The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
NC_020990	Streptomyces albidoflavus, complete sequence	6841649	3003079	3063916	6841649	protease,transposase,integrase	Streptomyces_phage(28.57%)	57	3021344:3021386	3064043:3064085
WP_003949729.1|3003079_3003658_+|protease	snapalysin family zinc-dependent metalloprotease	protease	NA	NA	NA	NA
WP_003949728.1|3003813_3004329_+	peptidylprolyl isomerase	NA	A0A1V0SCU1	Indivirus	53.3	3.5e-47
WP_003949727.1|3004406_3004595_-	hypothetical protein	NA	NA	NA	NA	NA
WP_015507438.1|3004693_3004891_-	DUF397 domain-containing protein	NA	NA	NA	NA	NA
WP_003949725.1|3005043_3005256_-	DUF397 domain-containing protein	NA	NA	NA	NA	NA
WP_003949724.1|3005252_3006083_-	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_008405998.1|3006216_3006405_+	hypothetical protein	NA	NA	NA	NA	NA
WP_015507439.1|3006401_3006620_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003949721.1|3006968_3007676_-	FadR family transcriptional regulator	NA	NA	NA	NA	NA
WP_015507440.1|3007949_3009278_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003949719.1|3009379_3010852_+	acyl-CoA synthetase	NA	NA	NA	NA	NA
WP_015507441.1|3010844_3012209_+	acetyl-CoA carboxyltransferase subunit alpha	NA	NA	NA	NA	NA
WP_003949717.1|3012293_3012758_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003949716.1|3012919_3013879_+	MerR family transcriptional regulator	NA	NA	NA	NA	NA
WP_003949715.1|3013850_3014348_-	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_003949714.1|3014491_3014968_+	VOC family protein	NA	NA	NA	NA	NA
WP_003949713.1|3015075_3015702_+	RraA family protein	NA	NA	NA	NA	NA
WP_015507442.1|3015734_3016694_+	D-2-hydroxyacid dehydrogenase family protein	NA	M1I4S0	Paramecium_bursaria_Chlorella_virus	24.3	1.5e-14
WP_003949711.1|3016709_3017567_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003949710.1|3017655_3018594_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003949709.1|3018697_3019075_+	MerR family transcriptional regulator	NA	NA	NA	NA	NA
WP_031177928.1|3019106_3019901_-	DUF429 domain-containing protein	NA	NA	NA	NA	NA
WP_015507445.1|3019932_3021201_-	hypothetical protein	NA	NA	NA	NA	NA
3021344:3021386	attL	GAGCCGCCTTCGGGATTCGAACCCGAGACCTACGCATTACGAG	NA	NA	NA	NA
WP_162473210.1|3021608_3021761_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003949705.1|3021874_3022348_-	MarR family transcriptional regulator	NA	NA	NA	NA	NA
WP_003949704.1|3022421_3022796_+	cupin domain-containing protein	NA	NA	NA	NA	NA
WP_003949701.1|3024863_3025538_-	response regulator transcription factor	NA	NA	NA	NA	NA
WP_003949700.1|3025534_3026761_-	two-component sensor histidine kinase	NA	NA	NA	NA	NA
WP_037629820.1|3026781_3027762_-|protease	CPBP family intramembrane metalloprotease	protease	NA	NA	NA	NA
WP_003949697.1|3029057_3029999_-	AraC family transcriptional regulator	NA	NA	NA	NA	NA
WP_003949696.1|3030079_3030922_+	NAD(P)H-binding protein	NA	NA	NA	NA	NA
WP_003949695.1|3031020_3031632_+	NAD(P)H-dependent oxidoreductase	NA	NA	NA	NA	NA
WP_003949694.1|3031663_3033553_-	S9 family peptidase	NA	NA	NA	NA	NA
WP_008405917.1|3034605_3035277_-	DUF3159 domain-containing protein	NA	NA	NA	NA	NA
WP_003949692.1|3036167_3036605_+	HIT family protein	NA	NA	NA	NA	NA
WP_008405913.1|3038094_3039855_+	CocE/NonD family hydrolase	NA	NA	NA	NA	NA
WP_003949000.1|3039993_3040764_+|transposase	IS5-like element IS112 family transposase	transposase	NA	NA	NA	NA
WP_051085199.1|3040712_3042197_-	SAM-dependent DNA methyltransferase	NA	A0A220A2U4	Liberibacter_phage	37.0	4.2e-69
WP_041826601.1|3042864_3043365_-	hypothetical protein	NA	NA	NA	NA	NA
WP_110034217.1|3043572_3043848_+	XamI family restriction endonuclease	NA	NA	NA	NA	NA
WP_003949000.1|3043860_3044631_+|transposase	IS5-like element IS112 family transposase	transposase	NA	NA	NA	NA
WP_106428971.1|3044679_3045405_+	XamI family restriction endonuclease	NA	NA	NA	NA	NA
WP_003949688.1|3045397_3047161_+	modification methylase	NA	NA	NA	NA	NA
WP_086014547.1|3047474_3048639_-|transposase	IS3 family transposase	transposase	A0A2P1JR32	Mycobacterium_phage	34.4	2.8e-20
WP_003949685.1|3048780_3049953_-	serine hydrolase	NA	NA	NA	NA	NA
WP_050777417.1|3050026_3051421_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003949683.1|3051585_3052116_+	ATP-binding protein	NA	A0A1J0MCT1	Streptomyces_phage	37.2	9.8e-05
WP_003949680.1|3052871_3054068_+	cupin	NA	NA	NA	NA	NA
WP_037629818.1|3054001_3054859_+	aldo/keto reductase	NA	NA	NA	NA	NA
WP_015507452.1|3054846_3055704_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003949677.1|3055828_3057532_-	hypothetical protein	NA	NA	NA	NA	NA
WP_015507453.1|3057528_3058089_-	plasmid mobilization relaxosome protein MobC	NA	NA	NA	NA	NA
WP_003949675.1|3058414_3059269_-	DUF2637 domain-containing protein	NA	D7NW84	Streptomyces_phage	56.3	5.0e-35
WP_078485261.1|3059686_3061048_-	DUF3631 domain-containing protein	NA	NA	NA	NA	NA
WP_037630553.1|3061219_3061450_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003949672.1|3061544_3062246_+	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_015507455.1|3062242_3063916_+|integrase	site-specific integrase	integrase	X5JB41	Clostridium_phage	29.0	1.4e-20
3064043:3064085	attR	GAGCCGCCTTCGGGATTCGAACCCGAGACCTACGCATTACGAG	NA	NA	NA	NA
>prophage 2
NC_020990	Streptomyces albidoflavus, complete sequence	6841649	3322761	3380877	6841649	tRNA,transposase,integrase,holin	Tupanvirus(14.29%)	51	3338061:3338084	3384468:3384491
WP_003949456.1|3322761_3324033_+|tRNA	serine--tRNA ligase	tRNA	A0A2K9L088	Tupanvirus	36.3	1.2e-69
WP_003949455.1|3324059_3324884_+	Cof-type HAD-IIB family hydrolase	NA	NA	NA	NA	NA
WP_008416676.1|3324893_3325613_-	ABC transporter permease subunit	NA	NA	NA	NA	NA
WP_015507520.1|3325626_3326538_-	ABC transporter ATP-binding protein	NA	A0A2R8FG22	Brazilian_cedratvirus	30.5	1.5e-13
WP_003949453.1|3326534_3327416_-	ABC transporter permease subunit	NA	NA	NA	NA	NA
WP_003949452.1|3327412_3328438_-	ABC transporter ATP-binding protein	NA	A0A2H4PQG7	Staphylococcus_phage	29.5	2.1e-19
WP_015507521.1|3328734_3330552_+	SDR family oxidoreductase	NA	NA	NA	NA	NA
WP_003949450.1|3330878_3331334_+	hypothetical protein	NA	NA	NA	NA	NA
WP_010644320.1|3331344_3332247_-	LLM class flavin-dependent oxidoreductase	NA	NA	NA	NA	NA
WP_050777413.1|3332435_3333293_+	HAD family phosphatase	NA	NA	NA	NA	NA
WP_003949447.1|3333295_3334342_-	M23 family metallopeptidase	NA	A0A1B0XUH3	Freshwater_phage	40.0	2.4e-18
WP_003949446.1|3334465_3336181_-	GAF domain-containing protein	NA	NA	NA	NA	NA
WP_003949445.1|3336258_3339924_-	thiol reductant ABC exporter subunit CydD	NA	W8CYL7	Bacillus_phage	25.7	7.5e-19
3338061:3338084	attL	CCGATGTTTCACGTGAAACATCGG	NA	NA	NA	NA
WP_003949444.1|3339987_3340989_-	cytochrome d ubiquinol oxidase subunit II	NA	NA	NA	NA	NA
WP_003949443.1|3341003_3342512_-	cytochrome ubiquinol oxidase subunit I	NA	NA	NA	NA	NA
WP_003949442.1|3342704_3343787_-	histidinol-phosphate transaminase	NA	A0A1X6WGT4	Pacmanvirus	24.7	3.8e-11
WP_003949441.1|3344172_3345294_+	LacI family transcriptional regulator	NA	NA	NA	NA	NA
WP_018470269.1|3345524_3346544_+	Ser/Thr protein kinase	NA	NA	NA	NA	NA
WP_003949439.1|3346752_3347670_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003949438.1|3347809_3349603_-	phosphomethylpyrimidine synthase ThiC	NA	NA	NA	NA	NA
WP_018470266.1|3349824_3351213_+	YibE/F family protein	NA	NA	NA	NA	NA
WP_015507526.1|3351257_3351668_-	SsgA family sporulation/cell division regulator	NA	NA	NA	NA	NA
WP_003949435.1|3351792_3352611_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_003949434.1|3352781_3352997_-	DUF5326 family protein	NA	NA	NA	NA	NA
WP_003949433.1|3353200_3353518_-	cupin domain-containing protein	NA	NA	NA	NA	NA
WP_003949432.1|3353635_3354016_+|holin	phage holin family protein	holin	NA	NA	NA	NA
WP_015507527.1|3354195_3355320_+	cystathionine gamma-lyase	NA	NA	NA	NA	NA
WP_003949430.1|3355523_3356429_+	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_003949429.1|3356475_3356958_+	NUDIX hydrolase	NA	NA	NA	NA	NA
WP_003949428.1|3357158_3358037_+	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_003949427.1|3358189_3358648_+	MarR family transcriptional regulator	NA	NA	NA	NA	NA
WP_050777412.1|3358698_3359202_+	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_015507529.1|3359358_3360762_-	serine hydrolase	NA	A0A2P1JQM9	Mycobacterium_phage	31.4	1.6e-14
WP_003949424.1|3360826_3361018_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003949422.1|3361927_3362470_-	transferase	NA	NA	NA	NA	NA
WP_003949421.1|3362626_3363196_+	deaminase	NA	NA	NA	NA	NA
WP_003949000.1|3363570_3364341_+|transposase	IS5-like element IS112 family transposase	transposase	NA	NA	NA	NA
WP_003949420.1|3364496_3364868_+	TIR domain-containing protein	NA	NA	NA	NA	NA
WP_003949419.1|3364878_3365859_+	caspase family protein	NA	NA	NA	NA	NA
WP_015507532.1|3365858_3366140_+	hypothetical protein	NA	NA	NA	NA	NA
WP_015507533.1|3366103_3368848_-	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_003949416.1|3368844_3369963_-	AAA family ATPase	NA	NA	NA	NA	NA
WP_003949415.1|3369959_3372095_-|integrase,transposase	DDE-type integrase/transposase/recombinase	integrase,transposase	NA	NA	NA	NA
WP_003949414.1|3372091_3372721_-|transposase	TnsA-like heteromeric transposase endonuclease subunit	transposase	NA	NA	NA	NA
WP_003949413.1|3373099_3373501_-	hypothetical protein	NA	NA	NA	NA	NA
WP_015507536.1|3373555_3373858_-	hypothetical protein	NA	NA	NA	NA	NA
WP_015507537.1|3373958_3374336_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003949410.1|3374346_3376998_-	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_003949409.1|3376994_3378113_-	AAA family ATPase	NA	NA	NA	NA	NA
WP_003949408.1|3378109_3380236_-|integrase,transposase	DDE-type integrase/transposase/recombinase	integrase,transposase	NA	NA	NA	NA
WP_101277829.1|3380232_3380877_-|transposase	TnsA-like heteromeric transposase endonuclease subunit	transposase	NA	NA	NA	NA
3384468:3384491	attR	CCGATGTTTCACGTGAAACATCGG	NA	NA	NA	NA
