The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
NC_021066	Raoultella ornithinolytica B6, complete sequence	5398151	1074541	1085691	5398151		uncultured_Caudovirales_phage(50.0%)	10	NA	NA
WP_015584167.1|1074541_1075240_-	arsenical resistance protein ArsH	NA	A0A2H4J5V6	uncultured_Caudovirales_phage	65.1	1.1e-83
WP_004862888.1|1075328_1075649_+	metalloregulator ArsR/SmtB family transcription factor	NA	A0A2H4J145	uncultured_Caudovirales_phage	47.4	3.8e-20
WP_015584168.1|1075694_1076987_+	arsenic transporter	NA	A0A2H4J144	uncultured_Caudovirales_phage	69.6	1.8e-161
WP_015584169.1|1076996_1077422_+	glutaredoxin-dependent arsenate reductase	NA	A0A2H4J8T1	uncultured_Caudovirales_phage	62.6	3.1e-41
WP_015584170.1|1077401_1078043_-	CatA-like O-acetyltransferase	NA	NA	NA	NA	NA
WP_015584171.1|1078078_1078462_-	VOC family protein	NA	NA	NA	NA	NA
WP_004862872.1|1078552_1079323_+	DeoR/GlpR transcriptional regulator	NA	A0A077SK06	Escherichia_phage	29.1	1.4e-15
WP_015584172.1|1079671_1082887_+	molybdopterin-dependent oxidoreductase	NA	A0A0P0IVM8	Acinetobacter_phage	25.6	1.5e-10
WP_004862868.1|1082932_1083391_+	(2Fe-2S)-binding protein	NA	A0A0P0IVM8	Acinetobacter_phage	36.9	7.4e-17
WP_080636355.1|1083543_1085691_-	formate dehydrogenase subunit alpha	NA	A0A077SK27	Escherichia_phage	23.5	4.0e-28
>prophage 2
NC_021066	Raoultella ornithinolytica B6, complete sequence	5398151	1273596	1286768	5398151		Escherichia_phage(28.57%)	11	NA	NA
WP_015584251.1|1273596_1274028_+	universal stress protein	NA	A0A1W6JNV4	Morganella_phage	39.3	3.9e-20
WP_004862416.1|1274085_1274772_-	GntR family transcriptional regulator	NA	NA	NA	NA	NA
WP_004862414.1|1274864_1275614_-	bifunctional NADP-dependent 3-hydroxy acid dehydrogenase/3-hydroxypropionate dehydrogenase YdfG	NA	NA	NA	NA	NA
WP_015584252.1|1276362_1278408_+	peptidyl-dipeptidase Dcp	NA	A0A1V0SIU1	Klosneuvirus	23.7	3.9e-17
WP_015584253.1|1278565_1278808_-	DinI family protein	NA	Q6UAW0	Klebsiella_phage	78.5	4.0e-30
WP_004862401.1|1279193_1279424_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004862397.1|1279533_1280409_-	class A broad-spectrum beta-lactamase ORN-1	NA	Q1MVP3	Enterobacteria_phage	71.1	4.1e-109
WP_032687689.1|1280704_1280965_+	hypothetical protein	NA	A0A077SK33	Escherichia_phage	83.1	7.4e-30
WP_015584255.1|1281066_1282167_+	AAA family ATPase	NA	A0A077SLJ9	Escherichia_phage	81.7	4.3e-172
WP_004862386.1|1282209_1283475_-	MFS transporter	NA	NA	NA	NA	NA
WP_004862383.1|1283660_1286768_-	beta-galactosidase	NA	L0N6M2	Herpes_simplex_virus	59.5	0.0e+00
>prophage 3
NC_021066	Raoultella ornithinolytica B6, complete sequence	5398151	2204059	2237497	5398151	head	Cronobacter_phage(41.18%)	48	NA	NA
WP_015584718.1|2204059_2205325_-	Y-family DNA polymerase	NA	I6RSM4	Salmonella_phage	83.6	1.3e-207
WP_015584719.1|2205324_2205615_-	hypothetical protein	NA	K7PGV5	Enterobacterial_phage	43.5	8.5e-11
WP_015584720.1|2205906_2206341_+	hypothetical protein	NA	NA	NA	NA	NA
WP_144055787.1|2206356_2206656_+	hypothetical protein	NA	NA	NA	NA	NA
WP_015584722.1|2206686_2207436_-	hypothetical protein	NA	NA	NA	NA	NA
WP_015584723.1|2207439_2209188_-	SGNH/GDSL hydrolase family protein	NA	A0A286S1P0	Klebsiella_phage	48.4	5.7e-17
WP_015584724.1|2209276_2211760_-	MoaD/ThiS family protein	NA	F1C5A7	Cronobacter_phage	45.8	3.4e-201
WP_015584725.1|2211746_2212142_-	C40 family peptidase	NA	F1C5F2	Cronobacter_phage	57.1	3.5e-39
WP_015584726.1|2212138_2212609_-	hypothetical protein	NA	F1C5F1	Cronobacter_phage	38.6	5.6e-28
WP_015584727.1|2212608_2213085_-	hypothetical protein	NA	F1C5F0	Cronobacter_phage	56.3	6.2e-43
WP_071824631.1|2213210_2213480_+	DUF1883 domain-containing protein	NA	NA	NA	NA	NA
WP_015584728.1|2213456_2213636_-	hypothetical protein	NA	NA	NA	NA	NA
WP_015584729.1|2213674_2213917_-	DUF4282 domain-containing protein	NA	NA	NA	NA	NA
WP_015584730.1|2213978_2216711_-	tape measure protein	NA	A0A1B1W284	Salmonella_phage	38.2	5.5e-75
WP_071824632.1|2216753_2217083_-	hypothetical protein	NA	A0A222YZ97	Escherichia_phage	50.9	1.6e-21
WP_015584731.1|2217087_2217546_-	hypothetical protein	NA	NA	NA	NA	NA
WP_104896064.1|2217757_2218159_+	hypothetical protein	NA	A0A077K9U2	Edwardsiella_phage	40.6	3.2e-08
WP_015584733.1|2218204_2218735_-	KilA-N domain-containing protein	NA	A0A2H4FQV0	Salmonella_phage	89.7	1.3e-86
WP_015584734.1|2218950_2219664_-	hypothetical protein	NA	G0ZNE7	Cronobacter_phage	54.2	2.8e-63
WP_015584735.1|2219732_2220497_-	immunoglobulin domain-containing protein	NA	G0ZNE6	Cronobacter_phage	42.8	2.4e-36
WP_015584736.1|2220556_2220778_-	hypothetical protein	NA	NA	NA	NA	NA
WP_015584737.1|2220780_2221164_-	hypothetical protein	NA	NA	NA	NA	NA
WP_015584738.1|2221160_2221529_-	hypothetical protein	NA	F1C5E3	Cronobacter_phage	79.5	7.2e-47
WP_015584739.1|2221531_2221897_-	hypothetical protein	NA	G0ZNE2	Cronobacter_phage	46.7	5.5e-23
WP_015584740.1|2221896_2222070_-	hypothetical protein	NA	Q5G8X7	Enterobacteria_phage	55.4	4.1e-13
WP_015584741.1|2222069_2222342_-	hypothetical protein	NA	NA	NA	NA	NA
WP_015584742.1|2222341_2222722_-	hypothetical protein	NA	F1C5E2	Cronobacter_phage	55.3	1.8e-29
WP_015584743.1|2222724_2222964_-	hypothetical protein	NA	NA	NA	NA	NA
WP_015584744.1|2222996_2224052_-	hypothetical protein	NA	A0A291AXD4	Shigella_phage	52.7	1.1e-100
WP_015584745.1|2224048_2224510_-	hypothetical protein	NA	B1GS72	Salmonella_phage	53.7	1.4e-31
WP_015584746.1|2224509_2225880_-	DUF2213 domain-containing protein	NA	F1C5D9	Cronobacter_phage	52.3	1.9e-124
WP_049814518.1|2225897_2226908_-|head	phage head morphogenesis protein	head	F1C5D8	Cronobacter_phage	68.4	1.9e-113
WP_015584748.1|2226825_2228277_-	DUF1073 domain-containing protein	NA	F1C5D7	Cronobacter_phage	53.0	1.4e-122
WP_015584749.1|2228289_2229858_-	hypothetical protein	NA	G8C7P3	Escherichia_phage	88.1	5.4e-293
WP_015584750.1|2229854_2230343_-	DUF2280 domain-containing protein	NA	H9C190	Pectobacterium_phage	77.2	3.0e-48
WP_015584751.1|2230373_2231003_-	hypothetical protein	NA	I6S676	Salmonella_phage	82.4	1.9e-100
WP_015584752.1|2231066_2231546_-	hypothetical protein	NA	A0A192Y5Y1	Salmonella_phage	47.4	2.2e-11
WP_044023550.1|2232267_2232645_-	hypothetical protein	NA	C6ZR66	Salmonella_phage	64.3	2.2e-06
WP_015584754.1|2232733_2233231_-	lysozyme	NA	A0A192Y6U3	Salmonella_phage	83.6	1.1e-74
WP_015584755.1|2233208_2233478_-	hypothetical protein	NA	K7P6H9	Enterobacteria_phage	82.6	5.4e-36
WP_015584756.1|2233757_2234183_-	hypothetical protein	NA	NA	NA	NA	NA
WP_044023620.1|2234727_2235417_-	antiterminator	NA	I6PDF8	Cronobacter_phage	52.8	6.2e-60
WP_015584758.1|2235416_2235557_-	YlcG family protein	NA	NA	NA	NA	NA
WP_015584759.1|2235553_2236135_-	recombination protein NinG	NA	G0ZNC4	Cronobacter_phage	44.6	2.8e-37
WP_015584760.1|2236127_2236301_-	hypothetical protein	NA	G8C7V4	Escherichia_phage	68.4	9.2e-13
WP_015584761.1|2236300_2236756_-	hypothetical protein	NA	K7P7B8	Enterobacteria_phage	68.9	6.1e-56
WP_144055788.1|2236941_2237220_-	hypothetical protein	NA	NA	NA	NA	NA
WP_015584762.1|2237239_2237497_-	DNA polymerase III subunit theta	NA	G8C7V1	Escherichia_phage	70.1	3.5e-24
>prophage 4
NC_021066	Raoultella ornithinolytica B6, complete sequence	5398151	2241172	2255900	5398151	tRNA	Escherichia_phage(35.29%)	22	NA	NA
WP_015584767.1|2241172_2242603_-	AAA family ATPase	NA	Q9MCT4	Escherichia_phage	66.3	8.4e-184
WP_167324206.1|2242592_2243378_-	DNA replication protein	NA	F1C5C3	Cronobacter_phage	56.0	1.9e-84
WP_015584769.1|2243418_2243565_-	hypothetical protein	NA	NA	NA	NA	NA
WP_015584770.1|2243651_2243873_-	bacteriophage CII family protein	NA	NA	NA	NA	NA
WP_015584771.1|2243913_2244135_-	helix-turn-helix transcriptional regulator	NA	Q716D6	Shigella_phage	52.9	4.1e-13
WP_015584772.1|2244233_2244866_+	helix-turn-helix domain-containing protein	NA	A0A1I9KG86	Aeromonas_phage	36.0	2.7e-33
WP_015584773.1|2245227_2245434_+	penicillin-binding protein	NA	A0A0M4S6W3	Salmonella_phage	94.1	3.1e-31
WP_015584774.1|2245518_2245914_+	hypothetical protein	NA	NA	NA	NA	NA
WP_015584775.1|2245907_2246060_+	hypothetical protein	NA	NA	NA	NA	NA
WP_015584776.1|2246043_2246703_+	exodeoxyribonuclease X	NA	A0A1W5PTR6	Pseudoalteromonas_phage	36.4	9.9e-23
WP_015584777.1|2246704_2247373_+	AAA family ATPase	NA	G9L667	Escherichia_phage	44.3	6.3e-49
WP_044023552.1|2247384_2248089_+	hypothetical protein	NA	A0A088C400	Shewanella_sp._phage	39.1	1.1e-24
WP_015584779.1|2248103_2248262_+	DUF1317 family protein	NA	A0A0N7CHV0	Escherichia_phage	58.8	3.0e-10
WP_044023553.1|2248258_2248918_+	DNA methyltransferase	NA	G8C7S6	Escherichia_phage	89.0	9.1e-117
WP_015584781.1|2248914_2249133_+	hypothetical protein	NA	NA	NA	NA	NA
WP_015584782.1|2249134_2249353_+	TraR/DksA family transcriptional regulator	NA	A0A0N7C211	Escherichia_phage	50.0	5.1e-08
WP_015584783.1|2249352_2249592_+	DUF4222 domain-containing protein	NA	H6WZF9	Escherichia_phage	47.4	1.0e-09
WP_015584784.1|2249605_2249854_+	excisionase family protein	NA	S4TND0	Salmonella_phage	64.6	9.5e-27
WP_015584785.1|2249896_2251186_+	DUF3596 domain-containing protein	NA	Q8W658	Enterobacteria_phage	65.0	1.2e-168
WP_004860115.1|2251445_2252648_+	nicotinate phosphoribosyltransferase	NA	A0A2L0UZQ6	Agrobacterium_phage	30.6	1.2e-42
WP_004860113.1|2252825_2254226_+|tRNA	asparagine--tRNA ligase	tRNA	A0A2K9V902	Bandra_megavirus	36.6	1.0e-80
WP_004860110.1|2254817_2255900_+	porin	NA	Q1MVN1	Enterobacteria_phage	53.4	7.4e-100
>prophage 5
NC_021066	Raoultella ornithinolytica B6, complete sequence	5398151	5355666	5365608	5398151	integrase	Enterobacteria_phage(75.0%)	11	5353100:5353122	5365659:5365681
5353100:5353122	attL	GTGTACCTAAACGTGTACCAATT	NA	NA	NA	NA
WP_015585918.1|5355666_5358009_-	toprim domain-containing protein	NA	Q7M2A8	Enterobacteria_phage	81.3	0.0e+00
WP_014837515.1|5358023_5358344_-	DUF5375 domain-containing protein	NA	NA	NA	NA	NA
WP_015585919.1|5358340_5358568_-	hypothetical protein	NA	NA	NA	NA	NA
WP_071824676.1|5358564_5359113_-	host cell division inhibitor Icd-like protein	NA	Q7M2A7	Enterobacteria_phage	66.7	3.5e-29
WP_015585920.1|5359109_5359376_-	AlpA family transcriptional regulator	NA	Q7M299	Enterobacteria_phage	70.5	1.3e-29
WP_015585921.1|5359915_5360653_+	hypothetical protein	NA	Q7M2A2	Enterobacteria_phage	60.1	1.9e-70
WP_015585922.1|5360649_5360895_+	ogr/Delta-like zinc finger family protein	NA	Q7M294	Enterobacteria_phage	58.0	1.4e-19
WP_015585923.1|5360912_5361479_+	phage polarity suppression protein	NA	Q7M2A1	Enterobacteria_phage	63.2	1.6e-58
WP_015585924.1|5362027_5363128_-	protein kinase	NA	A0A2K9L111	Tupanvirus	26.3	9.8e-15
WP_015585925.1|5363143_5364391_-	DUF3644 domain-containing protein	NA	NA	NA	NA	NA
WP_015585926.1|5364387_5365608_-|integrase	tyrosine-type recombinase/integrase	integrase	A0A1B5FPC6	Escherichia_phage	48.9	1.1e-104
5365659:5365681	attR	GTGTACCTAAACGTGTACCAATT	NA	NA	NA	NA
