H4FRP7	Methylophilaceae_phage	33.4	3.9e-79
WP_005613712.1|4305_5514_+|portal	phage portal protein	portal	H6WZL2	Escherichia_phage	26.7	1.1e-27
WP_157859747.1|5506_5671_+	hypothetical protein	NA	NA	NA	NA	NA
WP_005613715.1|5904_6378_+|head,protease	HK97 family phage prohead protease	head,protease	A0A2H4JA51	uncultured_Caudovirales_phage	32.0	1.2e-06
WP_005613717.1|6426_7518_+|capsid	phage major capsid protein	capsid	NA	NA	NA	NA
WP_005613719.1|7590_8136_+	hypothetical protein	NA	NA	NA	NA	NA
WP_005613720.1|8132_8444_+|head,tail	head-tail adaptor protein	head,tail	NA	NA	NA	NA
WP_005613722.1|8440_8806_+	hypothetical protein	NA	NA	NA	NA	NA
WP_005613723.1|8852_9320_+	hypothetical protein	NA	NA	NA	NA	NA
WP_005613724.1|9374_9596_+	hypothetical protein	NA	NA	NA	NA	NA
WP_005613726.1|9727_9946_+	hypothetical protein	NA	NA	NA	NA	NA
WP_005613727.1|10065_10347_+	hypothetical protein	NA	NA	NA	NA	NA
WP_005613728.1|10407_10887_+	hypothetical protein	NA	NA	NA	NA	NA
WP_005613729.1|10886_13148_+	hypothetical protein	NA	A0A2H4FT35	Methylophilaceae_phage	26.8	2.0e-06
WP_005613730.1|13147_13756_+	hypothetical protein	NA	NA	NA	NA	NA
WP_005613732.1|13757_14321_+	hypothetical protein	NA	NA	NA	NA	NA
WP_131665010.1|14368_19411_+	hypothetical protein	NA	F8TVN5	EBPR_siphovirus	25.8	4.1e-07
WP_005613737.1|19423_19963_+	DUF4376 domain-containing protein	NA	A0A2L0V114	Agrobacterium_phage	50.4	8.1e-23
WP_005613740.1|20087_21446_-	hypothetical protein	NA	A0A1S5SA14	Streptococcus_phage	24.2	3.8e-16
WP_040641574.1|21764_22571_+	hypothetical protein	NA	NA	NA	NA	NA
WP_005613746.1|22920_23790_-	methylenetetrahydrofolate reductase [NAD(P)H]	NA	NA	NA	NA	NA
WP_005613748.1|23947_24853_+	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_005613750.1|25040_25826_+	inositol monophosphatase	NA	NA	NA	NA	NA
WP_005613751.1|26009_26396_-	GFA family protein	NA	NA	NA	NA	NA
WP_005613753.1|26423_27194_-|protease	rhomboid family intramembrane serine protease	protease	NA	NA	NA	NA
>prophage 2
NZ_CP015231	Epibacterium mobile F1926 plasmid unnamed1, complete sequence	1256329	793274	844399	1256329	terminase,portal,holin,transposase,protease,integrase	Rhodobacter_phage(15.0%)	48	801816:801864	840983:841031
WP_005624003.1|793274_794789_-|holin	choline-sulfatase	holin	A0A1V0SA98	Catovirus	25.1	9.6e-21
WP_040642547.1|795074_797129_+	EAL domain-containing protein	NA	G3MA91	Bacillus_virus	26.6	3.7e-07
WP_005624007.1|797339_798386_+	TRAP transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_005624009.1|798475_799057_+	TRAP transporter small permease	NA	NA	NA	NA	NA
WP_005624013.1|799053_800559_+	TRAP transporter large permease	NA	NA	NA	NA	NA
WP_005624016.1|800633_801659_-	LacI family DNA-binding transcriptional regulator	NA	C6ZCU4	Enterobacteria_phage	26.7	3.3e-17
801816:801864	attL	CCCCCTCCTAAGGGGCAGGTTGCAGGTTCGAATCCTGCCGGGGTCACCA	NA	NA	NA	NA
WP_040642551.1|802049_802697_-	hypothetical protein	NA	A0A1B1IY20	Phage_MedPE-SWcel-C56	40.7	2.0e-28
WP_005624023.1|802782_803037_-	hypothetical protein	NA	NA	NA	NA	NA
WP_005624026.1|803223_803970_-	lysozyme	NA	A0A0K1Y6F2	Rhodobacter_phage	48.4	1.7e-34
WP_005624028.1|804074_804290_-	hypothetical protein	NA	NA	NA	NA	NA
WP_046002530.1|804314_805145_-	hypothetical protein	NA	NA	NA	NA	NA
WP_005632031.1|805153_805531_-	hypothetical protein	NA	NA	NA	NA	NA
WP_052699543.1|805530_810063_-	hypothetical protein	NA	G8DH58	Emiliania_huxleyi_virus	36.7	1.7e-04
WP_005607661.1|810067_810514_-	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_005607664.1|810506_811139_-	hypothetical protein	NA	NA	NA	NA	NA
WP_005607667.1|811166_811799_-	hypothetical protein	NA	A0A291AUM9	Sinorhizobium_phage	26.6	2.5e-07
WP_052699542.1|811795_813997_-	hypothetical protein	NA	A0A1J0GUY9	Halomonas_phage	31.9	2.6e-19
WP_005635092.1|813996_814323_-	hypothetical protein	NA	NA	NA	NA	NA
WP_005635094.1|814349_814688_-	hypothetical protein	NA	NA	NA	NA	NA
WP_005635096.1|814739_815168_-	hypothetical protein	NA	A0A0U2BX03	Paracoccus_phage	48.3	6.9e-25
WP_005635099.1|815192_815648_-	hypothetical protein	NA	NA	NA	NA	NA
WP_005635102.1|815644_815968_-	hypothetical protein	NA	NA	NA	NA	NA
WP_005635105.1|815967_816288_-	DUF2190 family protein	NA	NA	NA	NA	NA
WP_005635108.1|816389_818408_-|protease	Clp protease ClpP	protease	Q8VNN5	Enterobacteria_phage	26.9	1.0e-38
WP_052699541.1|818404_819856_-|portal	phage portal protein	portal	B7SYD6	Stenotrophomonas_phage	32.2	1.3e-51
WP_046002529.1|819860_820067_-	hypothetical protein	NA	NA	NA	NA	NA
WP_005612403.1|820072_822175_-|terminase	phage terminase large subunit	terminase	A0A0K1Y726	Rhodobacter_phage	42.9	2.2e-140
WP_005612404.1|822174_822771_-	hypothetical protein	NA	A0A291AUT3	Sinorhizobium_phage	25.6	2.3e-10
WP_131664995.1|823097_823739_-	hypothetical protein	NA	A0A0K1Y721	Rhodobacter_phage	38.0	1.2e-28
WP_005612407.1|824013_824736_-	hypothetical protein	NA	NA	NA	NA	NA
WP_005612409.1|825707_826265_+	hypothetical protein	NA	NA	NA	NA	NA
WP_052032000.1|826572_827547_+	hypothetical protein	NA	NA	NA	NA	NA
WP_005612413.1|827822_828590_-	hypothetical protein	NA	NA	NA	NA	NA
WP_005612416.1|828589_828802_-	hypothetical protein	NA	NA	NA	NA	NA
WP_005612419.1|829117_830914_-	P4 family phage/plasmid primase	NA	G8DGC0	Emiliania_huxleyi_virus	39.5	2.8e-112
WP_005612422.1|830913_832029_-	hypothetical protein	NA	G8DGB8	Emiliania_huxleyi_virus	42.0	4.7e-65
WP_005612425.1|832103_832607_-	single-stranded DNA-binding protein	NA	A0A0U2C0X4	Paracoccus_phage	75.6	1.1e-48
WP_005612428.1|832697_832940_-	hypothetical protein	NA	NA	NA	NA	NA
WP_005612432.1|832932_833217_-	hypothetical protein	NA	NA	NA	NA	NA
WP_005612435.1|833408_833729_+	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_005612441.1|834523_835606_+|integrase	tyrosine-type recombinase/integrase	integrase	A0A067XRF8	Caulobacter_phage	31.2	1.9e-18
WP_005612443.1|835688_835937_+	hypothetical protein	NA	NA	NA	NA	NA
WP_005612446.1|835933_836434_+	hypothetical protein	NA	NA	NA	NA	NA
WP_005612448.1|836599_837637_-	toll/interleukin-1 receptor domain-containing protein	NA	NA	NA	NA	NA
WP_005612450.1|838273_839119_+	hypothetical protein	NA	A0A1S5S8Z0	Streptococcus_phage	31.7	5.0e-11
WP_005612452.1|839288_840818_+	pentapeptide repeat-containing protein	NA	NA	NA	NA	NA
WP_131664993.1|841156_843037_-	TniQ family protein	NA	NA	NA	NA	NA
840983:841031	attR	CCCCCTCCTAAGGGGCAGGTTGCAGGTTCGAATCCTGCCGGGGTCACCA	NA	NA	NA	NA
WP_157888506.1|843612_844399_+|transposase	IS5 family transposase	transposase	A0A0N9SHJ4	Paenibacillus_phage	36.7	3.4e-17
>prophage 1
NZ_CP015234	Epibacterium mobile F1926 plasmid unnamed4, complete sequence	58318	45640	55485	58318		Paramecium_bursaria_Chlorella_virus(25.0%)	9	NA	NA
WP_005617272.1|45640_47074_+	mannose-1-phosphate guanylyltransferase/mannose-6-phosphate isomerase	NA	A0A1V0SH58	Hokovirus	28.1	9.3e-50
WP_005617269.1|47079_48246_+	nucleotide sugar dehydrogenase	NA	O41091	Paramecium_bursaria_Chlorella_virus	53.9	4.0e-107
WP_005617266.1|48374_49250_-	glucose-1-phosphate thymidylyltransferase RfbA	NA	I7I009	Enterobacteria_phage	58.3	4.2e-93
WP_005617262.1|49246_50092_-	dTDP-4-dehydrorhamnose reductase	NA	A0A291LA50	Escherichia_phage	40.8	7.5e-31
WP_005617259.1|50157_51210_-	dTDP-glucose 4,6-dehydratase	NA	K7QJG5	Escherichia_phage	50.3	2.7e-91
WP_005617256.1|51206_52400_-	acyltransferase	NA	B5WZU0	Pseudomonas_phage	30.3	1.7e-17
WP_005617254.1|52405_52954_-	dTDP-4-dehydrorhamnose 3,5-epimerase	NA	I7HJC4	Enterobacteria_phage	45.6	1.7e-39
WP_046002285.1|53131_54379_+	glycosyltransferase	NA	NA	NA	NA	NA
WP_005616218.1|54546_55485_-	GDP-L-fucose synthase	NA	M1HWW2	Paramecium_bursaria_Chlorella_virus	52.0	5.8e-85
