The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
NC_020559	Mycobacterium tuberculosis str. Erdman = ATCC 35801 chromosome 1, complete sequence	4392353	2929429	2967701	4392353	tRNA,protease,head,integrase,terminase,capsid	Mycobacterium_phage(30.0%)	47	2958230:2958257	2967854:2967881
WP_003413486.1|2929429_2931508_-|tRNA	threonine--tRNA ligase	tRNA	A0A2K9L6B6	Tupanvirus	34.9	2.5e-104
WP_003413487.1|2931616_2931844_+	hypothetical protein	NA	NA	NA	NA	NA
WP_009938541.1|2931840_2933226_-	PE family protein	NA	NA	NA	NA	NA
WP_003413569.1|2933570_2934071_+	DUF1990 family protein	NA	NA	NA	NA	NA
WP_003413574.1|2934087_2934528_-	DoxX family membrane protein	NA	NA	NA	NA	NA
WP_003901437.1|2934674_2935352_+	transcriptional regulator	NA	NA	NA	NA	NA
WP_003413583.1|2935336_2935690_-	cupin domain-containing protein	NA	NA	NA	NA	NA
WP_003413586.1|2935702_2936128_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003413588.1|2936124_2936799_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_003413589.1|2936876_2937698_+	class I SAM-dependent methyltransferase	NA	NA	NA	NA	NA
WP_003413592.1|2937833_2938727_+	universal stress protein TB31.7	NA	NA	NA	NA	NA
WP_003413594.1|2938729_2939548_-	universal stress protein	NA	NA	NA	NA	NA
WP_003899401.1|2939562_2940744_-|protease	site-2 protease family protein	protease	NA	NA	NA	NA
WP_003413598.1|2940802_2941234_-	hypoxic response protein Hrp1	NA	A0A2I6B2H4	Macacine_betaherpesvirus	100.0	1.9e-75
WP_003899402.1|2941747_2942989_-	alpha/beta hydrolase	NA	NA	NA	NA	NA
WP_003899403.1|2943298_2943661_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003413610.1|2944007_2945132_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003413614.1|2945133_2945673_+	archease	NA	NA	NA	NA	NA
WP_010924557.1|2945812_2947111_+	RtcB family protein	NA	A2RQD0	Archaeal_BJ1_virus	43.3	3.8e-90
WP_003413619.1|2947149_2947431_-	DUF1876 domain-containing protein	NA	NA	NA	NA	NA
WP_003413625.1|2947575_2948061_-	non-heme di-iron catalase	NA	NA	NA	NA	NA
WP_003908019.1|2948087_2948342_-	hypothetical protein	NA	NA	NA	NA	NA
WP_009938544.1|2948345_2950682_-	PE family protein	NA	NA	NA	NA	NA
WP_003899405.1|2950710_2950953_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003899406.1|2950953_2951631_+	membrane protein	NA	NA	NA	NA	NA
WP_003413654.1|2951826_2952483_+	DedA family protein	NA	NA	NA	NA	NA
WP_003413657.1|2952645_2953092_+	anti-sigma factor antagonist	NA	NA	NA	NA	NA
WP_003413663.1|2953266_2953599_-	YnfA family protein	NA	NA	NA	NA	NA
WP_015456416.1|2953718_2954078_-	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_003413675.1|2954179_2954638_+	glyoxalase/bleomycin resistance/dioxygenase family protein	NA	NA	NA	NA	NA
WP_003899407.1|2954773_2955154_+	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_003413686.1|2955150_2956647_+	ACR3 family arsenite efflux transporter	NA	A0A2H4PQT9	Staphylococcus_phage	39.7	5.1e-14
WP_003912823.1|2956881_2957073_+	antitoxin MazE family protein	NA	NA	NA	NA	NA
2958230:2958257	attL	ACTGGTTCAATCCCAGTATCGCGCACCA	NA	NA	NA	NA
WP_003899409.1|2958363_2958795_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003900538.1|2958791_2959790_+|integrase	tyrosine-type recombinase/integrase	integrase	A0A2D1G8E2	Mycobacterium_phage	47.8	7.4e-62
WP_003900539.1|2959803_2960268_+	ParB N-terminal domain-containing protein	NA	NA	NA	NA	NA
WP_003908028.1|2960255_2960507_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003899411.1|2960677_2962117_-|capsid	phage major capsid protein	capsid	A0A1B3AYS4	Gordonia_phage	40.6	1.4e-66
WP_003899412.1|2962124_2962658_-|head,protease	HK97 family phage prohead protease	head,protease	A0A2H4JB68	uncultured_Caudovirales_phage	32.9	3.1e-06
WP_003899413.1|2962810_2963437_-|terminase	phage terminase small subunit P27 family	terminase	V9H0V4	Actinophage	47.2	1.6e-17
WP_003899414.1|2963468_2963792_-	type II toxin-antitoxin system toxin	NA	NA	NA	NA	NA
WP_003899415.1|2963871_2964117_-	type II toxin-antitoxin system antitoxin	NA	NA	NA	NA	NA
WP_003899416.1|2964113_2965541_-	DUF3631 domain-containing protein	NA	NA	NA	NA	NA
WP_003899417.1|2965542_2965935_-	DUF2742 domain-containing protein	NA	NA	NA	NA	NA
WP_003899418.1|2965931_2966192_-	helix-turn-helix domain-containing protein	NA	A0A2P1CHK7	Mycobacterium_phage	64.6	3.0e-15
WP_003900543.1|2966208_2966571_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003899420.1|2966573_2967701_-|integrase	site-specific integrase	integrase	A0A1X9SFC1	Mycobacterium_phage	40.4	1.5e-66
2967854:2967881	attR	ACTGGTTCAATCCCAGTATCGCGCACCA	NA	NA	NA	NA
>prophage 2
NC_020559	Mycobacterium tuberculosis str. Erdman = ATCC 35801 chromosome 1, complete sequence	4392353	3086894	3112923	4392353	integrase,tRNA,transposase	Burkholderia_virus(50.0%)	27	3096773:3096791	3121316:3121334
WP_003899482.1|3086894_3088274_-|transposase	transposase	transposase	A0A7P9	Microcystis_virus	30.3	9.3e-31
WP_003414146.1|3088273_3088855_-|transposase	IS607-like element IS1602 family transposase	transposase	F9VHY9	Thermus_phage	30.6	5.0e-18
WP_003414147.1|3089056_3089953_-|tRNA	tRNA pseudouridine(55) synthase TruB	tRNA	NA	NA	NA	NA
WP_003414149.1|3089949_3090633_-	4'-phosphopantetheinyl transferase	NA	NA	NA	NA	NA
WP_003414151.1|3090629_3091604_-	metallophosphoesterase	NA	NA	NA	NA	NA
WP_003900574.1|3091748_3092312_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003414155.1|3092311_3094000_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003414157.1|3094003_3094330_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003414158.1|3094460_3095090_+	DUF3558 family protein	NA	NA	NA	NA	NA
WP_003900576.1|3095108_3096758_+	CocE/NonD family hydrolase	NA	NA	NA	NA	NA
3096773:3096791	attL	GCGGACCCGGGCGGCGACC	NA	NA	NA	NA
WP_003414166.1|3096859_3097216_-	type II toxin-antitoxin system toxin endoribonuclease MazF9	NA	NA	NA	NA	NA
WP_003901465.1|3097199_3097430_-	antitoxin MazE	NA	NA	NA	NA	NA
WP_003414172.1|3097472_3098516_-	DUF2293 domain-containing protein	NA	NA	NA	NA	NA
WP_003911993.1|3098706_3098982_+	DUF1778 domain-containing protein	NA	NA	NA	NA	NA
WP_003917684.1|3099157_3099412_-	hypothetical protein	NA	NA	NA	NA	NA
WP_009938577.1|3099559_3099964_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003414184.1|3099960_3100152_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003899488.1|3100350_3101505_+|integrase,transposase	DDE-type integrase/transposase/recombinase	integrase,transposase	NA	NA	NA	NA
WP_003899489.1|3101738_3101996_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003414190.1|3102100_3102412_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003414195.1|3102831_3103440_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003414198.1|3103510_3104920_+|integrase,transposase	DDE-type integrase/transposase/recombinase	integrase,transposase	NA	NA	NA	NA
WP_003899491.1|3104916_3105729_+	ExeA family protein	NA	NA	NA	NA	NA
WP_087902221.1|3106833_3108095_-|transposase	IS3-like element IS987 family transposase	transposase	Q8W6R2	Burkholderia_virus	59.1	9.6e-83
WP_003414276.1|3110046_3110388_-	CRISPR-associated endonuclease Cas2	NA	NA	NA	NA	NA
WP_003414279.1|3110388_3111405_-	CRISPR-associated endonuclease Cas1	NA	NA	NA	NA	NA
WP_087902221.1|3111661_3112923_-|transposase	IS3-like element IS987 family transposase	transposase	Q8W6R2	Burkholderia_virus	59.1	9.6e-83
3121316:3121334	attR	GCGGACCCGGGCGGCGACC	NA	NA	NA	NA
