The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
NZ_CP006659	Klebsiella pneumoniae strain ATCC BAA-2146 chromosome 1	5435746	609394	615219	5435746		Enterobacteria_phage(100.0%)	8	NA	NA
WP_004200806.1|609394_609961_-	phage polarity suppression protein	NA	Q7M2A1	Enterobacteria_phage	63.2	2.8e-58
WP_004152203.1|609978_610224_-	ogr/Delta-like zinc finger family protein	NA	Q7M294	Enterobacteria_phage	56.8	5.5e-19
WP_004152204.1|610220_610958_-	hypothetical protein	NA	Q7M2A2	Enterobacteria_phage	59.4	1.1e-70
WP_000556592.1|611518_611785_+	AlpA family transcriptional regulator	NA	Q7M299	Enterobacteria_phage	71.6	2.0e-30
WP_004153681.1|611781_612330_+	host cell division inhibitor Icd-like protein	NA	Q7M2A7	Enterobacteria_phage	69.4	1.1e-30
WP_004152205.1|612326_612554_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004152206.1|612550_612871_+	DUF5375 domain-containing protein	NA	NA	NA	NA	NA
WP_004152207.1|612885_615219_+	toprim domain-containing protein	NA	Q7M2A8	Enterobacteria_phage	83.9	0.0e+00
>prophage 2
NZ_CP006659	Klebsiella pneumoniae strain ATCC BAA-2146 chromosome 1	5435746	1293923	1339198	5435746	holin,head,tRNA,lysis	Escherichia_phage(25.0%)	65	NA	NA
WP_004143010.1|1293923_1295309_+|tRNA	cysteine--tRNA ligase	tRNA	M1PG92	Moumouvirus	35.4	3.5e-46
WP_004143016.1|1295354_1295567_-	ribosome-associated protein YbcJ	NA	NA	NA	NA	NA
WP_004143017.1|1295568_1296435_-	bifunctional methylenetetrahydrofolate dehydrogenase/methenyltetrahydrofolate cyclohydrolase FolD	NA	A0A249XZQ2	Enterococcus_phage	34.8	1.3e-30
WP_004151317.1|1297905_1298241_-	excisionase family DNA-binding protein	NA	NA	NA	NA	NA
WP_004151316.1|1298242_1298458_-	TraR/DksA family transcriptional regulator	NA	A0A0K2FI84	Escherichia_phage	52.9	4.0e-13
WP_004151314.1|1298459_1298678_-	hypothetical protein	NA	A0A1I9LJM7	Stx_converting_phage	47.2	1.2e-09
WP_004151312.1|1298674_1299442_-	hypothetical protein	NA	D5LH17	Escherichia_phage	53.4	1.7e-66
WP_004151310.1|1299438_1300095_-	DNA methyltransferase	NA	G8C7S6	Escherichia_phage	87.5	2.7e-113
WP_004151308.1|1300091_1300250_-	DUF1317 family protein	NA	A0A0N7CHV0	Escherichia_phage	60.8	3.0e-10
WP_004151306.1|1300246_1300927_-	YqaJ viral recombinase family protein	NA	A0A0M3ULE0	Salmonella_phage	93.4	7.9e-124
WP_004199604.1|1300923_1301769_-	phage recombination protein Bet	NA	A0A1I9KF88	Aeromonas_phage	59.2	5.3e-69
WP_004151304.1|1301784_1302069_-	host nuclease inhibitor GamL	NA	G8C7T1	Escherichia_phage	62.8	8.0e-30
WP_004151303.1|1302157_1302352_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004151302.1|1302344_1302455_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004151301.1|1302451_1302667_-	hypothetical protein	NA	B5WZV1	Pseudomonas_phage	48.6	1.6e-09
WP_004151300.1|1303017_1303707_-	helix-turn-helix transcriptional regulator	NA	G8C7U1	Escherichia_phage	52.2	4.3e-61
WP_004151299.1|1303834_1304068_+	helix-turn-helix domain-containing protein	NA	G8C7U2	Escherichia_phage	50.7	4.3e-13
WP_001548453.1|1304108_1304330_+	hypothetical protein	NA	G8EYH8	Enterobacteria_phage	41.7	6.9e-05
WP_004151298.1|1304415_1304562_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004230546.1|1304602_1305454_+	hypothetical protein	NA	F1C5C3	Cronobacter_phage	56.3	5.3e-85
WP_004230547.1|1305458_1306874_+	AAA family ATPase	NA	Q9MCT4	Escherichia_phage	67.1	1.8e-183
WP_004151295.1|1306873_1307167_+	protein ren	NA	O48423	Enterobacteria_phage	65.6	3.3e-26
WP_004151294.1|1307163_1307670_+	hypothetical protein	NA	A0A0A6Z565	Enterobacter_phage	59.6	3.0e-27
WP_004151293.1|1307776_1308619_+	ead/Ea22-like family protein	NA	A0A2H4FRZ0	Salmonella_phage	60.8	1.8e-29
WP_004151292.1|1308618_1308795_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004151291.1|1308791_1309439_+	DUF551 domain-containing protein	NA	A5LH60	Enterobacteria_phage	32.6	4.5e-12
WP_004151288.1|1309939_1310395_+	hypothetical protein	NA	K7P7B8	Enterobacteria_phage	69.5	8.0e-56
WP_004151287.1|1310394_1310565_+	NinE family protein	NA	G8C7V4	Escherichia_phage	73.2	1.3e-14
WP_004151286.1|1310557_1311193_+	recombination protein NinG	NA	M9NYX8	Enterobacteria_phage	77.9	2.7e-81
WP_004151285.1|1311189_1311327_+	YlcG family protein	NA	NA	NA	NA	NA
WP_004151284.1|1311319_1311850_+	HNH endonuclease	NA	A0A193GYW9	Enterobacter_phage	43.1	5.2e-30
WP_004151283.1|1311846_1312536_+	antitermination protein	NA	I6PDF8	Cronobacter_phage	54.5	1.4e-56
WP_004151282.1|1313445_1313694_+|holin	class II holin family protein	holin	NA	NA	NA	NA
WP_004151281.1|1313696_1314227_+	lysozyme	NA	G9L6J6	Escherichia_phage	78.5	6.0e-79
WP_004151280.1|1314223_1314688_+|lysis	lysis protein	lysis	Q76H63	Enterobacteria_phage	73.2	2.4e-55
WP_004151279.1|1314793_1315123_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004151277.1|1315493_1316096_+	hypothetical protein	NA	G8C7P2	Escherichia_phage	80.9	5.4e-76
WP_004151276.1|1316095_1317568_+	hypothetical protein	NA	A0A1W6JNY3	Morganella_phage	82.5	1.3e-248
WP_004151275.1|1317580_1319002_+	DUF1073 domain-containing protein	NA	F1C5D7	Cronobacter_phage	57.1	9.6e-148
WP_004151274.1|1318976_1319981_+|head	phage head morphogenesis protein	head	F1C5D8	Cronobacter_phage	69.7	9.0e-116
WP_004151273.1|1320022_1320499_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004151272.1|1320571_1321957_+	DUF2213 domain-containing protein	NA	F1C5D9	Cronobacter_phage	60.0	2.3e-154
WP_004151271.1|1321960_1322389_+	hypothetical protein	NA	F1C5E0	Cronobacter_phage	60.8	1.6e-42
WP_004151270.1|1322400_1323495_+	hypothetical protein	NA	F1C5E1	Cronobacter_phage	62.8	1.7e-123
WP_004151269.1|1323505_1323745_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004151268.1|1323747_1324128_+	hypothetical protein	NA	F1C5E2	Cronobacter_phage	55.3	5.3e-29
WP_004151267.1|1324127_1324301_+	hypothetical protein	NA	I6R0P9	Salmonella_phage	56.1	1.4e-13
WP_004151266.1|1324300_1324663_+	hypothetical protein	NA	A0A173GCE0	Salmonella_phage	45.0	1.8e-18
WP_004151265.1|1324665_1325091_+	hypothetical protein	NA	R9TPP7	Aeromonas_phage	47.9	5.1e-28
WP_004151264.1|1325087_1325480_+	hypothetical protein	NA	G0ZNE4	Cronobacter_phage	52.7	5.1e-35
WP_004151263.1|1325548_1326301_+	Ig domain-containing protein	NA	G0ZNE6	Cronobacter_phage	42.1	5.8e-43
WP_004151262.1|1326353_1327031_+	hypothetical protein	NA	F1C5E8	Cronobacter_phage	57.9	4.8e-73
WP_004151261.1|1327206_1327962_+	KilA-N domain-containing protein	NA	K7PGT4	Enterobacteria_phage	51.0	2.4e-60
WP_004151260.1|1327964_1328219_+	hypothetical protein	NA	K7PM89	Enterobacteria_phage	73.0	6.7e-20
WP_004151259.1|1328512_1328983_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004151258.1|1328999_1329359_-	Arc family DNA-binding protein	NA	A0A0P0ZBD1	Stx2-converting_phage	47.5	3.8e-16
WP_004151257.1|1329458_1329629_+	Arc family DNA-binding protein	NA	I6R9A8	Salmonella_phage	87.0	6.1e-17
WP_004151256.1|1329618_1330332_+	hypothetical protein	NA	H6WRU8	Salmonella_phage	50.2	3.9e-49
WP_004151255.1|1330397_1331183_+	phage repressor protein	NA	A0A2L1IV39	Escherichia_phage	59.7	1.9e-84
WP_004151254.1|1331310_1331814_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004199612.1|1331906_1335353_+	tape measure protein	NA	Q5G8W8	Enterobacteria_phage	48.6	1.0e-163
WP_004151252.1|1335395_1335872_+	hypothetical protein	NA	A0A2P1MXB5	Escherichia_phage	49.7	3.0e-37
WP_004199076.1|1335871_1336342_+	hypothetical protein	NA	R9TPR6	Aeromonas_phage	41.0	2.5e-28
WP_004151250.1|1336338_1336734_+	C40 family peptidase	NA	F1C5F2	Cronobacter_phage	54.0	8.0e-36
WP_004151249.1|1336720_1339198_+	MoaD/ThiS family protein	NA	F1C5A7	Cronobacter_phage	45.6	2.7e-198
>prophage 3
NZ_CP006659	Klebsiella pneumoniae strain ATCC BAA-2146 chromosome 1	5435746	1785614	1822950	5435746	capsid,plate,portal,lysis,integrase,head,tail,terminase	Salmonella_phage(87.18%)	47	1785522:1785540	1823022:1823040
1785522:1785540	attL	CAGGCAACAAAAAACCCAT	NA	NA	NA	NA
WP_014342959.1|1785614_1786595_-|integrase	tyrosine-type recombinase/integrase	integrase	A0A218M4I3	Erwinia_phage	57.2	1.4e-97
WP_004178082.1|1787082_1788570_+	group II intron reverse transcriptase/maturase	NA	A0A0U4J920	Pseudomonas_phage	35.5	1.2e-31
WP_004150866.1|1788668_1789613_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004152885.1|1789624_1790503_-	phage repressor protein CI	NA	A0A1S6KZZ7	Salmonella_phage	39.9	1.7e-30
WP_000188448.1|1790648_1790870_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000460893.1|1790902_1791412_+	phage regulatory CII family protein	NA	E5G6L3	Salmonella_phage	98.8	5.8e-87
WP_000956179.1|1791419_1791620_+	DUF2724 domain-containing protein	NA	E5G6L4	Salmonella_phage	97.0	1.6e-32
WP_004199692.1|1791583_1791925_+	DUF5347 domain-containing protein	NA	E5G6L5	Salmonella_phage	98.2	1.7e-55
WP_004150864.1|1791992_1792226_+	DUF2732 family protein	NA	E5G6L6	Salmonella_phage	96.1	4.1e-32
WP_000752622.1|1792225_1792453_+	TraR/DksA family transcriptional regulator	NA	E5G6L7	Salmonella_phage	98.7	6.0e-36
WP_004150863.1|1792449_1793307_+	DNA adenine methylase	NA	E5G6L8	Salmonella_phage	95.4	2.0e-156
WP_004150862.1|1793303_1795718_+	replication endonuclease	NA	E5G6L9	Salmonella_phage	97.5	0.0e+00
WP_001154434.1|1795871_1796060_+	hypothetical protein	NA	E5G6M0	Salmonella_phage	98.4	5.5e-27
WP_001217575.1|1796070_1796304_+	DinI family protein	NA	E5G6M1	Salmonella_phage	100.0	4.7e-36
WP_000700647.1|1796418_1797096_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004199124.1|1797371_1799114_+	AIPR family protein	NA	NA	NA	NA	NA
WP_002895959.1|1799175_1800201_-|portal	phage portal protein	portal	A0A1S6KZW5	Salmonella_phage	86.7	7.6e-171
WP_004150858.1|1800200_1801967_-|terminase	terminase ATPase subunit family protein	terminase	A0A1S6KZW3	Salmonella_phage	99.0	0.0e+00
WP_002895967.1|1802109_1802943_+|capsid	GPO family capsid scaffolding protein	capsid	A0A1S6KZW9	Salmonella_phage	88.8	6.3e-123
WP_002895972.1|1802959_1804018_+|capsid	phage major capsid protein, P2 family	capsid	E5G6M6	Salmonella_phage	93.1	1.1e-180
WP_000059191.1|1804021_1804672_+|terminase	terminase endonuclease subunit	terminase	E5G6M7	Salmonella_phage	96.3	8.7e-112
WP_002896151.1|1804767_1805232_+|head	head completion/stabilization protein	head	A0A1S6KZW8	Salmonella_phage	89.0	8.4e-77
WP_002896155.1|1805231_1805435_+|tail	tail protein X	tail	A0A1S6KZY4	Salmonella_phage	88.1	1.3e-29
WP_002896158.1|1805438_1805654_+	hypothetical protein	NA	E5G6N0	Salmonella_phage	90.1	3.6e-30
WP_002896161.1|1805634_1806144_+	lysozyme	NA	E5G6N1	Salmonella_phage	83.4	2.1e-81
WP_002896163.1|1806148_1806532_+	hypothetical protein	NA	A0A1S6KZZ2	Salmonella_phage	42.0	2.1e-17
WP_002896168.1|1806528_1806957_+|lysis	LysB family phage lysis regulatory protein	lysis	A0A1S6KZX8	Salmonella_phage	77.9	9.6e-51
WP_002896170.1|1806943_1807090_+	hypothetical protein	NA	A0A1S6KZX6	Salmonella_phage	76.1	6.0e-13
WP_002896172.1|1807052_1807484_+|tail	phage tail protein	tail	A0A1S6KZY0	Salmonella_phage	82.5	9.9e-64
WP_002896175.1|1807476_1807923_+	phage virion morphogenesis protein	NA	A0A1S6L001	Salmonella_phage	71.2	2.2e-50
WP_004150857.1|1807919_1808612_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002896177.1|1808706_1809279_+|plate	phage baseplate assembly protein V	plate	E5G6N6	Salmonella_phage	72.3	4.7e-77
WP_002896179.1|1809275_1809638_+	GPW/gp25 family protein	NA	A0A1S6KZZ4	Salmonella_phage	84.7	5.8e-49
WP_002896182.1|1809624_1810533_+|plate	baseplate assembly protein	plate	E5G6N8	Salmonella_phage	66.9	7.6e-106
WP_004150856.1|1810525_1811125_+|tail	phage tail protein I	tail	A0A1S6L000	Salmonella_phage	60.5	1.3e-58
WP_019724930.1|1813343_1814078_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002896186.1|1814081_1814813_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002896188.1|1814809_1815013_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002896191.1|1815042_1816119_+|tail	phage tail protein	tail	Q37842	Escherichia_phage	44.8	1.2e-25
WP_002896193.1|1816257_1817430_+|tail	phage tail sheath protein	tail	A0A1S6KZY7	Salmonella_phage	93.3	1.9e-210
WP_002896201.1|1817439_1817955_+|tail	phage major tail tube protein	tail	E5G6P8	Salmonella_phage	85.4	1.3e-81
WP_002896204.1|1818007_1818307_+|tail	phage tail assembly protein	tail	E5G6P9	Salmonella_phage	79.0	3.7e-33
WP_002896220.1|1818321_1818441_+|tail	GpE family phage tail protein	tail	E5G6Q0	Salmonella_phage	87.2	2.2e-13
WP_002896222.1|1818433_1821061_+|tail	phage tail tape measure protein	tail	E5FFG5	Burkholderia_phage	42.0	5.6e-117
WP_002896224.1|1821057_1821543_+|tail	phage tail protein	tail	E5G6Q2	Salmonella_phage	75.6	7.2e-63
WP_002896225.1|1821539_1822640_+	phage late control D family protein	NA	A0A1S6KZZ5	Salmonella_phage	87.4	4.9e-176
WP_000972391.1|1822731_1822950_+	ogr/Delta-like zinc finger family protein	NA	Q53ZE7	Salmonella_virus	69.0	7.5e-20
1823022:1823040	attR	CAGGCAACAAAAAACCCAT	NA	NA	NA	NA
>prophage 4
NZ_CP006659	Klebsiella pneumoniae strain ATCC BAA-2146 chromosome 1	5435746	1857366	1866830	5435746	protease,tRNA	Dickeya_phage(16.67%)	8	NA	NA
WP_002896440.1|1857366_1858482_+	macrolide transporter subunit MacA	NA	A0A140XAI1	Dickeya_phage	52.7	1.3e-06
WP_004150848.1|1858478_1860419_+	macrolide ABC transporter ATP-binding protein/permease MacB	NA	G9BWD6	Planktothrix_phage	40.5	1.9e-37
WP_002896516.1|1860495_1860717_-	cold shock-like protein CspD	NA	A0A2H4N7Y6	Lake_Baikal_phage	61.2	1.3e-16
WP_002896520.1|1861042_1861360_+|protease	ATP-dependent Clp protease adapter ClpS	protease	A0A1B1IT64	uncultured_Mediterranean_phage	45.7	2.0e-13
WP_002896522.1|1861390_1863670_+|protease	ATP-dependent Clp protease ATP-binding subunit ClpA	protease	A0A223W0B1	Agrobacterium_phage	42.0	1.6e-165
WP_001040187.1|1863790_1864009_-	translation initiation factor IF-1	NA	NA	NA	NA	NA
WP_002898014.1|1864362_1865064_-|tRNA	leucyl/phenylalanyl-tRNA--protein transferase	tRNA	NA	NA	NA	NA
WP_004150847.1|1865108_1866830_-	cysteine/glutathione ABC transporter ATP-binding protein/permease CydC	NA	A0A2R8FG22	Brazilian_cedratvirus	34.3	1.5e-14
>prophage 5
NZ_CP006659	Klebsiella pneumoniae strain ATCC BAA-2146 chromosome 1	5435746	2283747	2297460	5435746	transposase,integrase	Enterobacteria_phage(43.75%)	20	2283971:2283985	2296083:2296097
WP_004140269.1|2283747_2284557_-	peptide ABC transporter ATP-binding protein SapF	NA	A0A2H4PQG7	Staphylococcus_phage	28.9	2.1e-14
2283971:2283985	attL	AGCTCCAGCATCAGG	NA	NA	NA	NA
WP_004140266.1|2284558_2285551_-	peptide ABC transporter ATP-binding protein SapD	NA	G9BWD6	Planktothrix_phage	27.2	3.0e-07
WP_004151901.1|2285550_2286441_-	peptide ABC transporter permease SapC	NA	NA	NA	NA	NA
WP_004151900.1|2286587_2287805_+|integrase	site-specific integrase	integrase	K7PGY1	Enterobacteria_phage	51.9	8.6e-121
WP_004151899.1|2288012_2288675_-	DNA methyltransferase	NA	G8C7S6	Escherichia_phage	84.6	2.7e-105
WP_004151898.1|2288671_2289100_-	hypothetical protein	NA	M9NYX4	Enterobacteria_phage	80.3	7.5e-64
WP_004201102.1|2289096_2289777_-	YqaJ viral recombinase family protein	NA	A0A0M3ULE0	Salmonella_phage	91.2	8.2e-121
WP_088224434.1|2289778_2290066_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004201103.1|2290062_2290908_-	phage recombination protein Bet	NA	A0A1I9KF88	Aeromonas_phage	59.2	1.8e-69
WP_004201105.1|2290923_2291208_-	host nuclease inhibitor GamL	NA	G8C7T1	Escherichia_phage	79.8	1.1e-39
WP_004135674.1|2291296_2291491_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004219883.1|2291483_2291609_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004201108.1|2291919_2292123_+	hypothetical protein	NA	A0A192Y6Q5	Salmonella_phage	71.6	3.9e-18
WP_004201109.1|2292204_2293281_-	ParA family protein	NA	H2BD62	Pseudomonas_phage	37.9	9.1e-58
WP_004201113.1|2293568_2294267_-	helix-turn-helix transcriptional regulator	NA	Q76H56	Enterobacteria_phage	84.1	3.7e-108
WP_004201115.1|2294378_2294606_+	helix-turn-helix domain-containing protein	NA	Q76H55	Enterobacteria_phage	77.1	1.4e-24
WP_001548453.1|2294646_2294868_+	hypothetical protein	NA	G8EYH8	Enterobacteria_phage	41.7	6.9e-05
WP_004201117.1|2294953_2295814_+	replication protein	NA	K7PGT1	Enterobacteria_phage	53.3	1.0e-59
WP_004201118.1|2295810_2296659_+	ATP-binding protein	NA	K7PLU3	Enterobacteria_phage	60.1	5.1e-88
2296083:2296097	attR	CCTGATGCTGGAGCT	NA	NA	NA	NA
WP_001067855.1|2296755_2297460_-|transposase	IS6-like element IS26 family transposase	transposase	A0A077SL39	Escherichia_phage	100.0	1.8e-139
>prophage 6
NZ_CP006659	Klebsiella pneumoniae strain ATCC BAA-2146 chromosome 1	5435746	2300954	2309524	5435746	transposase	Escherichia_phage(28.57%)	7	NA	NA
WP_001389365.1|2300954_2301719_+|transposase	IS6-like element IS6100 family transposase	transposase	A0A077SL39	Escherichia_phage	65.7	4.3e-86
WP_001067855.1|2301895_2302600_+|transposase	IS6-like element IS26 family transposase	transposase	A0A077SL39	Escherichia_phage	100.0	1.8e-139
WP_004178082.1|2304509_2305997_+	group II intron reverse transcriptase/maturase	NA	A0A0U4J920	Pseudomonas_phage	35.5	1.2e-31
WP_002901812.1|2306076_2306496_+	translesion error-prone DNA polymerase V autoproteolytic subunit	NA	A0A1W6JNS2	Morganella_phage	57.5	1.4e-35
WP_002901813.1|2306497_2307763_+	Y-family DNA polymerase	NA	I6RSM4	Salmonella_phage	82.7	9.6e-208
WP_071531199.1|2307838_2308666_-	FRG domain-containing protein	NA	A0A1S6KZX9	Salmonella_phage	30.2	8.4e-19
WP_002901815.1|2308852_2309524_-	SOS response-associated peptidase	NA	A0A2H4J5W2	uncultured_Caudovirales_phage	59.6	4.5e-79
>prophage 7
NZ_CP006659	Klebsiella pneumoniae strain ATCC BAA-2146 chromosome 1	5435746	2342457	2415864	5435746	holin,terminase,plate,integrase	uncultured_Caudovirales_phage(33.33%)	84	2340538:2340552	2349478:2349492
2340538:2340552	attL	AGTTGATCCTCTGGC	NA	NA	NA	NA
WP_004152144.1|2342457_2343219_+	SDR family oxidoreductase	NA	Q06VL0	Trichoplusia_ni_ascovirus	32.5	2.4e-20
WP_004152145.1|2343435_2344968_+	HD domain-containing protein	NA	A0A1B1ISR1	uncultured_Mediterranean_phage	30.0	1.1e-21
WP_016197745.1|2345166_2345715_-	DJ-1/PfpI family protein	NA	NA	NA	NA	NA
WP_004152147.1|2345911_2347093_+|integrase	site-specific integrase	integrase	A0A0M4QX09	Salmonella_phage	84.2	5.6e-202
WP_004152148.1|2347073_2347316_-	hypothetical protein	NA	A0A0M4RTZ2	Salmonella_phage	73.8	2.2e-20
WP_004198245.1|2347275_2347422_-	hypothetical protein	NA	A0A1B5FPC2	Escherichia_phage	70.8	2.9e-15
WP_014343018.1|2347494_2347728_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004152150.1|2347970_2348183_-	hypothetical protein	NA	A0A286S2B6	Klebsiella_phage	98.6	3.4e-33
WP_004152151.1|2348179_2348404_-	hypothetical protein	NA	A0A286S2B3	Klebsiella_phage	89.2	3.1e-29
WP_004154298.1|2348393_2349104_-	Rha family transcriptional regulator	NA	A0A286S260	Klebsiella_phage	88.3	2.1e-111
WP_004152153.1|2349109_2349628_-	hypothetical protein	NA	A0A286S1S7	Klebsiella_phage	98.8	1.7e-94
2349478:2349492	attR	GCCAGAGGATCAACT	NA	NA	NA	NA
WP_004152154.1|2349732_2350560_-	hypothetical protein	NA	Q8W654	Enterobacteria_phage	84.0	5.5e-111
WP_004152155.1|2350556_2350751_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004152156.1|2350747_2351173_-	hypothetical protein	NA	A0A286S1S2	Klebsiella_phage	77.9	3.5e-53
WP_004177208.1|2351169_2351388_-	hypothetical protein	NA	A0A286S1P6	Klebsiella_phage	98.6	6.6e-32
WP_004152157.1|2351359_2351614_-	hypothetical protein	NA	A0A286SGR4	Klebsiella_phage	97.6	3.1e-41
WP_004152158.1|2351606_2351972_-	hypothetical protein	NA	A0A286S1Q6	Klebsiella_phage	99.2	6.9e-58
WP_004152159.1|2352141_2352330_-	hypothetical protein	NA	A0A286S1P8	Klebsiella_phage	100.0	4.6e-26
WP_004152160.1|2352322_2352637_-	hypothetical protein	NA	A0A286S1T9	Klebsiella_phage	100.0	1.0e-49
WP_004152161.1|2352807_2353476_-	LexA family transcriptional regulator	NA	A0A286S2B2	Klebsiella_phage	99.5	2.4e-125
WP_004152162.1|2353573_2353795_+	helix-turn-helix transcriptional regulator	NA	A0A286S2C1	Klebsiella_phage	100.0	3.0e-32
WP_004198228.1|2354371_2356030_+	DEAD/DEAH box helicase	NA	A0A286N2P9	Klebsiella_phage	96.0	0.0e+00
WP_004198233.1|2356031_2356994_+	toprim domain-containing protein	NA	A0A286N2Q0	Klebsiella_phage	99.4	4.8e-183
WP_004198239.1|2356990_2357467_+	hypothetical protein	NA	A0A286N2Q1	Klebsiella_phage	100.0	1.8e-90
WP_004152167.1|2357463_2358246_+	antitermination protein	NA	F1C595	Cronobacter_phage	76.8	7.2e-113
WP_004146526.1|2358651_2358900_+|holin	class II holin family protein	holin	NA	NA	NA	NA
WP_004152169.1|2358902_2359433_+	lysozyme	NA	K7PLY1	Enterobacteria_phage	77.1	2.7e-79
WP_004153952.1|2359429_2359819_+	lipase chaperone	NA	A0A192Y6H8	Salmonella_phage	49.2	9.4e-21
WP_004152170.1|2360053_2360374_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004218030.1|2360739_2361228_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004152172.1|2361178_2362579_+|terminase	PBSX family phage terminase large subunit	terminase	A0A077KAW0	Edwardsiella_phage	69.0	9.4e-188
WP_004152173.1|2362816_2364268_+	DUF1073 domain-containing protein	NA	A0A0M4S6U1	Salmonella_phage	68.8	3.8e-192
WP_004152174.1|2364323_2364872_+	hypothetical protein	NA	A0A0M4REK0	Salmonella_phage	56.3	3.0e-49
WP_004199270.1|2364923_2366126_+	DUF2213 domain-containing protein	NA	A0A0M4R5A6	Salmonella_phage	54.1	2.6e-106
WP_000528476.1|2366129_2366624_+	hypothetical protein	NA	A0A2H4JHM9	uncultured_Caudovirales_phage	62.7	4.2e-50
WP_001132269.1|2366635_2367577_+	DUF2184 domain-containing protein	NA	A0A2H4J191	uncultured_Caudovirales_phage	77.1	1.7e-137
WP_000725700.1|2367616_2367898_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000113538.1|2367866_2368286_+	DUF4054 domain-containing protein	NA	A0A0M5M3S2	Salmonella_phage	60.7	3.3e-40
WP_000834982.1|2368282_2368789_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001116156.1|2368788_2369175_+	hypothetical protein	NA	A0A2H4J1A4	uncultured_Caudovirales_phage	78.2	1.1e-48
WP_004152176.1|2369269_2369710_+	hypothetical protein	NA	A0A2H4J1A0	uncultured_Caudovirales_phage	51.7	1.6e-40
WP_004152177.1|2369713_2370859_+	DUF3383 domain-containing protein	NA	A0A2H4J8G4	uncultured_Caudovirales_phage	76.9	6.3e-166
WP_004199809.1|2370869_2371310_+	DUF3277 family protein	NA	A0A0M5M1K6	Salmonella_phage	80.1	3.3e-62
WP_004152564.1|2371313_2371739_+	hypothetical protein	NA	A0A2H4J2V6	uncultured_Caudovirales_phage	63.4	2.6e-40
WP_004152565.1|2371774_2371927_+	hypothetical protein	NA	A0A2H4J1A2	uncultured_Caudovirales_phage	88.0	7.6e-19
WP_004152566.1|2371916_2373920_+	lytic transglycosylase domain-containing protein	NA	A0A2H4J9N7	uncultured_Caudovirales_phage	63.6	1.2e-247
WP_004152567.1|2373919_2374519_+	hypothetical protein	NA	A0A2H4J1B3	uncultured_Caudovirales_phage	57.6	9.9e-54
WP_004217362.1|2374594_2374822_+	hypothetical protein	NA	A0A2H4J495	uncultured_Caudovirales_phage	56.0	4.6e-20
WP_004152569.1|2374824_2375847_+	hypothetical protein	NA	A0A2H4J1B2	uncultured_Caudovirales_phage	54.2	9.2e-100
WP_004152570.1|2375846_2376188_+	hypothetical protein	NA	A0A2H4J1A5	uncultured_Caudovirales_phage	46.6	1.8e-23
WP_004199301.1|2376237_2376420_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004152571.1|2376462_2377029_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004152572.1|2377082_2377736_+	hypothetical protein	NA	A0A2H4J8H6	uncultured_Caudovirales_phage	63.5	1.0e-59
WP_004152573.1|2377737_2378091_+	hypothetical protein	NA	A0A2H4J629	uncultured_Caudovirales_phage	80.3	2.3e-50
WP_004152574.1|2378090_2379287_+|plate	baseplate J/gp47 family protein	plate	A0A0M4RD32	Salmonella_phage	72.9	3.9e-158
WP_004152575.1|2379283_2380057_+	DUF2612 domain-containing protein	NA	A0A2H4J1A9	uncultured_Caudovirales_phage	54.4	2.8e-77
WP_004152576.1|2380056_2380923_+	hypothetical protein	NA	A0A2H4IYR0	uncultured_Caudovirales_phage	64.5	1.9e-34
WP_004152577.1|2380922_2381120_+	hypothetical protein	NA	NA	NA	NA	NA
WP_025403895.1|2383470_2384199_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002902128.1|2384209_2384941_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002902131.1|2384937_2385147_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004178082.1|2385596_2387084_+	group II intron reverse transcriptase/maturase	NA	A0A0U4J920	Pseudomonas_phage	35.5	1.2e-31
WP_002902133.1|2387161_2387446_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002902136.1|2387668_2387917_-	DinI-like family protein	NA	S5MQI1	Escherichia_phage	70.4	1.4e-25
WP_002902144.1|2388762_2389254_+	type VI secretion system contractile sheath small subunit	NA	NA	NA	NA	NA
WP_002902148.1|2389296_2390841_+	type VI secretion system contractile sheath large subunit	NA	NA	NA	NA	NA
WP_004218490.1|2390850_2392194_+|plate	type VI secretion system baseplate subunit TssK	plate	NA	NA	NA	NA
WP_004151603.1|2392190_2392880_+	DotU family type IV/VI secretion system protein	NA	NA	NA	NA	NA
WP_004151602.1|2392876_2394583_+	OmpA family protein	NA	NA	NA	NA	NA
WP_002902160.1|2394587_2395079_+	type VI secretion system effector Hcp	NA	NA	NA	NA	NA
WP_002902163.1|2395343_2397998_+	type VI secretion system ATPase TssH	NA	K4FB40	Cronobacter_phage	33.4	2.5e-96
WP_004228410.1|2397999_2400369_+	type VI secretion system tip protein VgrG	NA	A0A2H4JCD4	uncultured_Caudovirales_phage	33.8	9.1e-18
WP_002902169.1|2400369_2401149_+	DUF4123 domain-containing protein	NA	NA	NA	NA	NA
WP_002902172.1|2401212_2401743_+	T6SS immunity phospholipase A1-binding lipoprotein Tli1-KP	NA	NA	NA	NA	NA
WP_002902174.1|2401811_2402342_+	T6SS immunity phospholipase A1-binding lipoprotein Tli1-KP	NA	NA	NA	NA	NA
WP_002902176.1|2402409_2402940_+	T6SS immunity phospholipase A1-binding lipoprotein Tli1-KP	NA	NA	NA	NA	NA
WP_002902178.1|2403008_2403539_+	T6SS immunity phospholipase A1-binding lipoprotein Tli1-KP	NA	NA	NA	NA	NA
WP_002902180.1|2403606_2404137_+	T6SS immunity phospholipase A1-binding lipoprotein Tli1-KP	NA	NA	NA	NA	NA
WP_004151601.1|2404124_2406542_+	DUF2235 domain-containing protein	NA	NA	NA	NA	NA
WP_002902252.1|2406586_2406844_+	PAAR domain-containing protein	NA	NA	NA	NA	NA
WP_002902254.1|2406840_2407980_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004151599.1|2407963_2411389_+	type VI secretion protein VasK	NA	NA	NA	NA	NA
WP_004151598.1|2413060_2414815_+|plate	type VI secretion system baseplate subunit TssF	plate	NA	NA	NA	NA
WP_002902268.1|2414778_2415864_+|plate	type VI secretion system baseplate subunit TssG	plate	NA	NA	NA	NA
>prophage 8
NZ_CP006659	Klebsiella pneumoniae strain ATCC BAA-2146 chromosome 1	5435746	2609129	2620016	5435746		Escherichia_phage(87.5%)	9	NA	NA
WP_002210516.1|2609129_2609750_-	aldolase	NA	A0A077SK32	Escherichia_phage	100.0	8.0e-115
WP_004151609.1|2609742_2611008_-	four-carbon acid sugar kinase family protein	NA	A0A077SLJ7	Escherichia_phage	99.5	6.6e-233
WP_004151610.1|2611019_2611922_-	NAD(P)-dependent oxidoreductase	NA	A0A077SLF7	Escherichia_phage	99.3	7.7e-159
WP_002210513.1|2612182_2612944_+	DeoR/GlpR transcriptional regulator	NA	A0A077SK06	Escherichia_phage	100.0	1.9e-134
WP_004176269.1|2612964_2613825_-	class A broad-spectrum beta-lactamase SHV-11	NA	A0A077SL40	Escherichia_phage	99.3	2.2e-155
WP_002904006.1|2614122_2614383_+	hypothetical protein	NA	A0A077SK33	Escherichia_phage	97.7	3.5e-40
WP_001620097.1|2614469_2615558_+	AAA family ATPase	NA	A0A077SLJ9	Escherichia_phage	100.0	8.0e-211
WP_004151612.1|2615588_2616854_-	MFS transporter	NA	NA	NA	NA	NA
WP_004151613.1|2616908_2620016_-	beta-galactosidase	NA	L0N6M2	Herpes_simplex_virus	59.6	0.0e+00
>prophage 9
NZ_CP006659	Klebsiella pneumoniae strain ATCC BAA-2146 chromosome 1	5435746	3585565	3604247	5435746	transposase	Stx2-converting_phage(21.43%)	17	NA	NA
WP_004189161.1|3585565_3585916_-	IS66 family insertion sequence element accessory protein TnpB	NA	A0A0P0ZBY2	Stx2-converting_phage	63.8	5.2e-39
WP_004201210.1|3585912_3586353_-	IS66 family insertion sequence hypothetical protein	NA	Q6H9S5	Enterobacteria_phage	59.0	1.7e-18
WP_102003640.1|3586409_3587606_+|transposase	IS3 family transposase	transposase	Q9ZXG3	Shigella_phage	81.1	2.2e-145
WP_156529680.1|3587788_3588052_+	hypothetical protein	NA	NA	NA	NA	NA
WP_025403909.1|3588350_3589766_+	mannose-1-phosphate guanylyltransferase/mannose-6-phosphate isomerase	NA	A0A1V0SH58	Hokovirus	29.9	2.8e-54
WP_023321278.1|3589788_3591159_+	phosphomannomutase CpsG	NA	A0A127AWJ1	Bacillus_phage	26.5	4.2e-31
WP_004103677.1|3591321_3592488_+	UDP-glucose 6-dehydrogenase	NA	M1I798	Paramecium_bursaria_Chlorella_virus	54.2	1.8e-112
WP_004200392.1|3593045_3593168_-	small membrane protein	NA	NA	NA	NA	NA
WP_004200391.1|3593634_3594639_-	NAD-dependent epimerase	NA	E3T4Y8	Cafeteria_roenbergensis_virus	28.6	5.2e-31
WP_038434044.1|3594978_3596571_-|transposase	IS66-like element ISKox1 family transposase	transposase	A0A0P0ZEB3	Stx2-converting_phage	61.8	3.2e-176
WP_004189161.1|3596601_3596952_-	IS66 family insertion sequence element accessory protein TnpB	NA	A0A0P0ZBY2	Stx2-converting_phage	63.8	5.2e-39
WP_004201210.1|3596948_3597389_-	IS66 family insertion sequence hypothetical protein	NA	Q6H9S5	Enterobacteria_phage	59.0	1.7e-18
WP_102003640.1|3597445_3598642_+|transposase	IS3 family transposase	transposase	Q9ZXG3	Shigella_phage	81.1	2.2e-145
WP_004200428.1|3599171_3600758_+	TerC family protein	NA	A0A0R6PEZ3	Moraxella_phage	43.5	1.7e-36
WP_004200430.1|3601058_3602906_-	outer membrane assembly protein AsmA	NA	NA	NA	NA	NA
WP_004103714.1|3602933_3603515_-	dCTP deaminase	NA	I4AZP2	Saccharomonospora_phage	42.1	3.9e-31
WP_004200433.1|3603605_3604247_-	uridine kinase	NA	A0A1V0SAA3	Catovirus	37.9	3.8e-35
>prophage 10
NZ_CP006659	Klebsiella pneumoniae strain ATCC BAA-2146 chromosome 1	5435746	3938975	4013465	5435746	protease,holin,integrase,head,tRNA,transposase,tail,terminase	Salmonella_phage(35.71%)	83	3944617:3944634	4012454:4012471
WP_004152006.1|3938975_3940979_-|tRNA	tRNA(Met) cytidine acetyltransferase	tRNA	NA	NA	NA	NA
WP_002913800.1|3940988_3941864_-	neutral zinc metallopeptidase	NA	NA	NA	NA	NA
WP_002913801.1|3941983_3942697_-	phosphoribosylaminoimidazolesuccinocarboxamide synthase	NA	A0A127KMU1	Cyanophage	35.7	1.1e-38
WP_002913802.1|3942912_3943947_-	outer membrane protein assembly factor BamC	NA	NA	NA	NA	NA
WP_002913803.1|3943963_3944842_-	4-hydroxy-tetrahydrodipicolinate synthase	NA	NA	NA	NA	NA
3944617:3944634	attL	CAGCGATAACCGGAATAC	NA	NA	NA	NA
WP_002913804.1|3944995_3945562_+	glycine cleavage system transcriptional repressor	NA	NA	NA	NA	NA
WP_002913805.1|3945565_3946036_+	thioredoxin-dependent thiol peroxidase	NA	NA	NA	NA	NA
WP_002913806.1|3946097_3947159_-	AI-2E family transporter	NA	NA	NA	NA	NA
WP_004221267.1|3947213_3947330_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002913807.1|3947381_3948845_+|protease	beta-barrel assembly-enhancing protease	protease	NA	NA	NA	NA
WP_002913810.1|3948854_3949214_+	arsenate reductase (glutaredoxin)	NA	NA	NA	NA	NA
WP_002913812.1|3949341_3950253_+|transposase	Rpn family recombination-promoting nuclease/putative transposase	transposase	Q2A0A7	Sodalis_phage	58.8	3.5e-74
WP_020947395.1|3950249_3950951_-	DnaA inactivator Hda	NA	NA	NA	NA	NA
WP_002913824.1|3951049_3952336_-	uracil permease	NA	Q9KX94	Enterobacteria_phage	38.1	1.9e-65
WP_002913827.1|3952431_3953058_-	uracil phosphoribosyltransferase	NA	NA	NA	NA	NA
WP_002913829.1|3953275_3954709_-	6-phospho-beta-glucosidase	NA	NA	NA	NA	NA
WP_002913833.1|3954718_3955612_-	ROK family protein	NA	NA	NA	NA	NA
WP_002913836.1|3955875_3956913_+	phosphoribosylformylglycinamidine cyclo-ligase	NA	Q58MH8	Prochlorococcus_phage	44.5	8.2e-72
WP_004152007.1|3956909_3957551_+	phosphoribosylglycinamide formyltransferase	NA	E3SNR5	Prochlorococcus_phage	41.1	1.2e-28
WP_002913838.1|3957731_3959792_+	polyphosphate kinase 1	NA	NA	NA	NA	NA
WP_002913839.1|3959795_3961328_+	exopolyphosphatase	NA	NA	NA	NA	NA
WP_002913841.1|3961381_3963610_-	sensor domain-containing phosphodiesterase	NA	NA	NA	NA	NA
WP_004174861.1|3963980_3964154_+	DUF2633 family protein	NA	G9L6F2	Escherichia_phage	78.8	1.4e-16
WP_004221278.1|3964250_3965162_-	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_002913847.1|3965235_3966468_+	MFS transporter	NA	NA	NA	NA	NA
WP_004162150.1|3966761_3967940_+	anaerobic sulfatase maturase	NA	NA	NA	NA	NA
WP_004152009.1|3967923_3969792_+	sulfatase-like hydrolase/transferase	NA	A0A2P0VMN7	Tetraselmis_virus	22.6	2.6e-07
WP_004200526.1|3970011_3970494_-	DUF2514 domain-containing protein	NA	Q858E9	Salmonella_phage	75.6	1.7e-56
WP_004200527.1|3970490_3971120_-	glycoside hydrolase family 19 protein	NA	Q858F0	Salmonella_phage	79.7	8.4e-96
WP_004200528.1|3971121_3971415_-|holin	phage holin family protein	holin	A0A193GYK3	Enterobacter_phage	82.7	2.4e-37
WP_004200529.1|3971401_3971806_-	integral membrane protein	NA	T1SA79	Salmonella_phage	82.6	3.5e-55
WP_004200530.1|3971983_3972211_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004200531.1|3972220_3974515_-	hypothetical protein	NA	T1S9Y2	Salmonella_phage	55.5	5.8e-78
WP_004200532.1|3974671_3974968_+	hypothetical protein	NA	T1SA06	Salmonella_phage	65.1	2.4e-24
WP_071606113.1|3975066_3975219_+	transmembrane anchored protein	NA	G9L6D9	Escherichia_phage	81.6	4.3e-14
WP_004200533.1|3975253_3975550_-	hypothetical protein	NA	A0A2R9YJP3	Escherichia_phage	94.8	4.4e-47
WP_004200534.1|3975748_3978223_-	phage protein	NA	A0A0F6TK45	Escherichia_coli_O157_typing_phage	86.9	0.0e+00
WP_004200535.1|3978226_3980032_-	hypothetical protein	NA	A0A0F6TJQ3	Escherichia_coli_O157_typing_phage	73.5	3.3e-238
WP_004200536.1|3980028_3982842_-	hypothetical protein	NA	T1SBJ1	Salmonella_phage	92.5	0.0e+00
WP_004200537.1|3982852_3983392_-	hypothetical protein	NA	A0A0F6TJ56	Escherichia_coli_O157_typing_phage	70.9	2.4e-59
WP_004200538.1|3983391_3983856_-	hypothetical protein	NA	Q858G2	Salmonella_phage	81.0	1.3e-69
WP_004200540.1|3983855_3986333_-	hypothetical protein	NA	Q858G3	Salmonella_phage	84.2	0.0e+00
WP_004200541.1|3986332_3986938_-	hypothetical protein	NA	A0A0F6TJN5	Escherichia_coli_O157_typing_phage	79.5	5.1e-90
WP_004200543.1|3986937_3987261_-	hypothetical protein	NA	G9L6C8	Escherichia_phage	84.1	1.2e-45
WP_004200544.1|3987311_3987653_-	hypothetical protein	NA	G9L6C7	Escherichia_phage	70.8	3.1e-36
WP_004200545.1|3987663_3988101_-	hypothetical protein	NA	A0A193GYT9	Enterobacter_phage	93.1	8.8e-68
WP_004200546.1|3988154_3989141_-	hypothetical protein	NA	A0A193GZ49	Enterobacter_phage	94.2	2.5e-179
WP_004200547.1|3989155_3989839_-|protease	endoprotease	protease	G9L6C4	Escherichia_phage	71.6	7.3e-61
WP_004200548.1|3989841_3990138_-	hypothetical protein	NA	T1SBI9	Salmonella_phage	70.4	9.6e-34
WP_004200549.1|3990134_3991817_-|head,tail	head-to-tail-joining protein	head,tail	A0A0F6TJD8	Escherichia_coli_O157_typing_phage	84.4	9.6e-264
WP_004141368.1|3991831_3992038_-	hypothetical protein	NA	T1SA67	Salmonella_phage	88.2	4.8e-08
WP_004200550.1|3992791_3993163_+	hypothetical protein	NA	A0A0F6TJP2	Escherichia_coli_O157_typing_phage	91.9	3.7e-59
WP_004200551.1|3993206_3994682_-	hypothetical protein	NA	Q858H3	Salmonella_phage	92.9	4.9e-280
WP_017896965.1|3994678_3995299_-|terminase	terminase small subunit	terminase	T1SBI8	Salmonella_phage	73.2	9.5e-76
WP_017896964.1|3995356_3995686_-	hypothetical protein	NA	K7PGV5	Enterobacterial_phage	56.1	3.0e-28
WP_004178082.1|3995764_3997252_-	group II intron reverse transcriptase/maturase	NA	A0A0U4J920	Pseudomonas_phage	35.5	1.2e-31
WP_004200555.1|3997672_3998011_-	hypothetical protein	NA	A0A193GYX4	Enterobacter_phage	87.3	4.1e-49
WP_004200556.1|3998010_3998250_-	hypothetical protein	NA	G8C7S3	Escherichia_phage	53.4	2.3e-09
WP_004200557.1|3998242_3998737_-	DUF551 domain-containing protein	NA	A0A193GYX5	Enterobacter_phage	39.4	2.2e-27
WP_004200558.1|3998733_3999012_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004200559.1|3999008_3999389_-	HNH endonuclease	NA	K7P7B7	Enterobacteria_phage	92.8	5.7e-63
WP_004200560.1|3999388_3999859_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004200561.1|3999851_4000115_-	DUF4752 family protein	NA	T1S9K2	Salmonella_phage	72.0	2.0e-27
WP_004200562.1|4000111_4000303_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004200563.1|4000286_4000673_-	hypothetical protein	NA	R9TME7	Aeromonas_phage	44.0	6.7e-11
WP_004200564.1|4000865_4001213_-	DUF1064 domain-containing protein	NA	A0A0F6R8N5	Escherichia_coli_O157_typing_phage	81.7	8.6e-50
WP_004200565.1|4001338_4002109_-	hypothetical protein	NA	G9L6A8	Escherichia_phage	91.7	5.5e-57
WP_004200566.1|4002098_4003073_-	DNA cytosine methyltransferase	NA	Q858D4	Salmonella_phage	65.8	2.3e-140
WP_004152538.1|4003419_4003653_-	hypothetical protein	NA	T1SAR5	Salmonella_phage	66.2	9.2e-24
WP_004200573.1|4003807_4004389_+	helix-turn-helix transcriptional regulator	NA	Q858D7	Salmonella_phage	64.3	1.2e-64
WP_004164037.1|4004617_4004767_+	hypothetical protein	NA	G9L6A5	Escherichia_phage	84.2	7.9e-13
WP_004164029.1|4004763_4005063_+	hypothetical protein	NA	A0A0F6R7M4	Escherichia_coli_O157_typing_phage	54.5	2.1e-20
WP_004200574.1|4005059_4005881_+	PD-(D/E)XK nuclease-like domain-containing protein	NA	A0A193GYK2	Enterobacter_phage	82.1	2.3e-133
WP_004200576.1|4005877_4006759_+	recombinase RecT	NA	T1SBJ5	Salmonella_phage	82.6	3.5e-132
WP_004144294.1|4006807_4007056_+	AlpA family phage regulatory protein	NA	A0A0F6TJ45	Escherichia_coli_O157_typing_phage	78.0	2.8e-31
WP_009485475.1|4007165_4007459_+	PerC family transcriptional regulator	NA	T1S9J5	Salmonella_phage	71.1	4.0e-32
WP_004152545.1|4007451_4007610_+	DUF1317 family protein	NA	T1SAR0	Salmonella_phage	78.8	1.9e-17
WP_071606115.1|4007606_4008113_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004200578.1|4008109_4008706_+	adenine methylase	NA	T1SA14	Salmonella_phage	92.8	1.4e-108
WP_004200579.1|4008702_4008894_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004200581.1|4008910_4010161_-|integrase	tyrosine-type recombinase/integrase	integrase	A0A1X9TCT6	Enterobacter_phage	85.1	6.8e-206
WP_004151979.1|4010353_4011931_-	glutamine-hydrolyzing GMP synthase	NA	NA	NA	NA	NA
WP_004151980.1|4011998_4013465_-	IMP dehydrogenase	NA	A0A1V0SHK8	Klosneuvirus	38.7	1.2e-87
4012454:4012471	attR	CAGCGATAACCGGAATAC	NA	NA	NA	NA
>prophage 11
NZ_CP006659	Klebsiella pneumoniae strain ATCC BAA-2146 chromosome 1	5435746	4084815	4164416	5435746	capsid,plate,portal,lysis,integrase,head,tRNA,tail,terminase	Salmonella_phage(72.0%)	87	4129510:4129556	4166077:4166123
WP_002914079.1|4084815_4085553_-|tRNA	tRNA1(Val) (adenine(37)-N6)-methyltransferase	tRNA	NA	NA	NA	NA
WP_002914082.1|4085684_4087016_+	ATP-dependent RNA helicase SrmB	NA	E3T5E1	Cafeteria_roenbergensis_virus	31.9	6.2e-48
WP_002914084.1|4087061_4087445_-	autonomous glycyl radical cofactor GrcA	NA	A0A193GZ98	Escherichia_phage	79.3	4.0e-32
WP_002914088.1|4087758_4088448_+	uracil-DNA glycosylase	NA	A0A077BCN4	Equid_alphaherpesvirus	53.0	1.3e-57
WP_002914089.1|4088505_4089591_-|tRNA	tRNA/rRNA methyltransferase	tRNA	NA	NA	NA	NA
WP_002914091.1|4089794_4090220_+	thioredoxin TrxC	NA	A0A1J0GW78	Streptomyces_phage	40.2	6.0e-13
WP_002914092.1|4090289_4090988_+	DTW domain-containing protein	NA	NA	NA	NA	NA
WP_004188841.1|4091022_4093674_+	protein lysine acetyltransferase	NA	NA	NA	NA	NA
WP_002914094.1|4093794_4095150_+	CDP-diacylglycerol--serine O-phosphatidyltransferase	NA	NA	NA	NA	NA
WP_002914095.1|4095191_4095515_+	YfiM family lipoprotein	NA	NA	NA	NA	NA
WP_002914097.1|4095518_4096817_-	MFS transporter	NA	Q6JIH2	Burkholderia_virus	31.5	3.1e-44
WP_004150973.1|4102782_4105356_-	ATP-dependent chaperone ClpB	NA	H6X3M6	Enterobacteria_phage	35.4	6.9e-128
WP_002914109.1|4105485_4106217_-	polyphenol oxidase	NA	NA	NA	NA	NA
WP_002914110.1|4106213_4107194_-	23S rRNA pseudouridine(1911/1915/1917) synthase RluD	NA	NA	NA	NA	NA
WP_004145664.1|4107325_4108063_+	outer membrane protein assembly factor BamD	NA	NA	NA	NA	NA
WP_002914111.1|4108333_4108669_+	ribosome-associated translation inhibitor RaiA	NA	NA	NA	NA	NA
WP_100250063.1|4108775_4108823_+	pheA operon leader peptide PheL	NA	NA	NA	NA	NA
WP_004150975.1|4108923_4110084_+	bifunctional chorismate mutase/prephenate dehydratase	NA	NA	NA	NA	NA
WP_002914112.1|4110080_4110953_-	SMP-30/gluconolactonase/LRE family protein	NA	NA	NA	NA	NA
WP_002914113.1|4111015_4112137_-	bifunctional chorismate mutase/prephenate dehydrogenase	NA	NA	NA	NA	NA
WP_002914114.1|4112146_4113217_-	3-deoxy-7-phosphoheptulonate synthase AroF	NA	A0A0F6R6T6	Escherichia_coli_O157_typing_phage	51.5	1.8e-90
WP_004174804.1|4113559_4114069_+	YfiR family protein	NA	NA	NA	NA	NA
WP_002914116.1|4114061_4115285_+	diguanylate cyclase DgcN	NA	NA	NA	NA	NA
WP_002914117.1|4115298_4115781_+	OmpA family protein	NA	NA	NA	NA	NA
WP_002914118.1|4115789_4117160_-	PepSY domain-containing protein	NA	NA	NA	NA	NA
WP_002914119.1|4117216_4117675_-	DUF2946 domain-containing protein	NA	NA	NA	NA	NA
WP_002914145.1|4117794_4118142_-	50S ribosomal protein L19	NA	NA	NA	NA	NA
WP_002914147.1|4118181_4118949_-|tRNA	tRNA (guanosine(37)-N1)-methyltransferase TrmD	tRNA	NA	NA	NA	NA
WP_004150977.1|4118980_4119529_-	ribosome maturation factor RimM	NA	NA	NA	NA	NA
WP_002914149.1|4119547_4119796_-	30S ribosomal protein S16	NA	NA	NA	NA	NA
WP_002914152.1|4120055_4121420_-	signal recognition particle protein	NA	NA	NA	NA	NA
WP_002914153.1|4121583_4122375_+	inner membrane protein YpjD	NA	NA	NA	NA	NA
WP_004149392.1|4122394_4123681_+	HlyC/CorC family transporter	NA	NA	NA	NA	NA
WP_002914155.1|4123800_4124391_-	nucleotide exchange factor GrpE	NA	NA	NA	NA	NA
WP_002914158.1|4124515_4125394_+	NAD(+) kinase	NA	NA	NA	NA	NA
WP_002914159.1|4125480_4127142_+	DNA repair protein RecN	NA	NA	NA	NA	NA
WP_002914160.1|4127289_4127631_+	outer membrane protein assembly factor BamE	NA	NA	NA	NA	NA
WP_002914161.1|4127697_4127988_-	RnfH family protein	NA	NA	NA	NA	NA
WP_004188817.1|4127977_4128454_-	type II toxin-antitoxin system RatA family toxin	NA	NA	NA	NA	NA
WP_002914164.1|4128564_4129047_+	SsrA-binding protein SmpB	NA	W5RAM5	Staphylococcus_phage	47.4	2.3e-29
4129510:4129556	attL	ATGTAGGAATTTCGGACGCGGGTTCAACTCCCGCCAGCTCCACCAAA	NA	NA	NA	NA
WP_004150980.1|4129650_4130028_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004150981.1|4130055_4130274_-	ogr/Delta-like zinc finger family protein	NA	Q53ZE7	Salmonella_virus	72.2	1.9e-26
WP_004150982.1|4130340_4131435_-	phage late control D family protein	NA	E5G6Q3	Salmonella_phage	83.6	2.4e-170
WP_004150983.1|4131431_4131917_-|tail	phage tail protein	tail	E5G6Q2	Salmonella_phage	80.1	5.2e-61
WP_004150984.1|4131913_4134544_-|tail	phage tail tape measure protein	tail	E5FFG5	Burkholderia_phage	41.9	8.9e-115
WP_002896220.1|4134536_4134656_-|tail	GpE family phage tail protein	tail	E5G6Q0	Salmonella_phage	87.2	2.2e-13
WP_004150985.1|4134670_4134970_-|tail	phage tail assembly protein	tail	E5G6P9	Salmonella_phage	78.0	8.2e-33
WP_004150986.1|4135022_4135538_-|tail	phage major tail tube protein	tail	E5G6P8	Salmonella_phage	84.2	1.4e-80
WP_004150987.1|4135547_4136720_-|tail	phage tail sheath protein	tail	A0A1S6KZY7	Salmonella_phage	91.5	3.4e-207
WP_004150988.1|4136868_4137942_-|tail	phage tail protein	tail	A0A1S6KZZ8	Salmonella_phage	53.6	6.6e-40
WP_004200602.1|4137993_4139112_-	hypothetical protein	NA	A0A248XD67	Klebsiella_phage	38.0	4.4e-55
WP_004150990.1|4139121_4141071_-	CotH kinase family protein	NA	Q6QI97	Burkholderia_phage	38.9	1.0e-06
WP_004152935.1|4141072_4141744_-|tail	phage tail protein I	tail	A0A1S6L000	Salmonella_phage	58.9	3.2e-61
WP_004150992.1|4141736_4142645_-|plate	baseplate assembly protein	plate	E5G6N8	Salmonella_phage	68.9	1.9e-109
WP_004150993.1|4142631_4142994_-	GPW/gp25 family protein	NA	A0A1S6KZZ4	Salmonella_phage	85.6	8.4e-48
WP_004150994.1|4142990_4143563_-|plate	phage baseplate assembly protein V	plate	E5G6N6	Salmonella_phage	70.8	1.4e-76
WP_004150995.1|4143657_4144524_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004150996.1|4144546_4144993_-	phage virion morphogenesis protein	NA	A0A1S6L001	Salmonella_phage	72.3	2.5e-54
WP_004150997.1|4144985_4145408_-|tail	phage tail protein	tail	A0A1S6KZY0	Salmonella_phage	83.2	8.2e-63
WP_072093160.1|4145370_4145529_-	hypothetical protein	NA	A0A1S6KZX6	Salmonella_phage	75.0	9.0e-15
WP_004150998.1|4145503_4145932_-|lysis	LysB family phage lysis regulatory protein	lysis	A0A1S6KZX8	Salmonella_phage	82.5	7.1e-54
WP_004150999.1|4145928_4146312_-	hypothetical protein	NA	A0A1S6KZZ2	Salmonella_phage	45.4	1.9e-18
WP_004151000.1|4146316_4146826_-	lysozyme	NA	E5G6N1	Salmonella_phage	85.2	1.6e-81
WP_004134639.1|4146806_4147022_-	hypothetical protein	NA	E5G6N0	Salmonella_phage	88.7	6.1e-30
WP_004151001.1|4147025_4147229_-|tail	tail protein X	tail	E5G6M9	Salmonella_phage	89.6	9.8e-30
WP_004151002.1|4147228_4147693_-|head	head completion/stabilization protein	head	A0A1S6KZW8	Salmonella_phage	85.7	1.5e-73
WP_004134644.1|4147788_4148442_-|terminase	terminase endonuclease subunit	terminase	A0A1S6KZX1	Salmonella_phage	80.0	1.9e-90
WP_004151003.1|4148445_4149498_-|capsid	phage major capsid protein, P2 family	capsid	A0A1S6KZZ3	Salmonella_phage	91.0	6.8e-175
WP_004151004.1|4149514_4150348_-|capsid	GPO family capsid scaffolding protein	capsid	A0A1S6KZW9	Salmonella_phage	77.6	4.4e-100
WP_019405037.1|4150488_4152252_+|terminase	terminase ATPase subunit family protein	terminase	A0A1S6KZW3	Salmonella_phage	91.8	0.0e+00
WP_004151006.1|4152251_4153295_+|portal	phage portal protein	portal	A0A1S6KZW5	Salmonella_phage	85.6	3.1e-172
WP_024940854.1|4153351_4153621_-	hypothetical protein	NA	D2IZW1	Enterococcus_phage	41.3	1.4e-15
WP_004151007.1|4154142_4155144_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004151008.1|4155143_4156223_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004151009.1|4156209_4156893_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004151010.1|4156988_4157222_-	DinI family protein	NA	A0A0M4S6H1	Salmonella_phage	96.1	2.0e-34
WP_004151011.1|4157233_4157422_-	hypothetical protein	NA	A0A1S6L006	Salmonella_phage	90.3	2.2e-23
WP_004200605.1|4157584_4159969_-	replication endonuclease	NA	A0A1S6L028	Salmonella_phage	87.8	0.0e+00
WP_004151013.1|4159965_4160817_-	DNA adenine methylase	NA	A0A1S6L011	Salmonella_phage	75.4	2.2e-115
WP_004151014.1|4160813_4161041_-	TraR/DksA family transcriptional regulator	NA	A0A1S6L007	Salmonella_phage	92.0	5.1e-35
WP_004151016.1|4161040_4161274_-	DUF2732 family protein	NA	A0A1S6L021	Salmonella_phage	90.9	6.0e-31
WP_004144796.1|4161341_4161680_-	DUF5347 domain-containing protein	NA	A0A218M4I7	Erwinia_phage	58.0	6.2e-29
WP_004151017.1|4161643_4161844_-	DUF2724 domain-containing protein	NA	A0A1S6L005	Salmonella_phage	68.8	4.5e-19
WP_004151018.1|4161851_4162361_-	phage regulatory CII family protein	NA	A0A1S6L008	Salmonella_phage	85.8	1.1e-77
WP_001397669.1|4162393_4162636_-	hypothetical protein	NA	A0A1S6KZZ6	Salmonella_phage	98.8	4.0e-38
WP_004151019.1|4162758_4163388_+	phage repressor protein CI	NA	A0A1S6KZZ7	Salmonella_phage	54.5	1.4e-61
WP_004151020.1|4163390_4164416_+|integrase	site-specific integrase	integrase	A0A1S6L016	Salmonella_phage	93.8	1.5e-190
4166077:4166123	attR	ATGTAGGAATTTCGGACGCGGGTTCAACTCCCGCCAGCTCCACCAAA	NA	NA	NA	NA
>prophage 12
NZ_CP006659	Klebsiella pneumoniae strain ATCC BAA-2146 chromosome 1	5435746	4883571	4932414	5435746	capsid,portal,protease,head,tRNA,tail,terminase	uncultured_Caudovirales_phage(68.75%)	56	NA	NA
WP_002918465.1|4883571_4884066_-|protease	ClpXP protease specificity-enhancing factor	protease	A0A1S5R3H3	Pseudomonas_phage	54.8	1.5e-26
WP_002918467.1|4884069_4884708_-	stringent starvation protein A	NA	NA	NA	NA	NA
WP_135801240.1|4884677_4884962_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000829818.1|4885019_4885412_-	30S ribosomal protein S9	NA	NA	NA	NA	NA
WP_002918559.1|4885427_4885856_-	50S ribosomal protein L13	NA	NA	NA	NA	NA
WP_004144945.1|4886121_4887249_-	cell division protein ZapE	NA	NA	NA	NA	NA
WP_002918565.1|4887439_4887838_+	DUF1043 family protein	NA	NA	NA	NA	NA
WP_002918566.1|4888011_4889379_+|protease	serine endoprotease DegQ	protease	A0A1B1IT49	uncultured_Mediterranean_phage	25.3	6.0e-22
WP_002918568.1|4889466_4890525_+	outer membrane-stress sensor serine endopeptidase DegS	NA	NA	NA	NA	NA
WP_002918570.1|4890661_4891600_-	malate dehydrogenase	NA	NA	NA	NA	NA
WP_002918625.1|4892014_4892485_+	transcriptional regulator ArgR	NA	NA	NA	NA	NA
WP_002918626.1|4892860_4893124_+	peroxide/acid stress response protein YhcN	NA	NA	NA	NA	NA
WP_002918627.1|4893222_4893489_+	peroxide/acid stress response protein YhcN	NA	NA	NA	NA	NA
WP_002918629.1|4893539_4893815_-	barstar family protein	NA	NA	NA	NA	NA
WP_002918632.1|4893894_4895862_-	p-hydroxybenzoic acid efflux pump subunit AaeB	NA	NA	NA	NA	NA
WP_002918639.1|4895867_4896800_-	p-hydroxybenzoic acid efflux pump subunit AaeA	NA	NA	NA	NA	NA
WP_002918640.1|4896807_4897011_-	AaeX family protein	NA	NA	NA	NA	NA
WP_002918641.1|4897142_4898072_+	HTH-type transcriptional activator AaeR	NA	NA	NA	NA	NA
WP_002918642.1|4898107_4899553_-|protease	metalloprotease TldD	protease	NA	NA	NA	NA
WP_004150952.1|4899641_4903439_-	AsmA2 domain-containing protein YhdP	NA	NA	NA	NA	NA
WP_002918644.1|4903476_4904946_-	ribonuclease G	NA	NA	NA	NA	NA
WP_002918646.1|4904948_4905530_-	septum formation inhibitor Maf	NA	NA	NA	NA	NA
WP_002918648.1|4905537_4906026_-	rod shape-determining protein MreD	NA	NA	NA	NA	NA
WP_004149974.1|4906025_4907018_-	rod shape-determining protein MreC	NA	NA	NA	NA	NA
WP_002918653.1|4907088_4908132_-	rod shape-determining protein MreB	NA	F2Y0P3	Organic_Lake_phycodnavirus	22.3	6.7e-05
WP_002918686.1|4908437_4910378_-	RNase E specificity factor CsrD	NA	NA	NA	NA	NA
WP_002918687.1|4910457_4910649_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002918688.1|4910877_4911879_+	protein-methionine-sulfoxide reductase catalytic subunit MsrP	NA	NA	NA	NA	NA
WP_002918689.1|4911878_4912487_+	protein-methionine-sulfoxide reductase heme-binding subunit MsrQ	NA	NA	NA	NA	NA
WP_002918732.1|4912710_4913163_+	type II 3-dehydroquinate dehydratase	NA	NA	NA	NA	NA
WP_002918736.1|4913185_4913653_+	acetyl-CoA carboxylase biotin carboxyl carrier protein	NA	NA	NA	NA	NA
WP_002918738.1|4913663_4915013_+	acetyl-CoA carboxylase biotin carboxylase subunit	NA	NA	NA	NA	NA
WP_002918740.1|4915123_4915366_+	YhdT family protein	NA	NA	NA	NA	NA
WP_002918742.1|4915355_4916807_+	sodium/pantothenate symporter	NA	NA	NA	NA	NA
WP_002918745.1|4916818_4917700_+	50S ribosomal protein L11 methyltransferase	NA	NA	NA	NA	NA
WP_004144972.1|4918057_4919023_+|tRNA	tRNA dihydrouridine synthase DusB	tRNA	NA	NA	NA	NA
WP_000462905.1|4919047_4919344_+	DNA-binding transcriptional regulator Fis	NA	NA	NA	NA	NA
WP_004150954.1|4919497_4919689_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004150955.1|4919691_4921353_-|terminase	terminase large subunit	terminase	A0A2H4JB64	uncultured_Caudovirales_phage	98.0	0.0e+00
WP_000113647.1|4921336_4921693_-|terminase	phage terminase small subunit P27 family	terminase	A0A2H4JHS3	uncultured_Caudovirales_phage	99.2	5.5e-60
WP_004150957.1|4921823_4921976_-	hypothetical protein	NA	A0A2H4JCY9	uncultured_Caudovirales_phage	88.0	2.4e-17
WP_004150959.1|4921968_4922412_-	HNH endonuclease	NA	A0A2H4JAS8	uncultured_Caudovirales_phage	91.8	2.8e-77
WP_001547824.1|4922411_4922711_-|head,tail	phage gp6-like head-tail connector protein	head,tail	A0A2H4JD08	uncultured_Caudovirales_phage	80.8	3.4e-39
WP_004150961.1|4922707_4923043_-|head	phage head closure protein	head	A0A2H4JHK5	uncultured_Caudovirales_phage	57.8	3.7e-26
WP_004150962.1|4923039_4924281_-|portal	phage portal protein	portal	A0A2H4JFJ9	uncultured_Caudovirales_phage	96.5	1.0e-230
WP_001547826.1|4924282_4924843_-|head,protease	HK97 family phage prohead protease	head,protease	A0A2H4JB68	uncultured_Caudovirales_phage	95.7	1.2e-98
WP_001549743.1|4924894_4926061_-|capsid	phage major capsid protein	capsid	A0A2H4JED2	uncultured_Caudovirales_phage	95.9	9.8e-207
WP_004150963.1|4926324_4926837_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004150964.1|4926885_4927221_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004150965.1|4927563_4929699_-	DUF927 domain-containing protein	NA	A0A1W6JPG0	Morganella_phage	62.4	3.4e-205
WP_001549749.1|4929698_4930064_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004150966.1|4930060_4930429_-	hypothetical protein	NA	A0A2H4JCX7	uncultured_Caudovirales_phage	81.1	3.7e-51
WP_004150967.1|4930425_4930740_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001549752.1|4930732_4930921_-	hypothetical protein	NA	NA	NA	NA	NA
WP_106918304.1|4930913_4931183_-	host cell division inhibitor Icd-like protein	NA	A0A2H4JGW3	uncultured_Caudovirales_phage	94.4	2.4e-44
WP_004150969.1|4931634_4932414_-	phage antirepressor KilAC domain-containing protein	NA	Q8HA02	Enterobacteria_phage	51.5	6.2e-40
>prophage 1
NZ_CP006663	Klebsiella pneumoniae strain ATCC BAA-2146 plasmid pCuAs, complete sequence	117755	12389	53613	117755	transposase	Escherichia_phage(44.44%)	35	NA	NA
WP_001067855.1|12389_13094_+|transposase	IS6-like element IS26 family transposase	transposase	A0A077SL39	Escherichia_phage	100.0	1.8e-139
WP_001067855.1|13750_14455_+|transposase	IS6-like element IS26 family transposase	transposase	A0A077SL39	Escherichia_phage	100.0	1.8e-139
WP_001137892.1|14683_15268_-	TetR/AcrR family transcriptional regulator	NA	NA	NA	NA	NA
WP_000004159.1|15267_16506_-	MFS transporter	NA	NA	NA	NA	NA
WP_000219391.1|16502_17408_-	Mph(A) family macrolide 2'-phosphotransferase	NA	NA	NA	NA	NA
WP_001067855.1|17529_18234_-|transposase	IS6-like element IS26 family transposase	transposase	A0A077SL39	Escherichia_phage	100.0	1.8e-139
WP_000164043.1|18411_19062_-	tetracycline resistance transcriptional repressor TetR(A)	NA	NA	NA	NA	NA
WP_000804064.1|19167_20367_+	tetracycline efflux MFS transporter Tet(A)	NA	NA	NA	NA	NA
WP_000058717.1|20398_21283_-	EamA family transporter	NA	NA	NA	NA	NA
WP_001214976.1|21420_21828_-	cysteine hydrolase	NA	NA	NA	NA	NA
WP_004200823.1|23626_23935_+	hypothetical protein	NA	K7PKY8	Enterobacterial_phage	31.7	1.1e-08
WP_072141181.1|24111_24591_+	phospholipase D family protein	NA	A0A1B2LRT6	Wolbachia_phage	35.2	1.7e-19
WP_004199332.1|24910_25189_+	replication regulatory protein RepA	NA	NA	NA	NA	NA
WP_099913970.1|25405_25483_+	RepA leader peptide Tap	NA	NA	NA	NA	NA
WP_004200825.1|25475_26333_+	incFII family plasmid replication initiator RepA	NA	NA	NA	NA	NA
WP_004200826.1|27700_27985_+	hypothetical protein	NA	A0A1S6L2Z2	Erwinia_phage	43.2	1.5e-07
WP_004200827.1|27994_28423_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004200832.1|29749_31945_-	DEAD/DEAH box helicase	NA	NA	NA	NA	NA
WP_004152291.1|31941_33258_-	ATP-binding protein	NA	NA	NA	NA	NA
WP_000421673.1|33261_35571_-	TerB N-terminal domain-containing protein	NA	NA	NA	NA	NA
WP_004200835.1|36099_37068_+	phage exclusion protein	NA	NA	NA	NA	NA
WP_004200837.1|37305_38301_-|transposase	IS110 family transposase	transposase	A0A1S7J231	Thermus_phage	29.2	3.5e-19
WP_004200838.1|38808_39357_+	thioredoxin fold domain-containing protein	NA	NA	NA	NA	NA
WP_017896188.1|39966_40851_-	hypothetical protein	NA	NA	NA	NA	NA
WP_077255340.1|41762_42188_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004200841.1|42204_43068_+	toll/interleukin-1 receptor domain-containing protein	NA	NA	NA	NA	NA
WP_004200842.1|43717_45481_-	DUF262 domain-containing protein	NA	C4MZ12	Escherichia_phage	41.3	2.9e-08
WP_001567369.1|46098_46731_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001567368.1|46759_48163_-|transposase	ISNCY-like element ISKpn21 family transposase	transposase	NA	NA	NA	NA
WP_003026803.1|48363_48846_-	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_003026799.1|48833_49100_-	DUF1778 domain-containing protein	NA	NA	NA	NA	NA
WP_001567367.1|49344_49779_-	cell envelope integrity protein TolA	NA	NA	NA	NA	NA
WP_001567366.1|49825_50374_-	thioredoxin fold domain-containing protein	NA	NA	NA	NA	NA
WP_017896554.1|50867_51176_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004201219.1|52074_53613_-|transposase	IS66-like element ISKpn24 family transposase	transposase	A0A0P0ZEB3	Stx2-converting_phage	94.3	5.1e-280
>prophage 1
NZ_CP006662	Klebsiella pneumoniae strain ATCC BAA-2146 plasmid pHg, complete sequence	85161	3923	59658	85161	integrase,transposase	Escherichia_phage(34.62%)	50	6623:6640	13807:13824
WP_004201235.1|3923_5393_-	HNH endonuclease	NA	G0X580	Salmonella_phage	51.3	5.5e-21
WP_001749988.1|6149_6719_-	recombinase family protein	NA	E5FFF9	Burkholderia_phage	43.2	5.2e-36
6623:6640	attL	CCTGATAGATTTGCTCAC	NA	NA	NA	NA
WP_000845048.1|7111_8125_-|integrase	class 1 integron integrase IntI1	integrase	A0A1P8DJJ6	Virus_Rctr41k	45.5	1.0e-71
WP_004201280.1|8280_8754_+	trimethoprim-resistant dihydrofolate reductase DfrA14	NA	G3MBI7	Bacillus_virus	28.9	8.4e-16
WP_001144737.1|8974_9241_+	plasmid mobilization relaxosome protein MobC	NA	NA	NA	NA	NA
WP_001389365.1|9383_10148_+|transposase	IS6-like element IS6100 family transposase	transposase	A0A077SL39	Escherichia_phage	65.7	4.3e-86
WP_004098817.1|10408_11623_+	type II site-specific deoxyribonuclease	NA	E5E3X4	Burkholderia_phage	42.5	1.2e-34
WP_072094655.1|11656_13060_-	DNA cytosine methyltransferase	NA	E5E3X6	Burkholderia_phage	50.6	9.0e-106
WP_001749967.1|13471_13678_-	hypothetical protein	NA	NA	NA	NA	NA
WP_071549088.1|13682_14195_-	restriction endonuclease	NA	NA	NA	NA	NA
13807:13824	attR	GTGAGCAAATCTATCAGG	NA	NA	NA	NA
WP_001067855.1|14219_14924_+|transposase	IS6-like element IS26 family transposase	transposase	A0A077SL39	Escherichia_phage	100.0	1.8e-139
WP_001039463.1|15675_16062_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000861580.1|16070_16262_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000807690.1|17273_18029_+	replication initiation protein RepE	NA	I3WF20	Macacine_betaherpesvirus	96.0	4.5e-136
WP_011977766.1|19446_19782_-	C2H2-type zinc finger protein	NA	NA	NA	NA	NA
WP_001568067.1|19954_20236_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000176305.1|20289_20901_+	DUF2913 family protein	NA	NA	NA	NA	NA
WP_001067855.1|21049_21754_-|transposase	IS6-like element IS26 family transposase	transposase	A0A077SL39	Escherichia_phage	100.0	1.8e-139
WP_004201265.1|22548_22866_-	thiosulfate sulfurtransferase PspE	NA	NA	NA	NA	NA
WP_003833267.1|23312_23543_-	phage shock protein PspD	NA	NA	NA	NA	NA
WP_003020497.1|23551_23911_-	envelope stress response membrane protein PspC	NA	NA	NA	NA	NA
WP_003020509.1|23910_24135_-	envelope stress response membrane protein PspB	NA	NA	NA	NA	NA
WP_003020532.1|24189_24858_-	phage shock protein PspA	NA	NA	NA	NA	NA
WP_017896601.1|25013_26003_+	phage shock protein operon transcriptional activator	NA	NA	NA	NA	NA
WP_004201260.1|26097_26742_+	quinolone resistance pentapeptide repeat protein QnrB9	NA	NA	NA	NA	NA
WP_025403922.1|26783_27218_-	SgcJ/EcaC family oxidoreductase	NA	NA	NA	NA	NA
WP_003031976.1|27411_27816_+	IS66 family insertion sequence hypothetical protein	NA	A0A0P0ZCV4	Stx2-converting_phage	98.5	4.3e-69
WP_000612626.1|27812_28160_+	IS66 family insertion sequence element accessory protein TnpB	NA	A0A0P0ZDM8	Stx2-converting_phage	100.0	2.6e-62
WP_004201219.1|28208_29747_+|transposase	IS66-like element ISKpn24 family transposase	transposase	A0A0P0ZEB3	Stx2-converting_phage	94.3	5.1e-280
WP_002903955.1|34364_35267_-	NAD(P)-dependent oxidoreductase	NA	A0A077SLF7	Escherichia_phage	99.7	2.6e-159
WP_002210513.1|35528_36290_+	DeoR/GlpR transcriptional regulator	NA	A0A077SK06	Escherichia_phage	100.0	1.9e-134
WP_064767615.1|36310_37171_-	SHV family class A beta-lactamase	NA	A0A077SL40	Escherichia_phage	99.0	8.4e-155
WP_001067855.1|37307_38012_+|transposase	IS6-like element IS26 family transposase	transposase	A0A077SL39	Escherichia_phage	100.0	1.8e-139
WP_063840321.1|38155_38710_+	fluoroquinolone-acetylating aminoglycoside 6'-N-acetyltransferase AAC(6')-Ib-cr5	NA	NA	NA	NA	NA
WP_001334766.1|38840_39671_+	oxacillin-hydrolyzing class D beta-lactamase OXA-1	NA	NA	NA	NA	NA
WP_001067855.1|40302_41007_-|transposase	IS6-like element IS26 family transposase	transposase	A0A077SL39	Escherichia_phage	100.0	1.8e-139
WP_000557452.1|41113_41974_+	aminoglycoside N-acetyltransferase AAC(3)-IIe	NA	NA	NA	NA	NA
WP_002063889.1|41986_42529_+	AAA family ATPase	NA	NA	NA	NA	NA
WP_001067855.1|43722_44427_-|transposase	IS6-like element IS26 family transposase	transposase	A0A077SL39	Escherichia_phage	100.0	1.8e-139
WP_001393253.1|46748_47081_+	cupin fold metalloprotein, WbuC family	NA	NA	NA	NA	NA
WP_000239590.1|47127_48003_-	class A extended-spectrum beta-lactamase CTX-M-15	NA	A0A1B0VBP7	Salmonella_phage	82.4	1.1e-125
WP_000608644.1|48258_49521_-|transposase	IS1380-like element ISEc9 family transposase	transposase	A0A1B0VDR3	Salmonella_phage	100.0	1.3e-39
WP_001235713.1|50084_50642_+	recombinase family protein	NA	Q1MVP4	Enterobacteria_phage	100.0	7.0e-94
WP_000027057.1|50824_51685_+	class A broad-spectrum beta-lactamase TEM-1	NA	Q1MVP3	Enterobacteria_phage	100.0	4.6e-161
WP_000480968.1|52405_53242_-	aminoglycoside O-phosphotransferase APH(6)-Id	NA	NA	NA	NA	NA
WP_001082319.1|53241_54045_-	aminoglycoside O-phosphotransferase APH(3'')-Ib	NA	NA	NA	NA	NA
WP_001043260.1|54105_54921_-	sulfonamide-resistant dihydropteroate synthase Sul2	NA	A0A0B5J4J5	Pandoravirus	27.6	5.9e-09
WP_000954592.1|55250_55427_+	DUF4102 domain-containing protein	NA	T1S9J3	Salmonella_phage	68.6	1.0e-06
WP_000427619.1|55608_56613_-|transposase	IS110-like element IS5075 family transposase	transposase	NA	NA	NA	NA
WP_001138070.1|56691_59658_-|transposase	Tn3 family transposase	transposase	A0A1B0V7H9	Salmonella_phage	72.9	0.0e+00
>prophage 2
NZ_CP006662	Klebsiella pneumoniae strain ATCC BAA-2146 plasmid pHg, complete sequence	85161	64865	77394	85161	integrase	Escherichia_phage(33.33%)	13	72535:72548	83934:83947
WP_001776119.1|64865_65393_+	phospholipase D family protein	NA	A0A1B2LRT6	Wolbachia_phage	39.5	5.7e-21
WP_001776120.1|65425_65857_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001776122.1|66336_67302_-	DUF1738 domain-containing protein	NA	A0A1V0EEV1	Caulobacter_phage	42.7	1.6e-58
WP_004178082.1|67771_69259_-	group II intron reverse transcriptase/maturase	NA	A0A0U4J920	Pseudomonas_phage	35.5	1.2e-31
WP_000776034.1|69664_70096_+	translesion error-prone DNA polymerase V autoproteolytic subunit	NA	A0A1W6JNS2	Morganella_phage	53.3	1.6e-29
WP_004118291.1|70095_71367_+	Y-family DNA polymerase	NA	F1C5A5	Cronobacter_phage	63.3	4.9e-151
WP_000064120.1|71448_72423_-	ParB/RepB/Spo0J family partition protein	NA	Q38420	Escherichia_phage	54.4	2.6e-88
WP_000368714.1|72422_73628_-	AAA family ATPase	NA	A0A077SL49	Escherichia_phage	69.6	2.4e-163
72535:72548	attL	GCTGGATTTGCTGA	NA	NA	NA	NA
WP_000339857.1|74042_74312_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004118283.1|74668_75535_-	replication initiation protein	NA	A0A222YYK1	Escherichia_phage	31.1	1.5e-23
WP_032409716.1|76069_76174_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000764642.1|76302_76560_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000015958.1|76617_77394_-|integrase	phage integrase family protein	integrase	I3WFA4	Macacine_betaherpesvirus	92.9	6.4e-53
83934:83947	attR	TCAGCAAATCCAGC	NA	NA	NA	NA
