The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
NC_020819	Lactobacillus brevis KB290, complete genome	2395134	752995	796752	2395134	integrase,transposase	Paenibacillus_phage(15.38%)	40	761315:761374	791643:792685
WP_096109514.1|752995_753771_-|transposase	IS5 family transposase	transposase	A0A0N9SHJ4	Paenibacillus_phage	54.1	5.4e-28
WP_015473470.1|753858_755244_+	class II fumarate hydratase	NA	NA	NA	NA	NA
WP_015473471.1|755571_756927_+	M20/M25/M40 family metallo-hydrolase	NA	NA	NA	NA	NA
WP_015473472.1|757136_758156_+	LacI family DNA-binding transcriptional regulator	NA	NA	NA	NA	NA
WP_041815225.1|758388_759135_+	hypothetical protein	NA	NA	NA	NA	NA
WP_041815230.1|759188_760184_+	DMT family transporter	NA	NA	NA	NA	NA
WP_015473475.1|760197_761247_+	linear amide C-N hydrolase	NA	M1H001	Paramecium_bursaria_Chlorella_virus	27.1	9.6e-28
761315:761374	attL	GGTAGATTGTAAAATTAATCCGAACGCTGTTCGGACAAAAAAGATCAGCTTCCTTTAAAA	NA	NA	NA	NA
WP_015473476.1|761413_762343_+|transposase	IS30-like element ISLpl1 family transposase	transposase	H7BW61	unidentified_phage	29.9	8.5e-20
WP_015473477.1|762404_763637_-	arginine deiminase	NA	NA	NA	NA	NA
WP_015473478.1|764038_764689_-	hypothetical protein	NA	NA	NA	NA	NA
WP_015473481.1|765892_767047_-|integrase	site-specific integrase	integrase	S6C485	Thermus_phage	36.3	5.0e-54
WP_041815232.1|767104_767929_-	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_015473483.1|768071_768308_+	hypothetical protein	NA	NA	NA	NA	NA
WP_015473484.1|768319_768997_+	Rha family transcriptional regulator	NA	A0A192Y918	Salmonella_phage	29.4	6.2e-12
WP_041815234.1|769010_769295_+	hypothetical protein	NA	NA	NA	NA	NA
WP_041815237.1|769605_769962_+	hypothetical protein	NA	NA	NA	NA	NA
WP_015473487.1|769954_770269_+	hypothetical protein	NA	NA	NA	NA	NA
WP_015473488.1|770261_770486_+	hypothetical protein	NA	NA	NA	NA	NA
WP_015473489.1|770488_771277_+	bifunctional DNA primase/polymerase	NA	A0A060ADS5	Enterococcus_phage	33.6	1.4e-18
WP_015473490.1|771281_772691_+	virulence-associated E family protein	NA	A0A2I6PF19	Staphylococcus_phage	37.7	3.8e-72
WP_015473491.1|772928_773303_+	hypothetical protein	NA	NA	NA	NA	NA
WP_041815240.1|773308_773653_+	hypothetical protein	NA	NA	NA	NA	NA
WP_015473493.1|773649_774063_+	hypothetical protein	NA	NA	NA	NA	NA
WP_051053370.1|775775_776171_-	DUF1093 domain-containing protein	NA	NA	NA	NA	NA
WP_024525558.1|777063_777798_+	response regulator transcription factor	NA	W8CYM9	Bacillus_phage	36.4	9.7e-35
WP_015473494.1|777794_779264_+	HAMP domain-containing histidine kinase	NA	A0A1V0SGX0	Hokovirus	30.8	1.9e-21
WP_015473495.1|779322_780471_+	class I SAM-dependent rRNA methyltransferase	NA	NA	NA	NA	NA
WP_015473496.1|780653_781520_+	sugar uptake protein	NA	NA	NA	NA	NA
WP_011667989.1|781649_782996_+	glucose-6-phosphate isomerase	NA	NA	NA	NA	NA
WP_015473497.1|783283_786301_+	YfhO family protein	NA	NA	NA	NA	NA
WP_015473498.1|786666_787221_-	tryptophan-rich sensory protein	NA	NA	NA	NA	NA
WP_011667986.1|787326_787890_+	DUF1211 domain-containing protein	NA	NA	NA	NA	NA
WP_011667984.1|788574_789540_+	VIP2 family actin-ADP-ribosylating toxin	NA	NA	NA	NA	NA
WP_011667983.1|789678_790782_-	anion permease	NA	NA	NA	NA	NA
WP_011667982.1|790851_791514_-	EAL domain-containing protein	NA	NA	NA	NA	NA
WP_015473476.1|791741_792671_+|transposase	IS30-like element ISLpl1 family transposase	transposase	H7BW61	unidentified_phage	29.9	8.5e-20
WP_107696654.1|793124_793919_+	GGDEF domain-containing protein	NA	A0A127AWB9	Bacillus_phage	32.3	7.5e-17
791643:792685	attR	GGTAGATTGTAAAATTAATCCGAACGCTGTTCGGACAAAAAAGATCAGCTTCCTTTAAAATGGTGTTTACCACAAACCCATCTTTTAGGAGCTGATCTTTTGTCTAGTATAACCTATTCCGAACGAATTAAAATCGAAACCTTTTGTGAACTAGGGCTGTCCAATATCCAAATGGGCGTTCGGCTGAACCGATCACCGTCAACAATTTCTTATGAATTATCTCGATGTCAACCTTATCAGGCTGAATTAGCACAAACAGATGCCGAATACAAGCGATCACGATGTGGTCGGAAAACTAAGCTGAGCGATGAGTTAAAGCAAAAAATTCTCAACCATTTACGTCTAAGCTGGTCACCAGGAATGATTGCTCACGAATTTAAACTAGCTACTAAATCTATTTATAATTGGCTAAATCAGGGGAGAATTGATTTCTCCTTGAATGATCTACCTGAACATGGCGTACGCCAACGGCGTAACGTTGACCAACGATCCAAATATAATCAATCTTTGGGGCGATCAATTGAACAGCGTCCCATGATGATTAATCAACGTAATCGCATCGGCGATTTTGAACTAGATACAGTCGTTGGTCCTCGTGGGCATAGTAAGGCAGTTTTATTAACTTTAATCGATCGCAAATCACGGTTCCTTTGGGCATACCGGTTAAAAGATCGGACGACAGCGACTGTTAATGAAGCACTAACTAAGTTCCTAACCACTTTTAATGGTCCGGTGCACAGCTTTACTGTGGACCGTGGCACTGAGTTTAGTGGGCTAGTATCACTTGAATCACAATATGGTATTAAGACCTATTACTGCCATGCTTATACGCCAGCTGAACGTGGTAGTAATGAACGCTTTAATCGGAATTTACGTTATTTTTATCCTAAAGGGACTCGTTTTGAGCACATTAGTGCTCAAGATTTAACGACGACGTTACTCCAAATTAACCAGCGACCGCTTAAAATACTCGACTGGCAAACACCGTATCAGGTTATGCTGACAAATTTGTCCAAAAATTCGGATTAAATTTGCAATCTACC	NA	NA	NA	NA
WP_011667978.1|793997_794204_+	hypothetical protein	NA	NA	NA	NA	NA
WP_041815243.1|794266_795529_-|transposase	ISL3 family transposase	transposase	A0A1S5SBP9	Streptococcus_phage	31.4	8.5e-47
WP_096109514.1|795976_796752_-|transposase	IS5 family transposase	transposase	A0A0N9SHJ4	Paenibacillus_phage	54.1	5.4e-28
>prophage 2
NC_020819	Lactobacillus brevis KB290, complete genome	2395134	1200747	1209833	2395134	tRNA,transposase	Staphylococcus_phage(28.57%)	8	NA	NA
WP_015473476.1|1200747_1201677_-|transposase	IS30-like element ISLpl1 family transposase	transposase	H7BW61	unidentified_phage	29.9	8.5e-20
WP_024855005.1|1202417_1202909_-	dihydrofolate reductase	NA	A0A0N9S8H6	Staphylococcus_phage	37.8	1.5e-23
WP_015473768.1|1202925_1203876_-	thymidylate synthase	NA	A0A0N9SH48	Staphylococcus_phage	62.1	2.0e-117
WP_011667557.1|1203887_1205780_-	ABC-F family ATP-binding cassette domain-containing protein	NA	A0A2K9L0W2	Tupanvirus	29.3	6.1e-49
WP_024855004.1|1205808_1207002_-|tRNA	CCA tRNA nucleotidyltransferase	tRNA	G3MAR3	Bacillus_virus	40.2	1.9e-35
WP_042254316.1|1207177_1208074_+	YitT family protein	NA	M1Q1P6	Streptococcus_phage	38.8	1.6e-52
WP_041815344.1|1208192_1209452_-	tetratricopeptide repeat protein	NA	NA	NA	NA	NA
WP_011667553.1|1209557_1209833_-	HU family DNA-binding protein	NA	A0A0H3UZA0	Geobacillus_virus	68.5	3.1e-26
>prophage 3
NC_020819	Lactobacillus brevis KB290, complete genome	2395134	1263791	1324292	2395134	tRNA,integrase,protease,transposase	Bacillus_phage(11.76%)	58	1288579:1288593	1318548:1318562
WP_087609254.1|1263791_1264691_-|transposase	IS3 family transposase	transposase	A0A1B1P773	Bacillus_phage	35.8	2.4e-43
WP_015473803.1|1264687_1265221_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_015473804.1|1265309_1265951_-	HAD-IA family hydrolase	NA	NA	NA	NA	NA
WP_041815352.1|1266062_1266506_-|tRNA	D-tyrosyl-tRNA(Tyr) deacylase	tRNA	NA	NA	NA	NA
WP_015473806.1|1266525_1268760_-	bifunctional (p)ppGpp synthetase/guanosine-3',5'-bis(diphosphate) 3'-pyrophosphohydrolase	NA	S4TRQ0	Salmonella_phage	43.6	6.2e-08
WP_011667501.1|1268788_1269124_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011667500.1|1269191_1269944_-	16S rRNA (uracil(1498)-N(3))-methyltransferase	NA	NA	NA	NA	NA
WP_011667499.1|1269946_1270897_-	50S ribosomal protein L11 methyltransferase	NA	NA	NA	NA	NA
WP_051053372.1|1270999_1271317_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011667497.1|1271656_1272040_+	large-conductance mechanosensitive channel protein MscL	NA	NA	NA	NA	NA
WP_015473808.1|1272263_1272626_+	hypothetical protein	NA	NA	NA	NA	NA
WP_011667495.1|1273121_1273373_+	hypothetical protein	NA	NA	NA	NA	NA
WP_041815355.1|1273874_1275056_-	class I SAM-dependent methyltransferase	NA	NA	NA	NA	NA
WP_011667492.1|1275674_1276034_+	hypothetical protein	NA	NA	NA	NA	NA
WP_080628783.1|1276076_1276244_-	DUF3923 family protein	NA	NA	NA	NA	NA
WP_015473476.1|1276244_1277174_-|transposase	IS30-like element ISLpl1 family transposase	transposase	H7BW61	unidentified_phage	29.9	8.5e-20
WP_015473810.1|1277948_1279781_-	elongation factor 4	NA	E4ZFJ7	Streptococcus_phage	27.5	8.6e-24
WP_024855607.1|1279961_1281251_-	D-alanyl-lipoteichoic acid biosynthesis protein DltD	NA	NA	NA	NA	NA
WP_011667999.1|1281254_1281488_-	D-alanine--poly(phosphoribitol) ligase subunit DltC	NA	NA	NA	NA	NA
WP_011668000.1|1281525_1282734_-	D-alanyl-lipoteichoic acid biosynthesis protein DltB	NA	A0A125RNP0	Pseudomonas_phage	27.8	1.1e-22
WP_015473813.1|1282733_1284260_-	D-alanine--poly(phosphoribitol) ligase subunit DltA	NA	A0A2K9KZV5	Tupanvirus	28.1	1.1e-37
WP_011668002.1|1284299_1284449_-	teichoic acid D-Ala incorporation-associated protein DltX	NA	NA	NA	NA	NA
WP_015473814.1|1284748_1285897_-	molecular chaperone DnaJ	NA	M1PC06	Moumouvirus	28.3	5.4e-16
WP_041815358.1|1286013_1287873_-	molecular chaperone DnaK	NA	A0A2P1EIW2	Megavirus	46.2	2.8e-131
WP_011668005.1|1287912_1288497_-	nucleotide exchange factor GrpE	NA	NA	NA	NA	NA
WP_011668006.1|1288517_1289555_-	heat-inducible transcriptional repressor HrcA	NA	NA	NA	NA	NA
1288579:1288593	attL	CCAACAATTCCCAAC	NA	NA	NA	NA
WP_011668007.1|1289806_1290754_-	riboflavin biosynthesis protein RibF	NA	NA	NA	NA	NA
WP_011668008.1|1290774_1291686_-|tRNA	tRNA pseudouridine(55) synthase TruB	tRNA	NA	NA	NA	NA
WP_011668009.1|1291766_1292117_-	30S ribosome-binding factor RbfA	NA	NA	NA	NA	NA
WP_015473817.1|1292136_1294479_-	translation initiation factor IF-2	NA	A0A2H4UTS4	Bodo_saltans_virus	24.4	5.1e-21
WP_011668011.1|1294526_1294829_-	ribosomal L7Ae/L30e/S12e/Gadd45 family protein	NA	NA	NA	NA	NA
WP_011668012.1|1294821_1295118_-	YlxR family protein	NA	NA	NA	NA	NA
WP_011668013.1|1295144_1296350_-	transcription termination/antitermination protein NusA	NA	NA	NA	NA	NA
WP_011668014.1|1296373_1296847_-	ribosome maturation factor RimP	NA	NA	NA	NA	NA
WP_011668015.1|1296973_1297249_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011668016.1|1297397_1301735_-	PolC-type DNA polymerase III	NA	A0A0K2SUJ2	Clostridium_phage	37.6	1.0e-19
WP_011668017.1|1301826_1303536_-|tRNA	proline--tRNA ligase	tRNA	NA	NA	NA	NA
WP_015473823.1|1303571_1304849_-|protease	RIP metalloprotease RseP	protease	NA	NA	NA	NA
WP_011668019.1|1304944_1305736_-	phosphatidate cytidylyltransferase	NA	NA	NA	NA	NA
WP_041815361.1|1305757_1306546_-	isoprenyl transferase	NA	R9W0U9	Flavobacterium_phage	41.0	4.5e-22
WP_011668021.1|1306648_1307071_-	hypothetical protein	NA	NA	NA	NA	NA
WP_024855604.1|1307097_1307661_-	ribosome recycling factor	NA	NA	NA	NA	NA
WP_011668022.1|1307657_1308380_-	UMP kinase	NA	NA	NA	NA	NA
WP_011668023.1|1308526_1309411_-	elongation factor Ts	NA	NA	NA	NA	NA
WP_011668024.1|1309560_1310364_-	30S ribosomal protein S2	NA	NA	NA	NA	NA
WP_041815364.1|1310780_1312226_-|integrase,transposase	DDE-type integrase/transposase/recombinase	integrase,transposase	A0A1X9I6E7	Streptococcus_phage	27.7	1.5e-07
WP_011668025.1|1312369_1313089_+	HAD family hydrolase	NA	NA	NA	NA	NA
WP_011668026.1|1313211_1314210_-	D-2-hydroxyacid dehydrogenase	NA	A0A1J0F959	Only_Syngen_Nebraska_virus	35.5	3.7e-45
WP_041815367.1|1314293_1314563_-	GIY-YIG nuclease family protein	NA	NA	NA	NA	NA
WP_041815370.1|1314549_1315296_-|tRNA	tRNA1(Val) (adenine(37)-N6)-methyltransferase	tRNA	NA	NA	NA	NA
WP_051053373.1|1315364_1316033_+	1-acyl-sn-glycerol-3-phosphate acyltransferase	NA	NA	NA	NA	NA
WP_015473831.1|1316093_1317890_-	ABC transporter ATP-binding protein	NA	W8CYL7	Bacillus_phage	26.1	1.1e-44
WP_011668031.1|1319786_1320011_-	YneF family protein	NA	NA	NA	NA	NA
1318548:1318562	attR	CCAACAATTCCCAAC	NA	NA	NA	NA
WP_011668032.1|1320110_1320359_-	DUF896 domain-containing protein	NA	NA	NA	NA	NA
WP_024855599.1|1320541_1321171_+	transcriptional repressor LexA	NA	A0A1B2APZ1	Phage_Wrath	50.7	1.6e-14
WP_015473837.1|1321210_1321651_-	nucleoside 2-deoxyribosyltransferase	NA	A0A1D3SPR3	Enterococcus_phage	38.6	2.0e-19
WP_041815372.1|1321877_1322468_+	hypothetical protein	NA	NA	NA	NA	NA
WP_015473839.1|1322618_1324292_+|transposase	IS1182 family transposase	transposase	A0ZS58	Staphylococcus_virus	40.1	3.7e-90
>prophage 4
NC_020819	Lactobacillus brevis KB290, complete genome	2395134	1429080	1488893	2395134	tRNA,protease,transposase	unidentified_phage(18.18%)	56	NA	NA
WP_041815392.1|1429080_1430004_+|transposase	IS30 family transposase	transposase	H7BVY4	unidentified_phage	29.8	1.5e-29
WP_011668196.1|1430371_1431271_-	RluA family pseudouridine synthase	NA	NA	NA	NA	NA
WP_021740943.1|1431267_1432071_-	NAD kinase	NA	NA	NA	NA	NA
WP_011668198.1|1432072_1432732_-	GTP pyrophosphokinase family protein	NA	NA	NA	NA	NA
WP_011668199.1|1433045_1433684_+	DsbA family protein	NA	NA	NA	NA	NA
WP_041815395.1|1433845_1434709_+	DegV family protein	NA	NA	NA	NA	NA
WP_015473911.1|1434762_1436568_-	oligoendopeptidase F	NA	NA	NA	NA	NA
WP_015473912.1|1436634_1437729_-	hypothetical protein	NA	NA	NA	NA	NA
WP_015473913.1|1437855_1438503_-|tRNA	tRNA (guanosine(46)-N7)-methyltransferase TrmB	tRNA	NA	NA	NA	NA
WP_041815397.1|1438568_1439360_-	phosphotransferase family protein	NA	NA	NA	NA	NA
WP_011668205.1|1439421_1440648_-	ABC transporter permease	NA	NA	NA	NA	NA
WP_011668206.1|1440644_1441379_-	ABC transporter ATP-binding protein	NA	A0A2H4PQG7	Staphylococcus_phage	28.3	8.5e-23
WP_011668207.1|1441588_1442047_+	HIT family protein	NA	NA	NA	NA	NA
WP_015473917.1|1442049_1442370_+	hypothetical protein	NA	NA	NA	NA	NA
WP_011668209.1|1442482_1443400_+	peptidylprolyl isomerase	NA	NA	NA	NA	NA
WP_015473919.1|1443463_1444438_-	TraI domain-containing protein	NA	NA	NA	NA	NA
WP_015473920.1|1444450_1447075_-	AAA family ATPase	NA	NA	NA	NA	NA
WP_041815870.1|1447064_1448279_-	DNA repair exonuclease	NA	NA	NA	NA	NA
WP_015473922.1|1448361_1448706_-	YlbF family regulator	NA	NA	NA	NA	NA
WP_011668214.1|1448796_1450893_-	PBP1A family penicillin-binding protein	NA	NA	NA	NA	NA
WP_011668215.1|1451058_1451526_-	arginine repressor	NA	NA	NA	NA	NA
WP_011668216.1|1451760_1453452_-|tRNA	arginine--tRNA ligase	tRNA	A0A2I2L3K1	Orpheovirus	32.0	7.6e-75
WP_011668217.1|1453923_1454145_-	DUF2187 domain-containing protein	NA	NA	NA	NA	NA
WP_011668218.1|1454478_1455738_+	N-acetylmuramoyl-L-alanine amidase	NA	A0A2H4JAS1	uncultured_Caudovirales_phage	40.0	1.8e-17
WP_011668219.1|1455798_1456332_+	dihydrofolate reductase family protein	NA	NA	NA	NA	NA
WP_011668220.1|1456398_1456740_+	YisL family protein	NA	NA	NA	NA	NA
WP_011666857.1|1456993_1457917_+|transposase	IS30 family transposase	transposase	H7BVY4	unidentified_phage	30.4	6.2e-31
WP_011668221.1|1458011_1458725_-	amino acid racemase	NA	NA	NA	NA	NA
WP_041815400.1|1458731_1459988_-	carboxylate--amine ligase	NA	NA	NA	NA	NA
WP_011668223.1|1460122_1462006_-	asparagine synthase (glutamine-hydrolyzing)	NA	NA	NA	NA	NA
WP_041815402.1|1462149_1462848_-	Crp/Fnr family transcriptional regulator	NA	NA	NA	NA	NA
WP_011668225.1|1462986_1464396_+	C69 family dipeptidase	NA	NA	NA	NA	NA
WP_011668226.1|1464465_1464702_+	hypothetical protein	NA	NA	NA	NA	NA
WP_011668227.1|1464849_1466652_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011668228.1|1467203_1467455_-	hypothetical protein	NA	NA	NA	NA	NA
WP_015473928.1|1468190_1470701_-	excinuclease ABC subunit UvrA	NA	A0A1B1IVR3	uncultured_Mediterranean_phage	32.4	1.3e-139
WP_087609254.1|1470906_1471806_-|transposase	IS3 family transposase	transposase	A0A1B1P773	Bacillus_phage	35.8	2.4e-43
WP_015473803.1|1471802_1472336_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_011668232.1|1472614_1472908_-	heavy metal-binding domain-containing protein	NA	NA	NA	NA	NA
WP_015473929.1|1472898_1473417_-	VanZ family protein	NA	NA	NA	NA	NA
WP_015473930.1|1473972_1474449_+	MarR family transcriptional regulator	NA	NA	NA	NA	NA
WP_107696657.1|1474499_1475123_-|protease	CPBP family intramembrane metalloprotease	protease	NA	NA	NA	NA
WP_011668236.1|1475488_1475734_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011668237.1|1475883_1476846_+	NAD(P)-binding domain-containing protein	NA	A0A1B1IVB5	uncultured_Mediterranean_phage	29.0	8.2e-26
WP_011668238.1|1477065_1479780_+	glycoside hydrolase family 65 protein	NA	NA	NA	NA	NA
WP_011668239.1|1479792_1480464_+	beta-phosphoglucomutase	NA	NA	NA	NA	NA
WP_011668240.1|1480518_1481289_-	Cof-type HAD-IIB family hydrolase	NA	NA	NA	NA	NA
WP_011668241.1|1481442_1482090_+	deoxynucleoside kinase	NA	C1KFI3	Lactobacillus_virus	45.9	9.1e-45
WP_011668242.1|1482137_1482464_-	DUF960 domain-containing protein	NA	NA	NA	NA	NA
WP_011668243.1|1482537_1484013_-	MFS transporter	NA	NA	NA	NA	NA
WP_015473935.1|1484218_1485406_-	methionine adenosyltransferase	NA	A0A2H4PQS6	Staphylococcus_phage	69.4	9.5e-149
WP_011668245.1|1485649_1486357_+	hypothetical protein	NA	NA	NA	NA	NA
WP_011668246.1|1486463_1486826_+	hypothetical protein	NA	NA	NA	NA	NA
WP_011668247.1|1486853_1487423_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011668248.1|1487629_1487953_+	heavy metal-binding domain-containing protein	NA	M4STD1	Rhodobacter_phage	35.6	1.2e-05
WP_011668249.1|1488323_1488893_+|protease	matrixin family metalloprotease	protease	NA	NA	NA	NA
>prophage 5
NC_020819	Lactobacillus brevis KB290, complete genome	2395134	1660024	1745673	2395134	tail,transposase,tRNA,terminase,capsid,protease,plate,holin	Lactobacillus_phage(73.17%)	86	NA	NA
WP_015474035.1|1660024_1662511_-|protease	ATP-dependent Clp protease ATP-binding subunit	protease	K4FB40	Cronobacter_phage	39.7	4.0e-125
WP_015474036.1|1662528_1662996_-	CtsR family transcriptional regulator	NA	NA	NA	NA	NA
WP_021741310.1|1664315_1665587_-|tRNA	serine--tRNA ligase	tRNA	A0A1B1IVT2	uncultured_Mediterranean_phage	48.1	3.2e-86
WP_024526557.1|1665870_1666503_-	deoxynucleoside kinase	NA	C1KFI3	Lactobacillus_virus	47.7	2.6e-52
WP_035465420.1|1666819_1668082_+|transposase	ISL3 family transposase	transposase	A0A1S5SBP9	Streptococcus_phage	31.9	2.9e-47
WP_024526556.1|1668155_1669655_-	amino acid permease	NA	NA	NA	NA	NA
WP_015474041.1|1670004_1670559_-	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_015474042.1|1670642_1671437_+	alpha/beta hydrolase	NA	NA	NA	NA	NA
WP_011668516.1|1671540_1672209_-	phosphatase PAP2 family protein	NA	NA	NA	NA	NA
WP_021741305.1|1672320_1672770_-	threonine/serine exporter family protein	NA	NA	NA	NA	NA
WP_011668518.1|1672786_1673548_-	threonine/serine exporter family protein	NA	NA	NA	NA	NA
WP_011668519.1|1673672_1674320_-	metal-dependent transcriptional regulator	NA	NA	NA	NA	NA
WP_015474047.1|1674381_1675278_-	cation transporter	NA	A0A1V0SED0	Indivirus	29.1	4.0e-06
WP_024526551.1|1675450_1676014_-	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_015474049.1|1676546_1676984_-	MerR family transcriptional regulator	NA	NA	NA	NA	NA
WP_011668525.1|1677207_1678704_+	multidrug efflux MFS transporter	NA	NA	NA	NA	NA
WP_011668524.1|1678703_1679429_+	DUF4811 domain-containing protein	NA	NA	NA	NA	NA
WP_021741297.1|1679560_1679800_-	MerR family transcriptional regulator	NA	NA	NA	NA	NA
WP_015474051.1|1679989_1680700_+	AzlC family ABC transporter permease	NA	NA	NA	NA	NA
WP_015474052.1|1680684_1681017_+	AzlD domain-containing protein	NA	NA	NA	NA	NA
WP_041815468.1|1681060_1682338_-	uracil permease	NA	Q9KX94	Enterobacteria_phage	37.6	2.0e-67
WP_015474054.1|1682520_1683714_-	MFS transporter	NA	NA	NA	NA	NA
WP_011668531.1|1683745_1684144_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011668351.1|1684178_1684697_-	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_011668352.1|1684799_1685285_-	pyridoxamine 5'-phosphate oxidase family protein	NA	NA	NA	NA	NA
WP_042254898.1|1685405_1685942_-	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_011668354.1|1686130_1686907_-	DUF1003 domain-containing protein	NA	NA	NA	NA	NA
WP_015474058.1|1686914_1687799_-	RluA family pseudouridine synthase	NA	NA	NA	NA	NA
WP_041815471.1|1687817_1688135_-	glycine cleavage system protein H (lipoate-binding)	NA	NA	NA	NA	NA
WP_011668357.1|1688266_1688467_+	hypothetical protein	NA	NA	NA	NA	NA
WP_087609254.1|1688915_1689815_-|transposase	IS3 family transposase	transposase	A0A1B1P773	Bacillus_phage	35.8	2.4e-43
WP_015473803.1|1689811_1690345_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_015474060.1|1690462_1691026_-	sugar O-acetyltransferase	NA	NA	NA	NA	NA
WP_015474061.1|1691102_1692527_-	L-arabinose isomerase	NA	NA	NA	NA	NA
WP_011668360.1|1692575_1693304_-	L-ribulose-5-phosphate 4-epimerase	NA	NA	NA	NA	NA
WP_015474062.1|1693323_1694925_-	FGGY-family carbohydrate kinase	NA	NA	NA	NA	NA
WP_015474063.1|1694956_1696354_-	sugar porter family MFS transporter	NA	NA	NA	NA	NA
WP_041815473.1|1696852_1698115_+|transposase	ISL3 family transposase	transposase	A0A1S5SBP9	Streptococcus_phage	32.1	6.5e-47
WP_041815476.1|1698166_1699252_-	GntR family transcriptional regulator	NA	NA	NA	NA	NA
WP_015474066.1|1699440_1700004_-	sugar O-acetyltransferase	NA	NA	NA	NA	NA
WP_015474067.1|1700115_1701006_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_015474068.1|1701249_1702230_+	family 43 glycosylhydrolase	NA	NA	NA	NA	NA
WP_015474069.1|1702243_1703533_+	oligosaccharide MFS transporter	NA	NA	NA	NA	NA
WP_011668368.1|1703598_1705089_+	alpha-N-arabinofuranosidase	NA	NA	NA	NA	NA
WP_015474071.1|1705125_1706901_-	DNA helicase RecQ	NA	M1PGQ0	Moumouvirus	36.1	2.9e-77
WP_024855499.1|1707145_1707568_-	Rrf2 family transcriptional regulator	NA	NA	NA	NA	NA
WP_041815479.1|1707709_1708285_+	NAD(P)-binding domain-containing protein	NA	NA	NA	NA	NA
WP_041815481.1|1708474_1709878_+	C69 family dipeptidase	NA	NA	NA	NA	NA
WP_015474075.1|1709969_1711412_-	arginine-ornithine antiporter	NA	NA	NA	NA	NA
WP_015474076.1|1711784_1714319_-	M1 family metallopeptidase	NA	A0A0P0IY26	Acinetobacter_phage	26.6	2.0e-63
WP_011668375.1|1714476_1714875_-	iron-sulfur cluster biosynthesis family protein	NA	NA	NA	NA	NA
WP_041815484.1|1714949_1717163_-	alpha-galactosidase	NA	NA	NA	NA	NA
WP_015474078.1|1717818_1718121_+	hypothetical protein	NA	NA	NA	NA	NA
WP_041815489.1|1718304_1718850_-	hypothetical protein	NA	NA	NA	NA	NA
WP_015474079.1|1719281_1720334_-	hypothetical protein	NA	D6PSS2	Lactobacillus_phage	96.3	3.6e-176
WP_015474080.1|1720333_1720846_-	hypothetical protein	NA	D6PSS1	Lactobacillus_phage	74.9	3.5e-60
WP_015474081.1|1720842_1721247_-|holin	phage holin family protein	holin	A0A097BY69	Enterococcus_phage	41.4	1.7e-17
WP_015474082.1|1721303_1721474_-	hypothetical protein	NA	D6PSR8	Lactobacillus_phage	82.1	1.2e-17
WP_015474084.1|1721632_1722085_-	hypothetical protein	NA	NA	NA	NA	NA
WP_015474086.1|1723450_1724110_-	hypothetical protein	NA	D6PT00	Lactobacillus_phage	83.0	1.6e-73
WP_041815491.1|1724099_1725278_-|plate	baseplate J/gp47 family protein	plate	D6PSZ9	Lactobacillus_phage	81.6	1.6e-180
WP_015474088.1|1725264_1725663_-	DUF2634 domain-containing protein	NA	D6PSZ8	Lactobacillus_phage	78.6	4.9e-49
WP_041815492.1|1725662_1726007_-	hypothetical protein	NA	D6PSZ7	Lactobacillus_phage	88.6	1.3e-50
WP_158414577.1|1726006_1727287_-	hypothetical protein	NA	D6PSZ6	Lactobacillus_phage	82.3	3.2e-182
WP_041815494.1|1727237_1727630_-	hypothetical protein	NA	D6PSZ5	Lactobacillus_phage	99.2	4.6e-68
WP_015474091.1|1727641_1728289_-	LysM peptidoglycan-binding domain-containing protein	NA	D6PSZ4	Lactobacillus_phage	92.1	3.4e-108
WP_015474092.1|1728288_1733892_-|tail	phage tail tape measure protein	tail	D6PSY9	Lactobacillus_phage	89.4	4.4e-180
WP_155275711.1|1733906_1734077_-	hypothetical protein	NA	D6PSY6	Lactobacillus_phage	98.1	8.7e-24
WP_015474094.1|1734087_1734462_-	hypothetical protein	NA	D6PSY5	Lactobacillus_phage	92.7	1.9e-63
WP_015474095.1|1734532_1734931_-	hypothetical protein	NA	D6PSY4	Lactobacillus_phage	97.7	4.5e-71
WP_015474096.1|1734945_1735983_-	DUF3383 family protein	NA	D6PSY3	Lactobacillus_phage	94.7	4.9e-141
WP_015474097.1|1735995_1736466_-	hypothetical protein	NA	D6PSY2	Lactobacillus_phage	95.8	2.5e-60
WP_015474098.1|1736458_1736833_-	hypothetical protein	NA	D6PSY1	Lactobacillus_phage	97.6	3.2e-66
WP_041815496.1|1736832_1737432_-	hypothetical protein	NA	D6PSY0	Lactobacillus_phage	97.5	4.5e-107
WP_015474100.1|1737431_1737758_-	DUF4054 domain-containing protein	NA	D6PSX9	Lactobacillus_phage	93.5	5.6e-51
WP_015474101.1|1737769_1738132_-	hypothetical protein	NA	D6PSX8	Lactobacillus_phage	100.0	3.6e-59
WP_015474102.1|1738142_1739021_-	encapsulin	NA	D6PSX7	Lactobacillus_phage	99.0	8.0e-161
WP_015474103.1|1739035_1739500_-	hypothetical protein	NA	D6PSX6	Lactobacillus_phage	98.1	4.9e-77
WP_015474104.1|1739514_1740618_-	DUF2213 domain-containing protein	NA	D6PSX5	Lactobacillus_phage	94.8	1.5e-177
WP_041815498.1|1740629_1740899_-	LysM peptidoglycan-binding domain-containing protein	NA	D6PSX4	Lactobacillus_phage	97.8	5.6e-25
WP_015474106.1|1740921_1741749_-|capsid	minor capsid protein	capsid	D6PSX3	Lactobacillus_phage	94.2	3.8e-128
WP_015474107.1|1741751_1743113_-	DUF1073 domain-containing protein	NA	D6PSX2	Lactobacillus_phage	99.1	1.4e-260
WP_041815501.1|1743129_1744467_-|terminase	terminase	terminase	D6PSX1	Lactobacillus_phage	99.3	3.0e-167
WP_015474109.1|1744450_1745203_-	hypothetical protein	NA	D6PSW8	Lactobacillus_phage	88.0	4.8e-106
WP_041815504.1|1745261_1745495_-	hypothetical protein	NA	D6PSW7	Lactobacillus_phage	89.6	1.2e-34
WP_041815506.1|1745478_1745673_-	hypothetical protein	NA	D6PSW6	Lactobacillus_phage	95.2	1.6e-29
>prophage 6
NC_020819	Lactobacillus brevis KB290, complete genome	2395134	1748807	1766261	2395134	integrase	Lactobacillus_phage(75.0%)	27	1749732:1749745	1767970:1767983
WP_041815897.1|1748807_1749245_-	transcriptional regulator	NA	D6PSV8	Lactobacillus_phage	98.6	1.2e-77
WP_051053380.1|1749465_1749927_-	hypothetical protein	NA	A0A2H4PBD2	Lactobacillus_phage	54.3	2.0e-30
1749732:1749745	attL	ACCATTCAGGATTT	NA	NA	NA	NA
WP_051053381.1|1750052_1750481_-	hypothetical protein	NA	D6PSU8	Lactobacillus_phage	59.8	1.0e-20
WP_051053382.1|1750596_1751040_-	RusA family crossover junction endodeoxyribonuclease	NA	D6PSU4	Lactobacillus_phage	61.8	5.8e-43
WP_125692949.1|1751032_1751719_-	antA/AntB antirepressor family protein	NA	U5U413	Lactobacillus_phage	45.1	4.6e-31
WP_015474116.1|1751754_1752543_-	DnaD domain protein	NA	NA	NA	NA	NA
WP_041815906.1|1752554_1753310_-	PD-(D/E)XK nuclease-like domain-containing protein	NA	A0A0P0IZH9	Lactobacillus_phage	54.2	2.0e-72
WP_015474118.1|1753344_1754403_-	recombinase RecT	NA	D7RWF9	Brochothrix_phage	49.3	1.7e-56
WP_015474119.1|1754403_1754619_-	hypothetical protein	NA	NA	NA	NA	NA
WP_041815513.1|1754609_1754903_-	hypothetical protein	NA	NA	NA	NA	NA
WP_156646391.1|1755012_1755171_-	hypothetical protein	NA	D6PST6	Lactobacillus_phage	76.9	7.4e-17
WP_041815516.1|1755182_1755476_-	hypothetical protein	NA	NA	NA	NA	NA
WP_015474121.1|1755480_1756002_-	hypothetical protein	NA	NA	NA	NA	NA
WP_015474122.1|1756068_1756242_-	hypothetical protein	NA	NA	NA	NA	NA
WP_041815519.1|1756364_1756562_-	hypothetical protein	NA	NA	NA	NA	NA
WP_041815522.1|1756905_1757154_+	hypothetical protein	NA	NA	NA	NA	NA
WP_041815524.1|1757142_1757328_-	hypothetical protein	NA	NA	NA	NA	NA
WP_051053383.1|1757327_1757585_-	helix-turn-helix transcriptional regulator	NA	D6PST0	Lactobacillus_phage	97.6	3.3e-38
WP_080628795.1|1758138_1758525_+	ImmA/IrrE family metallo-endopeptidase	NA	D6PSS8	Lactobacillus_phage	97.7	1.4e-69
WP_041815530.1|1758625_1759219_+	zinc ribbon domain-containing protein	NA	D6PSS6	Lactobacillus_phage	96.4	1.4e-92
WP_041815533.1|1759231_1759864_+	DUF805 domain-containing protein	NA	D6PSS5	Lactobacillus_phage	91.5	3.9e-85
WP_041815535.1|1759970_1760339_+	zinc ribbon domain-containing protein	NA	D6PSS7	Lactobacillus_phage	89.3	1.4e-47
WP_144054551.1|1760457_1761306_+	hypothetical protein	NA	NA	NA	NA	NA
WP_015474129.1|1761738_1762920_+|integrase	tyrosine-type recombinase/integrase	integrase	A0A1S5SA16	Streptococcus_phage	28.3	4.5e-34
WP_172757523.1|1763096_1764638_-	glutamine-hydrolyzing GMP synthase	NA	A0A1V0SH76	Hokovirus	28.1	1.4e-14
WP_144054552.1|1764746_1765325_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011668379.1|1765337_1766261_-	type I pantothenate kinase	NA	A0A1B1ISL9	uncultured_Mediterranean_phage	33.9	2.2e-28
1767970:1767983	attR	AAATCCTGAATGGT	NA	NA	NA	NA
>prophage 7
NC_020819	Lactobacillus brevis KB290, complete genome	2395134	2133730	2175535	2395134	tail,head,portal,terminase,plate,integrase	Lactobacillus_phage(59.52%)	64	2135794:2135810	2175451:2175467
WP_041815643.1|2133730_2133997_-	DUF3102 domain-containing protein	NA	C5IUM1	Streptococcus_phage	56.6	3.3e-17
WP_015474392.1|2134033_2134573_-	hypothetical protein	NA	NA	NA	NA	NA
WP_015474393.1|2134637_2135090_-	hypothetical protein	NA	D6PSV8	Lactobacillus_phage	54.1	3.4e-38
WP_015474394.1|2135566_2136415_-	conserved phage C-terminal domain-containing protein	NA	A0A1W6JNI1	Staphylococcus_phage	38.2	5.5e-34
2135794:2135810	attL	CATCCATAAATTCCTGT	NA	NA	NA	NA
WP_158414579.1|2136426_2136669_-	hypothetical protein	NA	NA	NA	NA	NA
WP_024526214.1|2137161_2137431_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_015474397.1|2137447_2138140_-	Rha family transcriptional regulator	NA	A0A2H4PAV0	Aphanizomenon_phage	34.8	4.4e-05
WP_015474398.1|2138157_2138352_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_015474399.1|2138483_2138978_+	helix-turn-helix domain-containing protein	NA	L0P7E1	Lactobacillus_phage	57.6	4.2e-10
WP_041815649.1|2139042_2140191_+|integrase	site-specific integrase	integrase	A0A172LN96	Lactococcus_phage	35.4	9.7e-58
WP_080628796.1|2140427_2141171_-	N-acetylmuramoyl-L-alanine amidase	NA	A0A1W6JN27	Lactococcus_phage	60.8	4.4e-59
WP_041815652.1|2141179_2141467_-	DUF3792 family protein	NA	NA	NA	NA	NA
WP_041815655.1|2141468_2141666_-	hypothetical protein	NA	NA	NA	NA	NA
WP_015474404.1|2141658_2142054_-	hypothetical protein	NA	A0A2P0ZLF7	Lactobacillus_phage	43.3	1.8e-24
WP_015474405.1|2142069_2142228_-	XkdX family protein	NA	NA	NA	NA	NA
WP_041815657.1|2142665_2143277_-	hypothetical protein	NA	NA	NA	NA	NA
WP_041815660.1|2143278_2144121_-	hypothetical protein	NA	L0P6E1	Lactobacillus_phage	26.5	1.9e-10
WP_015474409.1|2144122_2144749_-	DUF2313 domain-containing protein	NA	Q9AZ88	Lactobacillus_prophage	43.1	1.2e-25
WP_015474410.1|2144741_2145887_-|plate	baseplate J/gp47 family protein	plate	L0P7C2	Lactobacillus_phage	55.6	6.8e-120
WP_144054554.1|2145864_2146302_-	DUF2634 domain-containing protein	NA	A9D9X1	Lactobacillus_prophage	52.9	1.6e-29
WP_041815662.1|2146294_2146615_-	DUF2577 domain-containing protein	NA	A9D9W8	Lactobacillus_prophage	44.2	4.2e-19
WP_041815665.1|2146614_2147664_-	hypothetical protein	NA	X2CXX6	Lactobacillus_phage	32.0	7.6e-41
WP_015474414.1|2147666_2148353_-	hypothetical protein	NA	A9D9W2	Lactobacillus_prophage	43.0	1.4e-32
WP_041815969.1|2148354_2148852_-	hypothetical protein	NA	L0P7B8	Lactobacillus_phage	47.5	7.5e-23
WP_015474417.1|2151235_2151376_-	hypothetical protein	NA	NA	NA	NA	NA
WP_015474418.1|2151420_2151825_-	XkdN-Like protein	NA	NA	NA	NA	NA
WP_041815975.1|2151841_2152330_-|tail	phage tail tube protein	tail	Q20DC7	Lactobacillus_phage	73.9	8.9e-61
WP_015474420.1|2152353_2153775_-|tail	phage tail sheath subtilisin-like domain-containing protein	tail	Q20DC8	Lactobacillus_phage	50.0	8.5e-112
WP_015474421.1|2153776_2153929_-	hypothetical protein	NA	NA	NA	NA	NA
WP_015474422.1|2153918_2154335_-	hypothetical protein	NA	NA	NA	NA	NA
WP_015474423.1|2154331_2154736_-	HK97 gp10 family phage protein	NA	A0A0A7RVN8	Clostridium_phage	32.3	1.3e-17
WP_015474424.1|2154735_2155113_-	hypothetical protein	NA	X2CXE4	Lactobacillus_phage	71.8	5.1e-40
WP_015474425.1|2155109_2155499_-	hypothetical protein	NA	Q20DD3	Lactobacillus_phage	47.7	3.7e-09
WP_015474426.1|2155510_2155822_-	hypothetical protein	NA	NA	NA	NA	NA
WP_015474427.1|2155896_2156808_-	hypothetical protein	NA	Q20DD4	Lactobacillus_phage	76.3	5.8e-130
WP_015474428.1|2156829_2157378_-	phage scaffolding protein	NA	X2CYF9	Lactobacillus_phage	48.1	4.5e-37
WP_041815667.1|2157504_2157834_-	hypothetical protein	NA	NA	NA	NA	NA
WP_051053391.1|2157866_2158901_-|head	phage head morphogenesis protein	head	A9D9S7	Lactobacillus_prophage	43.4	2.1e-80
WP_015474431.1|2158887_2160306_-|portal	phage portal protein	portal	X2CY64	Lactobacillus_phage	56.3	1.1e-151
WP_041815670.1|2160296_2161547_-|terminase	PBSX family phage terminase large subunit	terminase	B6CXD2	Clostridium_phage	43.3	8.9e-97
WP_015474433.1|2161533_2161968_-|terminase	terminase small subunit	terminase	A7J290	Streptococcus_phage	50.7	4.1e-33
WP_041815672.1|2161990_2162620_-	hypothetical protein	NA	NA	NA	NA	NA
WP_015474435.1|2162732_2163260_-	hypothetical protein	NA	A0A097BY45	Enterococcus_phage	35.0	1.8e-19
WP_015474436.1|2163259_2163463_-	hypothetical protein	NA	NA	NA	NA	NA
WP_041815675.1|2163492_2163684_-	hypothetical protein	NA	D6PSV7	Lactobacillus_phage	95.2	2.5e-27
WP_041815677.1|2163664_2163904_-	hypothetical protein	NA	NA	NA	NA	NA
WP_051053392.1|2163896_2164334_-	hypothetical protein	NA	D6PSV5	Lactobacillus_phage	61.9	1.6e-37
WP_041815684.1|2164468_2164894_-	hypothetical protein	NA	D6PSU8	Lactobacillus_phage	54.9	1.8e-17
WP_173391369.1|2165010_2165325_-	VRR-NUC domain-containing protein	NA	A0A1B0YA93	Lactobacillus_phage	53.9	4.1e-27
WP_051053393.1|2165579_2167904_-	DNA primase	NA	Q9T0Y1	Lactobacillus_phage	61.9	3.6e-285
WP_015474440.1|2167915_2168521_-	DUF669 domain-containing protein	NA	Q9T0Y2	Lactobacillus_phage	50.3	1.8e-50
WP_144054555.1|2168536_2169040_-	hypothetical protein	NA	F8UBL7	Clostridium_phage	46.9	2.9e-38
WP_041815687.1|2169036_2170392_-	DEAD/DEAH box helicase	NA	A0A0P0ID30	Lactobacillus_phage	60.8	9.1e-156
WP_015474442.1|2170324_2171095_-	AAA family ATPase	NA	A0A1P8BM36	Lactococcus_phage	64.3	8.5e-82
WP_015474443.1|2171095_2171956_-	DUF1351 domain-containing protein	NA	A0A2D1GPE4	Lactobacillus_phage	37.1	3.2e-37
WP_015474444.1|2171945_2172179_-	hypothetical protein	NA	NA	NA	NA	NA
WP_041815690.1|2172406_2172721_+	hypothetical protein	NA	NA	NA	NA	NA
WP_173391363.1|2172849_2172999_-	hypothetical protein	NA	NA	NA	NA	NA
WP_015474448.1|2173081_2173225_-	hypothetical protein	NA	NA	NA	NA	NA
WP_015474449.1|2173255_2173525_-	hypothetical protein	NA	A0A2P0ZLA9	Lactobacillus_phage	49.4	7.4e-17
WP_041815998.1|2173536_2174331_-	phage antirepressor KilAC domain-containing protein	NA	Q38330	Lactococcus_phage	52.1	1.6e-67
WP_173391370.1|2174343_2174535_-	transcriptional regulator	NA	NA	NA	NA	NA
WP_015474452.1|2174798_2175113_+	helix-turn-helix transcriptional regulator	NA	Q9T1J3	Lactobacillus_phage	44.3	1.2e-13
WP_015474453.1|2175115_2175535_+	ImmA/IrrE family metallo-endopeptidase	NA	D6PSS8	Lactobacillus_phage	38.8	3.5e-21
2175451:2175467	attR	ACAGGAATTTATGGATG	NA	NA	NA	NA
