The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
NC_021054	Mycobacterium tuberculosis str. Beijing/NITR203, complete genome	4411128	2940915	2976282	4411128	terminase,transposase,capsid,head,protease,tRNA,integrase	Tupanvirus(11.11%)	41	2969716:2969743	2980699:2980726
WP_003413486.1|2940915_2942994_-|tRNA	threonine--tRNA ligase	tRNA	A0A2K9L6B6	Tupanvirus	34.9	2.5e-104
WP_003413487.1|2943102_2943330_+	hypothetical protein	NA	NA	NA	NA	NA
WP_015575225.1|2943326_2944712_-	PE family protein	NA	NA	NA	NA	NA
WP_003413569.1|2945056_2945557_+	DUF1990 domain-containing protein	NA	NA	NA	NA	NA
WP_003413574.1|2945573_2946014_-	DoxX family membrane protein	NA	NA	NA	NA	NA
WP_003901437.1|2946160_2946838_+	transcriptional regulator	NA	NA	NA	NA	NA
WP_003413583.1|2946822_2947176_-	cupin domain-containing protein	NA	NA	NA	NA	NA
WP_003413586.1|2947188_2947614_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003901438.1|2947610_2948285_-	transcriptional regulator	NA	NA	NA	NA	NA
WP_003413589.1|2948362_2949184_+	class I SAM-dependent methyltransferase	NA	NA	NA	NA	NA
WP_003413592.1|2949319_2950213_+	universal stress protein	NA	NA	NA	NA	NA
WP_003413594.1|2950215_2951034_-	universal stress protein	NA	NA	NA	NA	NA
WP_003899401.1|2951048_2952230_-|protease	zinc metalloprotease	protease	NA	NA	NA	NA
WP_003413598.1|2952288_2952720_-	hypoxic response protein 1	NA	A0A2I6B2H4	Macacine_betaherpesvirus	100.0	1.9e-75
WP_003899402.1|2953233_2954475_-	alpha/beta hydrolase	NA	NA	NA	NA	NA
WP_003899403.1|2954784_2955147_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003902322.1|2955493_2956618_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003413614.1|2956619_2957159_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003413616.1|2957298_2958597_+	RNA-splicing ligase RtcB	NA	A2RQD0	Archaeal_BJ1_virus	43.3	3.8e-90
WP_003413619.1|2958635_2958917_-	DUF1876 domain-containing protein	NA	NA	NA	NA	NA
WP_003413625.1|2959061_2959547_-	hemerythrin domain-containing protein	NA	NA	NA	NA	NA
WP_003902325.1|2959573_2959831_-	hypothetical protein	NA	NA	NA	NA	NA
WP_009938544.1|2959831_2962168_-	PE family protein	NA	NA	NA	NA	NA
WP_003899405.1|2962196_2962439_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003899406.1|2962439_2963117_+	membrane protein	NA	NA	NA	NA	NA
WP_003413657.1|2964131_2964578_+	STAS domain-containing protein	NA	NA	NA	NA	NA
WP_003413663.1|2964752_2965085_-	YnfA family protein	NA	NA	NA	NA	NA
WP_003413665.1|2965204_2965564_-	transcriptional regulator	NA	NA	NA	NA	NA
WP_003413675.1|2965665_2966124_+	cadmium-induced protein CadI	NA	NA	NA	NA	NA
WP_003899407.1|2966259_2966640_+	transcriptional regulator	NA	NA	NA	NA	NA
WP_003413686.1|2966636_2968133_+	arsenical-resistance protein	NA	A0A2H4PQT9	Staphylococcus_phage	39.7	5.1e-14
WP_085972563.1|2968322_2968559_+	DUF3018 domain-containing protein	NA	NA	NA	NA	NA
WP_077365235.1|2968631_2968805_+	hypothetical protein	NA	NA	NA	NA	NA
2969716:2969743	attL	ACTGGTTCAATCCCAGTATCGCGCACCA	NA	NA	NA	NA
WP_003899409.1|2969849_2970281_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003900538.1|2970277_2971276_+|integrase	integrase	integrase	A0A2D1G8E2	Mycobacterium_phage	47.8	7.4e-62
WP_003900539.1|2971289_2971754_+	hypothetical protein	NA	NA	NA	NA	NA
WP_075155216.1|2971741_2971930_+	hypothetical protein	NA	NA	NA	NA	NA
WP_085972562.1|2971886_2973147_+|transposase	IS3 family transposase	transposase	Q8W6R2	Burkholderia_virus	59.1	9.6e-83
WP_003901443.1|2973522_2974962_-|capsid	phage major capsid protein	capsid	A0A1B3AYS4	Gordonia_phage	40.6	1.4e-66
WP_003899412.1|2974969_2975503_-|head,protease	HK97 family phage prohead protease	head,protease	A0A2H4JB68	uncultured_Caudovirales_phage	32.9	3.1e-06
WP_003899413.1|2975655_2976282_-|terminase	phage terminase small subunit P27 family	terminase	V9H0V4	Actinophage	47.2	1.6e-17
2980699:2980726	attR	ACTGGTTCAATCCCAGTATCGCGCACCA	NA	NA	NA	NA
