The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
NC_020833	Mannheimia haemolytica USDA-ARS-USMARC-183, complete sequence	2657957	4938	12398	2657957	transposase,tail	Mannheimia_phage(81.82%)	11	NA	NA
WP_006248970.1|4938_5658_-	helix-turn-helix transcriptional regulator	NA	F6MII3	Haemophilus_phage	60.0	4.4e-64
WP_006248972.1|5834_6113_+	DNA-binding protein	NA	F6MII4	Haemophilus_phage	57.5	1.0e-16
WP_006253446.1|6157_6961_+|transposase	transposase	transposase	A0A0M3LPN5	Mannheimia_phage	35.9	2.4e-31
WP_006253444.1|7450_7825_+	hypothetical protein	NA	A0A0M3LRV6	Mannheimia_phage	100.0	1.5e-63
WP_006253443.1|7824_8193_+	hypothetical protein	NA	A0A0M3LSI2	Mannheimia_phage	100.0	1.6e-62
WP_006251296.1|8222_8411_+	hypothetical protein	NA	A0A0M3LSQ8	Mannheimia_phage	100.0	2.2e-28
WP_006253442.1|8463_9459_+|tail	phage tail tape measure protein	tail	A0A0M3LPB6	Mannheimia_phage	85.6	1.5e-99
WP_006253441.1|9407_9965_+	DUF2313 domain-containing protein	NA	A0A0M3LQE1	Mannheimia_phage	98.9	3.9e-105
WP_015483985.1|9961_12022_+|tail	Variable tail fiber protein H	tail	A0A0M3LRW6	Mannheimia_phage	99.9	0.0e+00
WP_006248673.1|12022_12265_+	hypothetical protein	NA	A0A0M3LSI9	Mannheimia_phage	100.0	4.4e-45
WP_015483986.1|12251_12398_+	hypothetical protein	NA	A0A0M3LSS2	Mannheimia_phage	70.6	1.9e-06
>prophage 2
NC_020833	Mannheimia haemolytica USDA-ARS-USMARC-183, complete sequence	2657957	435651	443806	2657957	integrase,terminase	Acinetobacter_phage(16.67%)	12	435163:435222	440528:440601
435163:435222	attL	TAAAAAAGCCTTGAAACATTGATTTTCAAGGCTTTTTAGGTATCGGTTGAACCGTATAGG	NA	NA	NA	NA
WP_006250290.1|435651_436344_-|terminase	terminase small subunit	terminase	A0A1X9SFE5	Acinetobacter_phage	58.8	7.5e-29
WP_006250289.1|436340_436766_-	hypothetical protein	NA	NA	NA	NA	NA
WP_015484065.1|436772_436925_-	hypothetical protein	NA	NA	NA	NA	NA
WP_006250286.1|437085_437772_-	hypothetical protein	NA	NA	NA	NA	NA
WP_006250284.1|438166_438490_-	putative addiction module antidote protein	NA	A4JWV1	Burkholderia_virus	43.5	3.0e-12
WP_006253767.1|438602_438821_-	addiction module killer protein	NA	NA	NA	NA	NA
WP_006250282.1|439095_440322_-|integrase	tyrosine-type recombinase/integrase	integrase	A0A1V0E8G8	Vibrio_phage	39.9	4.3e-80
WP_006250280.1|441128_442088_+	RNA polymerase sigma factor RpoH	NA	A0A248SJA5	Salicola_phage	40.2	5.1e-44
440528:440601	attR	TAAAAAAGCCTTGAAACATTGATTTTCAAGGCTTTTTAGGTATCGGTTGAACCGTATAGGATTATAATTTGGTG	NA	NA	NA	NA
WP_006253765.1|442253_442547_+	DUF3144 domain-containing protein	NA	NA	NA	NA	NA
WP_006250278.1|442564_442867_-	BrnA antitoxin family protein	NA	K4NZP3	Burkholderia_phage	38.7	3.5e-07
WP_006250894.1|442838_443129_-	BrnT family toxin	NA	NA	NA	NA	NA
WP_006250276.1|443266_443806_-	HAD-IIIA family hydrolase	NA	A0A222YVZ6	Synechococcus_phage	34.8	3.1e-06
>prophage 3
NC_020833	Mannheimia haemolytica USDA-ARS-USMARC-183, complete sequence	2657957	877101	884045	2657957	tail	Mannheimia_phage(60.0%)	10	NA	NA
WP_006250049.1|877101_878400_+	adenylosuccinate synthase	NA	A0A285PX35	Cedratvirus	36.4	2.7e-72
WP_006250050.1|878778_879072_-	hypothetical protein	NA	A0A0M3LSV5	Mannheimia_phage	97.9	2.2e-46
WP_006247811.1|879215_879605_+	diaminopimelate decarboxylase	NA	NA	NA	NA	NA
WP_006247810.1|879576_879876_+	XRE family transcriptional regulator	NA	NA	NA	NA	NA
WP_006247809.1|879884_880043_-	hypothetical protein	NA	NA	NA	NA	NA
WP_006247808.1|880052_880739_-	hypothetical protein	NA	NA	NA	NA	NA
WP_006253310.1|880849_881461_-	hypothetical protein	NA	A0A0M3LQG1	Mannheimia_phage	61.4	7.7e-54
WP_006247807.1|881509_882136_-|tail	tail assembly protein	tail	A0A0M3LPS1	Mannheimia_phage	82.3	5.8e-89
WP_006247806.1|882357_883077_-	preprotein translocase subunit YajC	NA	NA	NA	NA	NA
WP_006253312.1|883334_884045_-	tape measure protein	NA	A0A125RN77	Pseudomonas_phage	40.0	2.2e-20
>prophage 4
NC_020833	Mannheimia haemolytica USDA-ARS-USMARC-183, complete sequence	2657957	887278	897595	2657957		Mannheimia_phage(50.0%)	14	NA	NA
WP_006247798.1|887278_887653_+	hypothetical protein	NA	A0A0M3LPT1	Mannheimia_phage	98.4	1.1e-66
WP_006253314.1|887660_887828_+	DNA cytosine methyltransferase	NA	A0A0M3LNT4	Mannheimia_phage	76.8	4.4e-20
WP_006253316.1|887908_888232_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_006247795.1|890341_890935_-	N-6-adenine methyltransferase	NA	A0A0M3LNW2	Mannheimia_phage	75.5	8.8e-87
WP_006247794.1|890945_891992_-	hypothetical protein	NA	M4SQA9	Psychrobacter_phage	52.6	1.1e-23
WP_006247793.1|891988_892672_-	hypothetical protein	NA	A0A2I7RHG4	Vibrio_phage	51.3	4.7e-52
WP_006247792.1|892729_892918_-	hypothetical protein	NA	A5VW97	Enterobacteria_phage	62.1	1.3e-12
WP_006247791.1|893042_893699_+	helix-turn-helix domain-containing protein	NA	A0A0M3LSL8	Mannheimia_phage	42.5	4.1e-37
WP_006247790.1|893710_894085_+	hypothetical protein	NA	NA	NA	NA	NA
WP_006247789.1|894236_894974_+	hypothetical protein	NA	NA	NA	NA	NA
WP_006253352.1|895009_895606_-	hypothetical protein	NA	NA	NA	NA	NA
WP_006249220.1|896251_896437_+	hypothetical protein	NA	NA	NA	NA	NA
WP_006249219.1|896420_896618_+	hypothetical protein	NA	NA	NA	NA	NA
WP_006249218.1|896620_897595_+	single-stranded DNA-binding protein	NA	A0A1S5NNJ1	Burkholderia_phage	44.6	8.9e-36
>prophage 5
NC_020833	Mannheimia haemolytica USDA-ARS-USMARC-183, complete sequence	2657957	971325	1076937	2657957	integrase,transposase,tail,tRNA,terminase,holin,portal	Mannheimia_phage(43.86%)	103	961670:961729	1061882:1062043
961670:961729	attL	GCTGTGCTGTGCTGTGCTGTGCTGTGCTGTGCTGTGCTGTGCTGTGCTGTGCTGTGCTGT	NA	NA	NA	NA
WP_006248811.1|971325_972381_-|integrase	tyrosine-type recombinase/integrase	integrase	A0A0M3LS39	Mannheimia_phage	99.7	1.0e-199
WP_006248810.1|972340_972616_-	DUF4224 domain-containing protein	NA	A0A0M3LNT7	Mannheimia_phage	98.9	4.5e-46
WP_006248809.1|972641_973133_-	class I SAM-dependent methyltransferase	NA	A0A0M3LQH0	Mannheimia_phage	96.9	1.1e-95
WP_006248808.1|973195_974038_-	hypothetical protein	NA	F6MIM2	Haemophilus_phage	67.3	4.0e-109
WP_006248807.1|974084_974210_-	Com family DNA-binding transcriptional regulator	NA	NA	NA	NA	NA
WP_006248806.1|974356_974566_-	hypothetical protein	NA	NA	NA	NA	NA
WP_006248805.1|974568_974862_-	hypothetical protein	NA	A0A0M3LQA6	Mannheimia_phage	37.9	1.1e-05
WP_006248804.1|974854_975292_-	hypothetical protein	NA	Q19US5	Mannheimia_phage	38.5	4.7e-05
WP_006248801.1|975530_976208_-	phage repressor protein/antirepressor Ant	NA	A0A0M3LQ72	Mannheimia_phage	91.3	2.0e-58
WP_006248800.1|976455_977295_-	KilA-N domain-containing protein	NA	Q4ZC41	Staphylococcus_virus	52.9	1.6e-73
WP_006248797.1|977524_977902_+	hypothetical protein	NA	NA	NA	NA	NA
WP_015484162.1|978033_978222_+	hypothetical protein	NA	A0A0M3LPW7	Mannheimia_phage	93.5	5.0e-28
WP_006248795.1|978225_978723_-	hypothetical protein	NA	A0A0M3LTD8	Mannheimia_phage	45.9	3.5e-28
WP_006248794.1|978706_978907_-	hypothetical protein	NA	A0A0M3LPT5	Mannheimia_phage	67.2	1.9e-17
WP_006248793.1|978903_979422_-	DUF551 domain-containing protein	NA	A0A0M3LQK2	Mannheimia_phage	82.3	1.4e-77
WP_006248792.1|979531_980335_-	YfdQ family protein	NA	I3PUY7	Vibrio_phage	40.1	1.1e-50
WP_006248791.1|980404_980764_-	hypothetical protein	NA	A0A192Y6G0	Salmonella_phage	51.5	3.6e-19
WP_006248790.1|980799_981258_-	single-stranded DNA-binding protein	NA	F8TUL2	EBPR_podovirus	48.0	6.0e-35
WP_006248789.1|981260_981458_-	hypothetical protein	NA	NA	NA	NA	NA
WP_006248788.1|981441_981627_-	hypothetical protein	NA	NA	NA	NA	NA
WP_006248787.1|981840_982116_+	hypothetical protein	NA	A0A1J0MFQ1	Staphylococcus_phage	30.4	1.2e-06
WP_006248786.1|982118_982370_-	hypothetical protein	NA	A0A0M3LNV4	Mannheimia_phage	85.2	1.7e-31
WP_015484163.1|982822_983053_-	hypothetical protein	NA	A0A0M3LQL0	Mannheimia_phage	98.7	2.5e-37
WP_015484164.1|983316_984429_-	hypothetical protein	NA	NA	NA	NA	NA
WP_006249427.1|984425_984929_-	DUF4365 domain-containing protein	NA	NA	NA	NA	NA
WP_006249426.1|984933_985665_-	helix-turn-helix transcriptional regulator	NA	A0A0M3LQ62	Mannheimia_phage	39.8	7.4e-43
WP_006249425.1|985791_986016_+	helix-turn-helix domain-containing protein	NA	D0UIL8	Aggregatibacter_phage	65.6	2.6e-15
WP_006249424.1|986064_986826_+	hypothetical protein	NA	A0A2I7R415	Vibrio_phage	33.3	6.5e-26
WP_006249423.1|986822_987614_+	helix-turn-helix domain-containing protein	NA	D0UIL5	Aggregatibacter_phage	76.1	7.7e-30
WP_006249422.1|987601_988237_+	bacteriophage replication protein	NA	A0A0M3LS65	Mannheimia_phage	56.3	1.5e-55
WP_015484167.1|988233_988806_+	phage N-6-adenine-methyltransferase	NA	A0A0M3LNW2	Mannheimia_phage	96.8	3.1e-105
WP_015587038.1|988875_989904_+	DUF968 domain-containing protein	NA	A0A1W6JP62	Morganella_phage	33.9	2.8e-48
WP_006249418.1|989896_990256_+	RusA family crossover junction endodeoxyribonuclease	NA	A0A0M3LPZ2	Mannheimia_phage	33.9	2.3e-13
WP_015484169.1|990245_990605_+	hypothetical protein	NA	NA	NA	NA	NA
WP_015587037.1|990684_991491_+	nitrate ABC transporter ATP-binding protein	NA	NA	NA	NA	NA
WP_006249199.1|991654_992002_+|holin	phage holin, lambda family	holin	A0A0M3LNX1	Mannheimia_phage	89.9	2.5e-49
WP_015484172.1|991991_992588_+	glycoside hydrolase family 19 protein	NA	A0A0M3LPP0	Mannheimia_phage	84.7	4.1e-92
WP_006249197.1|992588_992939_+	DUF2570 domain-containing protein	NA	A0A0M3LPB1	Mannheimia_phage	88.8	1.5e-22
WP_006249196.1|992943_993117_+	hypothetical protein	NA	A0A0M3LSZ0	Mannheimia_phage	94.7	3.3e-26
WP_006249195.1|993252_993651_+	hypothetical protein	NA	NA	NA	NA	NA
WP_006249194.1|993798_994275_+	DUF1441 family protein	NA	K7PJY2	Enterobacterial_phage	54.7	9.3e-39
WP_006249193.1|994274_996386_+|terminase	phage terminase large subunit family protein	terminase	A5LH27	Enterobacteria_phage	67.7	2.0e-274
WP_006249192.1|996382_996607_+	hypothetical protein	NA	NA	NA	NA	NA
WP_006249191.1|996606_998106_+|portal	phage portal protein	portal	Q8VNN6	Enterobacteria_phage	56.8	4.4e-159
WP_006249190.1|998117_1000079_+	peptidase S14	NA	A0A1W6JT88	Pseudomonas_phage	55.0	3.3e-199
WP_006249189.1|1000152_1000476_+	DUF2190 family protein	NA	K7PLV6	Enterobacteria_phage	38.3	4.9e-15
WP_006249188.1|1000468_1000771_+|tail	phage tail protein	tail	NA	NA	NA	NA
WP_006249187.1|1000774_1001299_+|tail	tail protein	tail	M9NZH5	Enterobacteria_phage	37.0	1.9e-16
WP_006249186.1|1001295_1001691_+|tail	phage tail protein	tail	NA	NA	NA	NA
WP_006249185.1|1001718_1002360_+	hypothetical protein	NA	NA	NA	NA	NA
WP_006249184.1|1002443_1002845_+	hypothetical protein	NA	NA	NA	NA	NA
WP_006249183.1|1002889_1003120_+	DUF4035 domain-containing protein	NA	NA	NA	NA	NA
WP_006249181.1|1003182_1003410_+	hypothetical protein	NA	NA	NA	NA	NA
WP_006249180.1|1003463_1007030_+	tape measure protein	NA	A0A125RN77	Pseudomonas_phage	34.3	2.3e-33
WP_006249179.1|1007029_1007359_+|tail	phage tail protein	tail	A0A2R9YJM0	Escherichia_phage	38.9	4.1e-17
WP_006249178.1|1007358_1008075_+|tail	phage minor tail protein L	tail	A0A0M3LPR8	Mannheimia_phage	98.3	2.3e-134
WP_006249177.1|1008078_1008810_+	C40 family peptidase	NA	A0A0M3LQI5	Mannheimia_phage	100.0	4.2e-147
WP_006249176.1|1009078_1009708_+|tail	tail assembly protein	tail	A0A0M3LPS1	Mannheimia_phage	100.0	1.0e-109
WP_006247812.1|1016897_1017191_+	hypothetical protein	NA	A0A0M3LSV5	Mannheimia_phage	99.0	5.7e-47
WP_006248062.1|1017458_1017629_-	zf-HC2 domain-containing protein	NA	NA	NA	NA	NA
WP_006248063.1|1018429_1019170_-	hypothetical protein	NA	NA	NA	NA	NA
WP_006248064.1|1019159_1020083_-	DUF692 family protein	NA	NA	NA	NA	NA
WP_006248065.1|1020183_1020471_-	hypothetical protein	NA	NA	NA	NA	NA
WP_006252769.1|1020496_1020937_-	DoxX family protein	NA	NA	NA	NA	NA
WP_015587099.1|1021178_1022111_+|transposase	IS481 family transposase	transposase	A0A0M3LS26	Mannheimia_phage	94.1	5.3e-163
WP_006253498.1|1023255_1025487_-	collagen-binding protein	NA	NA	NA	NA	NA
WP_006248069.1|1025680_1026910_-	alanine--glyoxylate aminotransferase family protein	NA	NA	NA	NA	NA
WP_006253499.1|1027182_1028976_+	elongation factor 4	NA	A0A2K9L2P9	Tupanvirus	42.6	1.1e-23
WP_006248071.1|1029062_1030022_+	signal peptidase I	NA	NA	NA	NA	NA
WP_006248072.1|1030067_1030742_+	ribonuclease III	NA	M4QMG4	Micromonas_pusilla_virus	35.0	7.8e-23
WP_006248073.1|1030844_1031762_+	GTPase Era	NA	NA	NA	NA	NA
WP_006248074.1|1031991_1032714_+	DNA repair protein RecO	NA	NA	NA	NA	NA
WP_006248075.1|1032801_1034037_+	ATP-dependent RNA helicase RhlB	NA	E3T5E1	Cafeteria_roenbergensis_virus	29.2	1.9e-38
WP_006248076.1|1034095_1035586_+	DUF853 domain-containing protein	NA	A0A248XCZ8	Klebsiella_phage	45.0	6.2e-81
WP_006248077.1|1035647_1036274_-	DsbA family oxidoreductase	NA	NA	NA	NA	NA
WP_006248078.1|1036283_1037294_-	ABC transporter ATP-binding protein	NA	G3M9Y6	Bacillus_virus	33.0	3.5e-27
WP_006248079.1|1037303_1038950_-	iron ABC transporter permease	NA	NA	NA	NA	NA
WP_006253500.1|1039072_1040101_-	Fe(3+) ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_006253501.1|1040445_1041165_+	30S ribosomal protein S2	NA	NA	NA	NA	NA
WP_006248082.1|1041260_1042112_+	elongation factor Ts	NA	NA	NA	NA	NA
WP_006248083.1|1042175_1043738_-	sulfatase-like hydrolase/transferase	NA	NA	NA	NA	NA
WP_006248084.1|1043829_1044546_+	UMP kinase	NA	NA	NA	NA	NA
WP_006248085.1|1044597_1045155_+	ribosome recycling factor	NA	NA	NA	NA	NA
WP_006248086.1|1045291_1045975_-	2,3-diphosphoglycerate-dependent phosphoglycerate mutase	NA	NA	NA	NA	NA
WP_006248087.1|1046142_1047306_+	peptidoglycan DD-metalloendopeptidase family protein	NA	NA	NA	NA	NA
WP_006248088.1|1047306_1048152_+	divergent polysaccharide deacetylase family protein	NA	NA	NA	NA	NA
WP_006248089.1|1048163_1049999_+	outer membrane protein assembly factor	NA	NA	NA	NA	NA
WP_006253502.1|1050079_1054177_+	translocation/assembly module TamB	NA	NA	NA	NA	NA
WP_006248092.1|1054291_1056058_+	cysteine/glutathione ABC transporter permease/ATP-binding protein CydD	NA	W8CYL7	Bacillus_phage	24.3	9.2e-23
WP_006248093.1|1056057_1057722_+	cysteine/glutathione ABC transporter ATP-binding protein/permease CydC	NA	W8CYL7	Bacillus_phage	25.2	2.8e-21
WP_006248094.1|1057853_1058483_+	high frequency lysogenization protein HflD	NA	NA	NA	NA	NA
WP_006248095.1|1058516_1059884_+	adenylosuccinate lyase	NA	A0A2H4UUU6	Bodo_saltans_virus	46.4	3.1e-111
WP_006248096.1|1059950_1060712_+	DeoR/GlpR family transcriptional regulator	NA	A0A077SK06	Escherichia_phage	29.2	1.2e-19
WP_006248097.1|1060704_1061580_+	4-hydroxybenzoate octaprenyltransferase	NA	NA	NA	NA	NA
WP_006250663.1|1062082_1063915_+	site-specific DNA-methyltransferase	NA	A0A2K5B255	Erysipelothrix_phage	48.4	4.9e-152
1061882:1062043	attR	ACAGCACAGCACAGCACAGCACAGCACAGCACAGCACAGCACAGCACAGCACAGCACAGCCTTGCCAACTTTTCGCTTAAAGATCAACAACTTTCTCAATTAAAATCCCTTTTACCTGAAATTTTCACCGAAGGTAAAATCGACTTCGACAAATTCCAACAA	NA	NA	NA	NA
WP_006248098.1|1063924_1066561_+	DEAD/DEAH box helicase family protein	NA	A0A2K5B2C2	Erysipelothrix_phage	35.9	4.3e-141
WP_006248099.1|1066692_1069125_+	DNA topoisomerase (ATP-hydrolyzing) subunit B	NA	A0A172JHT4	Bacillus_phage	32.1	6.6e-104
WP_006248100.1|1069177_1070140_-|tRNA	tRNA 5-methoxyuridine(34)/uridine 5-oxyacetic acid(34) synthase CmoB	tRNA	NA	NA	NA	NA
WP_006253504.1|1070236_1072000_-	30S ribosomal protein S12 methylthiotransferase accessory protein YcaO	NA	NA	NA	NA	NA
WP_006248102.1|1072263_1074552_+	CRISPR-associated helicase/endonuclease Cas3	NA	NA	NA	NA	NA
WP_006248103.1|1074682_1075276_+	hypothetical protein	NA	NA	NA	NA	NA
WP_006253505.1|1075337_1075754_-|transposase	IS200/IS605 family transposase	transposase	A0A1S5RHE3	Helicobacter_phage	63.5	3.3e-48
WP_006253506.1|1075800_1076937_+|transposase	transposase	transposase	A0A1B0VCD8	Salmonella_phage	57.5	4.2e-122
>prophage 6
NC_020833	Mannheimia haemolytica USDA-ARS-USMARC-183, complete sequence	2657957	1102097	1191422	2657957	integrase,plate,tail,tRNA,terminase,holin,capsid,portal,head	Mannheimia_phage(84.62%)	107	1090859:1090877	1193979:1193997
1090859:1090877	attL	GTGATGATGAAGCAATGTT	NA	NA	NA	NA
WP_006253274.1|1102097_1102742_-|integrase	tyrosine-type recombinase/integrase	integrase	A0A0M3LS39	Mannheimia_phage	83.6	1.2e-97
WP_006250074.1|1103077_1103497_-	type II toxin-antitoxin system HicB family antitoxin	NA	Q7Y3V7	Yersinia_phage	50.4	1.1e-27
WP_006250075.1|1103535_1103718_-	type II toxin-antitoxin system HicA family toxin	NA	A0A0M3LQ86	Mannheimia_phage	51.7	3.6e-07
WP_006250077.1|1103849_1104347_-	hypothetical protein	NA	A0A0M3LR76	Mannheimia_phage	97.9	1.6e-44
WP_006248823.1|1104339_1104720_-	hypothetical protein	NA	A0A0M3LQX0	Mannheimia_phage	100.0	1.6e-73
WP_006248824.1|1104794_1105478_-	hypothetical protein	NA	K7PKK1	Enterobacteria_phage	31.6	2.8e-20
WP_006248825.1|1105608_1105809_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_006247808.1|1106210_1106897_+	hypothetical protein	NA	NA	NA	NA	NA
WP_006247809.1|1106906_1107065_+	hypothetical protein	NA	NA	NA	NA	NA
WP_006247810.1|1107073_1107373_-	XRE family transcriptional regulator	NA	NA	NA	NA	NA
WP_015484247.1|1107344_1107734_-	diaminopimelate decarboxylase	NA	NA	NA	NA	NA
WP_006247812.1|1107877_1108171_+	hypothetical protein	NA	A0A0M3LSV5	Mannheimia_phage	99.0	5.7e-47
WP_006247813.1|1108455_1111314_+	DNA polymerase I	NA	A0A218MKQ4	uncultured_virus	30.6	8.0e-69
WP_006247814.1|1111424_1112066_+	outer membrane lipoprotein chaperone LolA	NA	NA	NA	NA	NA
WP_006247815.1|1112145_1112466_+	trp operon repressor	NA	NA	NA	NA	NA
WP_006250687.1|1112440_1113226_+	monofunctional biosynthetic peptidoglycan transglycosylase	NA	NA	NA	NA	NA
WP_006247817.1|1113237_1113957_+	oxygen-insensitive NADPH nitroreductase	NA	NA	NA	NA	NA
WP_006247818.1|1113953_1114865_+	RimK family alpha-L-glutamate ligase	NA	NA	NA	NA	NA
WP_006247820.1|1115021_1116290_+	malic enzyme	NA	NA	NA	NA	NA
WP_006247821.1|1116441_1116729_+	50S ribosomal protein L25	NA	NA	NA	NA	NA
WP_006249169.1|1117296_1117935_+	DUF1007 family protein	NA	NA	NA	NA	NA
WP_006249168.1|1117925_1118912_+	nickel/cobalt transporter	NA	NA	NA	NA	NA
WP_006249167.1|1119016_1120462_+	alanine:cation symporter family protein	NA	NA	NA	NA	NA
WP_006249166.1|1120532_1121402_-	succinate--CoA ligase subunit alpha	NA	NA	NA	NA	NA
WP_006249165.1|1121410_1122571_-	ADP-forming succinate--CoA ligase subunit beta	NA	NA	NA	NA	NA
WP_006249164.1|1122863_1124093_-	2-oxoglutarate dehydrogenase complex dihydrolipoyllysine-residue succinyltransferase	NA	NA	NA	NA	NA
WP_006249163.1|1124195_1127009_-	2-oxoglutarate dehydrogenase E1 component	NA	NA	NA	NA	NA
WP_095578364.1|1127173_1127920_-	zinc ABC transporter ATP-binding protein ZnuC	NA	A0A2K9L0W2	Tupanvirus	35.9	1.4e-17
WP_006249161.1|1128144_1129674_+	murein DD-endopeptidase MepM	NA	Q8SBN9	Clostridium_phage	47.9	1.7e-17
WP_006249160.1|1129683_1130367_+	bifunctional protein-disulfide isomerase/oxidoreductase DsbC	NA	NA	NA	NA	NA
WP_006249159.1|1130451_1132173_+	single-stranded-DNA-specific exonuclease RecJ	NA	A7KV88	Bacillus_phage	31.0	1.9e-65
WP_031192872.1|1132300_1133149_+	OmpA family protein	NA	NA	NA	NA	NA
WP_006249157.1|1133236_1134055_+	pyridoxal phosphatase	NA	NA	NA	NA	NA
WP_015587056.1|1134057_1135749_+	nitrate/nitrite two-component system sensor histidine kinase NarQ	NA	NA	NA	NA	NA
WP_006249155.1|1135799_1136318_+	N-acetyltransferase	NA	NA	NA	NA	NA
WP_006249154.1|1136360_1136960_+	RdgB/HAM1 family non-canonical purine NTP pyrophosphatase	NA	Q66YC8	Euphorbia_ringspot_virus	27.5	2.6e-09
WP_006249153.1|1136956_1137277_+	YbjQ family protein	NA	NA	NA	NA	NA
WP_006249152.1|1137280_1137733_+	YcgN family cysteine cluster protein	NA	NA	NA	NA	NA
WP_006249151.1|1137773_1138355_-	D-sedoheptulose 7-phosphate isomerase	NA	NA	NA	NA	NA
WP_006248209.1|1138663_1139623_+	sigma 54-interacting transcriptional regulator	NA	NA	NA	NA	NA
WP_006253548.1|1139615_1141367_+	ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_006248207.1|1141369_1142335_+	ABC transporter permease subunit	NA	NA	NA	NA	NA
WP_006248206.1|1142321_1143215_+	ABC transporter permease subunit	NA	NA	NA	NA	NA
WP_006248205.1|1143285_1144338_+	ATP-binding cassette domain-containing protein	NA	NA	NA	NA	NA
WP_006248204.1|1144346_1144577_-	YceK/YidQ family lipoprotein	NA	NA	NA	NA	NA
WP_006248203.1|1144706_1145789_+	3-isopropylmalate dehydrogenase	NA	NA	NA	NA	NA
WP_006248202.1|1145875_1146271_-	peptide-methionine (R)-S-oxide reductase MsrB	NA	NA	NA	NA	NA
WP_006248201.1|1146495_1147500_+	type I glyceraldehyde-3-phosphate dehydrogenase	NA	NA	NA	NA	NA
WP_006248200.1|1148275_1149316_-|portal	phage portal protein	portal	Q19UT6	Mannheimia_phage	100.0	1.4e-199
WP_006248199.1|1149324_1151127_-|terminase	terminase ATPase subunit family protein	terminase	Q19UT5	Mannheimia_phage	100.0	0.0e+00
WP_006248198.1|1151276_1152104_+|capsid	GPO family capsid scaffolding protein	capsid	Q19UT4	Mannheimia_phage	100.0	4.7e-139
WP_006248197.1|1152117_1153146_+|capsid	phage major capsid protein, P2 family	capsid	Q19UT3	Mannheimia_phage	100.0	2.7e-192
WP_006250770.1|1153155_1153845_+|terminase	terminase endonuclease subunit	terminase	Q19US0	Mannheimia_phage	100.0	2.2e-121
WP_006248195.1|1153956_1154472_+|head	head completion/stabilization protein	head	A0A0M3LNL8	Mannheimia_phage	100.0	3.3e-90
WP_006250771.1|1154468_1154681_+|tail	tail protein	tail	A0A0M3LPY0	Mannheimia_phage	100.0	2.0e-33
WP_006250772.1|1154686_1154893_+|holin	holin	holin	Q19UR7	Mannheimia_phage	100.0	7.6e-30
WP_006250773.1|1154885_1155452_+	lysozyme	NA	Q19UR6	Mannheimia_phage	100.0	2.3e-105
WP_006248210.1|1155448_1155904_+	hypothetical protein	NA	A0A0M3LQV2	Mannheimia_phage	100.0	1.4e-71
WP_006248194.1|1156052_1156274_+	TraR/DksA family transcriptional regulator	NA	A0A0M3LS11	Mannheimia_phage	100.0	3.4e-36
WP_006248193.1|1156270_1156756_+|tail	phage tail protein	tail	Q19UR3	Mannheimia_phage	100.0	1.5e-89
WP_006248192.1|1156748_1157207_+	phage virion morphogenesis protein	NA	Q19UR2	Mannheimia_phage	100.0	2.0e-78
WP_006248191.1|1157257_1157536_-	hypothetical protein	NA	Q19UR1	Mannheimia_phage	100.0	2.6e-33
WP_006248190.1|1157574_1160487_+	hypothetical protein	NA	Q19UR0	Mannheimia_phage	100.0	0.0e+00
WP_006253549.1|1160551_1160728_+	hypothetical protein	NA	A0A0M3LP21	Mannheimia_phage	100.0	7.4e-26
WP_006250779.1|1160720_1161008_+	type II toxin-antitoxin system RelE/ParE family toxin	NA	Q19UQ8	Mannheimia_phage	100.0	1.6e-46
WP_006248188.1|1161136_1161742_+|plate	phage baseplate assembly protein V	plate	A0A0M3LPY9	Mannheimia_phage	100.0	9.3e-84
WP_006248187.1|1161741_1162077_+	hypothetical protein	NA	Q19UQ6	Mannheimia_phage	100.0	7.7e-56
WP_006248186.1|1162073_1162991_+|plate	baseplate assembly protein	plate	Q19UQ5	Mannheimia_phage	100.0	6.2e-164
WP_006248185.1|1162977_1163610_+|tail	phage tail protein I	tail	Q19UQ4	Mannheimia_phage	100.0	1.0e-101
WP_096864244.1|1163612_1165892_+|tail	phage tail protein	tail	Q19UQ3	Mannheimia_phage	99.6	0.0e+00
WP_006248181.1|1165892_1166135_+	hypothetical protein	NA	Q19UQ2	Mannheimia_phage	100.0	1.7e-44
WP_168926376.1|1166118_1166397_-	hypothetical protein	NA	NA	NA	NA	NA
WP_006248179.1|1166572_1167754_+|tail	phage tail sheath protein	tail	Q19UP9	Mannheimia_phage	100.0	5.2e-224
WP_006248178.1|1167762_1168269_+|tail	phage major tail tube protein	tail	Q19UP8	Mannheimia_phage	100.0	1.7e-91
WP_006248177.1|1168347_1168662_+|tail	phage tail assembly protein	tail	Q19UP7	Mannheimia_phage	100.0	3.8e-49
WP_075270712.1|1168685_1168802_+|tail	GpE family phage tail protein	tail	R9QCM4	Mannheimia_phage	97.4	5.0e-15
WP_006253663.1|1168865_1169213_+	hypothetical protein	NA	R9QBV4	Mannheimia_phage	100.0	4.0e-55
WP_006248175.1|1169214_1169652_+|tail	phage tail protein	tail	Q19UP5	Mannheimia_phage	100.0	2.5e-75
WP_006248174.1|1169651_1170890_+	phage late control D family protein	NA	Q19UP4	Mannheimia_phage	100.0	7.7e-218
WP_006248173.1|1171072_1171879_-	DUF3800 domain-containing protein	NA	Q19UP3	Mannheimia_phage	100.0	2.3e-154
WP_006248172.1|1171913_1172174_-	excalibur calcium-binding domain-containing protein	NA	Q19UP2	Mannheimia_phage	100.0	2.2e-34
WP_006253662.1|1172273_1172684_-	hypothetical protein	NA	A0A0M3LP57	Mannheimia_phage	100.0	5.5e-72
WP_006248170.1|1172701_1173220_-	hypothetical protein	NA	Q19UP0	Mannheimia_phage	100.0	2.5e-93
WP_006248169.1|1173223_1173910_-	helix-turn-helix domain-containing protein	NA	A0A0M3LPF9	Mannheimia_phage	100.0	7.0e-128
WP_006248168.1|1174033_1174246_+	helix-turn-helix domain-containing protein	NA	Q19UN8	Mannheimia_phage	100.0	4.9e-32
WP_006253660.1|1174344_1174590_-	hypothetical protein	NA	A0A0M3LNP3	Mannheimia_phage	100.0	3.8e-36
WP_006248166.1|1174722_1174995_+	hypothetical protein	NA	Q19UN6	Mannheimia_phage	100.0	4.5e-46
WP_006248165.1|1175077_1175410_+	hypothetical protein	NA	Q19UT2	Mannheimia_phage	100.0	4.8e-50
WP_006248164.1|1175422_1175716_+	hypothetical protein	NA	Q19UT1	Mannheimia_phage	100.0	4.1e-53
WP_006248162.1|1175867_1176110_+	hypothetical protein	NA	Q19UT0	Mannheimia_phage	100.0	9.5e-40
WP_006248161.1|1176106_1176439_+	hypothetical protein	NA	Q19US9	Mannheimia_phage	100.0	1.6e-61
WP_006248160.1|1176435_1178796_+	replication endonuclease	NA	Q19US8	Mannheimia_phage	100.0	0.0e+00
WP_006248159.1|1178808_1179141_+	hypothetical protein	NA	A0A0M3LPG9	Mannheimia_phage	100.0	2.5e-59
WP_006248158.1|1179140_1179593_+	single-stranded DNA-binding protein	NA	A0A0M3LP44	Mannheimia_phage	100.0	1.7e-77
WP_006248157.1|1179603_1179936_+	hypothetical protein	NA	A0A0M3LNQ0	Mannheimia_phage	100.0	2.3e-60
WP_006248156.1|1179925_1180195_+	hypothetical protein	NA	A0A0M3LQ12	Mannheimia_phage	100.0	1.1e-44
WP_006248155.1|1180169_1180460_+	hypothetical protein	NA	A0A0M3LQ35	Mannheimia_phage	100.0	3.2e-50
WP_006248154.1|1180729_1180912_-	hypothetical protein	NA	Q19US2	Mannheimia_phage	100.0	2.7e-23
WP_006248153.1|1181189_1182188_-|integrase	site-specific integrase	integrase	Q19US1	Mannheimia_phage	100.0	1.1e-185
WP_006248152.1|1182555_1183356_-	bis(5'-nucleosyl)-tetraphosphatase (symmetrical)	NA	S4TT53	Salmonella_phage	37.1	4.0e-10
WP_006248151.1|1183447_1185424_-	exoribonuclease II	NA	NA	NA	NA	NA
WP_006248149.1|1185583_1185862_+	hypothetical protein	NA	NA	NA	NA	NA
WP_006248148.1|1185886_1186183_+	hypothetical protein	NA	A0A2R2X2B2	Escherichia_phage	42.3	2.1e-12
WP_006248147.1|1186235_1187027_-	SDR family oxidoreductase	NA	NA	NA	NA	NA
WP_006251533.1|1187170_1187944_-	FNR family transcription factor	NA	NA	NA	NA	NA
WP_006248145.1|1188174_1188600_+	universal stress protein	NA	NA	NA	NA	NA
WP_006248143.1|1188794_1191422_+|tRNA	alanine--tRNA ligase	tRNA	A0A2K9L1X7	Tupanvirus	37.1	4.6e-79
1193979:1193997	attR	GTGATGATGAAGCAATGTT	NA	NA	NA	NA
>prophage 7
NC_020833	Mannheimia haemolytica USDA-ARS-USMARC-183, complete sequence	2657957	1355632	1493828	2657957	integrase,protease,transposase,tail,tRNA,terminase,capsid	Mannheimia_phage(78.72%)	163	1355574:1355633	1490450:1490540
1355574:1355633	attL	TTGTAGAAGATCAAACCTAATCTGACAGTCCCCCGTTTTAAATTACCGTGTCTGTCAGAT	NA	NA	NA	NA
WP_015586954.1|1355632_1356673_-|transposase	IS481 family transposase	transposase	A0A0M3LR35	Mannheimia_phage	100.0	1.9e-201
WP_006253551.1|1356875_1358192_-	amino-acid N-acetyltransferase	NA	NA	NA	NA	NA
WP_006253552.1|1358320_1358506_-	DUF1508 domain-containing protein	NA	NA	NA	NA	NA
WP_006249010.1|1358621_1359944_-	Xaa-Pro aminopeptidase	NA	NA	NA	NA	NA
WP_006249011.1|1360159_1360483_+	hypothetical protein	NA	NA	NA	NA	NA
WP_006249013.1|1361774_1361993_+	cell division protein ZapB	NA	NA	NA	NA	NA
WP_006249014.1|1362048_1362630_+	thymidine kinase	NA	A0A2H4YFP5	Citrobacter_phage	52.1	5.6e-54
WP_006249015.1|1362720_1363839_-	anaerobic sulfatase maturase	NA	A0A1B2IB49	Erwinia_phage	28.2	1.3e-06
WP_006249016.1|1363928_1365377_-	sulfatase-like hydrolase/transferase	NA	A0A2P0VMN7	Tetraselmis_virus	27.1	7.1e-13
WP_006249017.1|1365523_1367221_-	solute:sodium symporter family transporter	NA	NA	NA	NA	NA
WP_006249018.1|1367364_1367916_-	Crp/Fnr family transcriptional regulator	NA	NA	NA	NA	NA
WP_006249019.1|1368014_1368824_+	sulfite exporter TauE/SafE family protein	NA	NA	NA	NA	NA
WP_006249020.1|1368840_1369533_-|tRNA	tRNA (adenosine(37)-N6)-threonylcarbamoyltransferase complex dimerization subunit type 1 TsaB	tRNA	NA	NA	NA	NA
WP_006249021.1|1369619_1370702_-	3-deoxy-7-phosphoheptulonate synthase AroG	NA	A0A0B6VT43	Edwardsiella_phage	46.7	6.5e-80
WP_006249022.1|1370790_1371630_-	membrane protein	NA	A0A1I9SA48	Rhodococcus_phage	37.0	1.3e-35
WP_006249023.1|1371781_1374442_-	DNA translocase FtsK	NA	G1FGP1	Mycobacterium_phage	44.0	1.6e-79
WP_006249024.1|1374452_1374935_-	leucine-responsive transcriptional regulator Lrp	NA	NA	NA	NA	NA
WP_006249025.1|1374991_1376110_-	ribonuclease D	NA	NA	NA	NA	NA
WP_006249026.1|1376243_1377431_+	ROK family protein	NA	NA	NA	NA	NA
WP_006249027.1|1377478_1378201_+	dethiobiotin synthase	NA	NA	NA	NA	NA
WP_006249028.1|1378249_1378459_-	ribosome alternative rescue factor ArfA	NA	NA	NA	NA	NA
WP_006249029.1|1378610_1379366_+	class I SAM-dependent methyltransferase	NA	NA	NA	NA	NA
WP_006249030.1|1379396_1380473_+	AI-2E family transporter	NA	NA	NA	NA	NA
WP_006249031.1|1380486_1381425_+	uridine diphosphate-N-acetylglucosamine-binding protein YvcK	NA	A1IMD5	Streptococcus_phage	28.6	6.6e-28
WP_006249032.1|1381474_1384081_-	type I DNA topoisomerase	NA	E3T4K4	Cafeteria_roenbergensis_virus	37.0	3.1e-91
WP_006249033.1|1384210_1385101_+	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_006249034.1|1385150_1385411_-	GlsB/YeaQ/YmgE family stress response membrane protein	NA	NA	NA	NA	NA
WP_006249035.1|1385490_1386450_-	ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_006251052.1|1386646_1387054_-|protease	ClpXP protease specificity-enhancing factor	protease	A0A1S5R3H3	Pseudomonas_phage	40.7	1.7e-20
WP_006249369.1|1387053_1387698_-	stringent starvation protein A	NA	NA	NA	NA	NA
WP_006249370.1|1387871_1388369_+	5-(carboxyamino)imidazole ribonucleotide mutase	NA	NA	NA	NA	NA
WP_015484189.1|1388383_1389349_+	asparaginase	NA	NA	NA	NA	NA
WP_006249372.1|1389367_1390456_+	5-(carboxyamino)imidazole ribonucleotide synthase	NA	NA	NA	NA	NA
WP_006249373.1|1390676_1391087_-	hypothetical protein	NA	NA	NA	NA	NA
WP_006249374.1|1391089_1393108_-	excinuclease ABC subunit B	NA	NA	NA	NA	NA
WP_006249376.1|1393346_1393583_-	type II toxin-antitoxin system ParD family antitoxin	NA	NA	NA	NA	NA
WP_080628642.1|1393745_1394591_+	EfeM/EfeO family lipoprotein	NA	NA	NA	NA	NA
WP_006253556.1|1394604_1395798_+	deferrochelatase/peroxidase EfeB	NA	NA	NA	NA	NA
WP_006249382.1|1396463_1397282_-	PHP domain-containing protein	NA	NA	NA	NA	NA
WP_006249381.1|1397293_1397893_-	hypothetical protein	NA	NA	NA	NA	NA
WP_006249380.1|1397889_1399437_-	exodeoxyribonuclease I	NA	NA	NA	NA	NA
WP_015484183.1|1399856_1400447_+	hypothetical protein	NA	A0A0M3LPE1	Mannheimia_phage	100.0	3.7e-101
WP_006249172.1|1400516_1401035_+	hypothetical protein	NA	A0A0M3LSW2	Mannheimia_phage	100.0	7.7e-95
WP_015484180.1|1401581_1401875_-	hypothetical protein	NA	A0A0M3LSV5	Mannheimia_phage	100.0	1.2e-47
WP_006250517.1|1401989_1402589_-	hypothetical protein	NA	A0A0M3LR33	Mannheimia_phage	100.0	7.5e-110
WP_100067196.1|1402589_1403033_-	hypothetical protein	NA	A0A0M3LS02	Mannheimia_phage	99.3	4.7e-77
WP_095597182.1|1403032_1406026_-	DUF1983 domain-containing protein	NA	A0A0M3LQG1	Mannheimia_phage	99.9	0.0e+00
WP_015484271.1|1406022_1409757_-|tail	bacteriophage tail protein	tail	A0A0M3LQG1	Mannheimia_phage	100.0	0.0e+00
WP_006249176.1|1409766_1410396_-|tail	tail assembly protein	tail	A0A0M3LPS1	Mannheimia_phage	100.0	1.0e-109
WP_006249177.1|1410664_1411396_-	C40 family peptidase	NA	A0A0M3LQI5	Mannheimia_phage	100.0	4.2e-147
WP_006251213.1|1411399_1412116_-|tail	phage minor tail protein L	tail	A0A0M3LPR8	Mannheimia_phage	100.0	4.2e-136
WP_006251214.1|1412123_1412594_-|tail	phage minor tail protein L	tail	A0A0M3LTB9	Mannheimia_phage	100.0	4.2e-84
WP_006251215.1|1412593_1412923_-|tail	phage tail protein	tail	A0A0M3LSV3	Mannheimia_phage	100.0	1.4e-57
WP_006251216.1|1412926_1415422_-|tail	tail length tape measure protein	tail	A0A0M3LSE2	Mannheimia_phage	100.0	0.0e+00
WP_006251218.1|1415966_1416425_-	hypothetical protein	NA	A0A0M3LR40	Mannheimia_phage	100.0	1.2e-78
WP_020824316.1|1416593_1416827_+	hypothetical protein	NA	A0A0M3LQZ8	Mannheimia_phage	100.0	7.0e-40
WP_006251220.1|1416841_1417513_-	hypothetical protein	NA	A0A0M3LPR4	Mannheimia_phage	100.0	2.8e-121
WP_006251221.1|1417608_1417785_+	type II toxin-antitoxin system HicA family toxin	NA	A0A0M3LQ86	Mannheimia_phage	100.0	3.3e-26
WP_006251222.1|1417840_1418257_+	type II toxin-antitoxin system HicB family antitoxin	NA	A0A0M3LQH7	Mannheimia_phage	100.0	4.3e-72
WP_006251223.1|1418296_1418779_-|tail	phage tail protein	tail	A0A0M3LPR0	Mannheimia_phage	100.0	2.3e-85
WP_006251224.1|1418782_1419163_-	hypothetical protein	NA	A0A0M3LTB0	Mannheimia_phage	100.0	7.1e-66
WP_006251225.1|1419159_1419528_-	hypothetical protein	NA	A0A0M3LSU9	Mannheimia_phage	100.0	4.8e-59
WP_006251226.1|1419529_1419874_-	hypothetical protein	NA	A0A0M3LSC9	Mannheimia_phage	100.0	2.2e-61
WP_006251227.1|1419873_1420251_-	hypothetical protein	NA	A0A0M3LQS8	Mannheimia_phage	100.0	7.3e-63
WP_015484272.1|1420253_1420505_-	hypothetical protein	NA	A0A0M3LR32	Mannheimia_phage	100.0	3.5e-21
WP_006251229.1|1420516_1421506_-	hypothetical protein	NA	A0A0M3LQZ1	Mannheimia_phage	100.0	8.6e-188
WP_006251230.1|1421520_1421955_-	hypothetical protein	NA	A0A0M3LPQ2	Mannheimia_phage	100.0	8.7e-76
WP_015587048.1|1421947_1423318_-	hypothetical protein	NA	A0A0M3LQ78	Mannheimia_phage	100.0	1.2e-243
WP_015587047.1|1423304_1424243_-	hypothetical protein	NA	A0A0M3LQH2	Mannheimia_phage	100.0	2.6e-170
WP_006251233.1|1424196_1425573_-	DUF1073 domain-containing protein	NA	A0A0M3LPQ5	Mannheimia_phage	100.0	4.3e-262
WP_015484276.1|1425569_1426790_-|terminase	PBSX family phage terminase large subunit	terminase	A0A0M3LQ32	Mannheimia_phage	100.0	8.3e-241
WP_006250104.1|1426773_1427298_-|terminase	terminase small subunit	terminase	A0A0M3LPC3	Mannheimia_phage	100.0	1.7e-89
WP_006250101.1|1427689_1427863_-	hypothetical protein	NA	A0A0M3LSZ0	Mannheimia_phage	100.0	7.8e-28
WP_006250100.1|1427867_1428218_-	DUF2570 domain-containing protein	NA	A0A0M3LSP1	Mannheimia_phage	100.0	1.1e-28
WP_006250099.1|1428190_1428760_-	lysozyme	NA	A0A0M3LQY4	Mannheimia_phage	100.0	1.5e-107
WP_032845633.1|1428752_1428989_-	hypothetical protein	NA	A0A0M3LR95	Mannheimia_phage	100.0	1.3e-36
WP_006250096.1|1429140_1429311_-	hypothetical protein	NA	A0A0M3LPX3	Mannheimia_phage	100.0	4.6e-25
WP_006251707.1|1429336_1429522_-	hypothetical protein	NA	A0A0M3LQD0	Mannheimia_phage	100.0	5.2e-30
WP_006250094.1|1429841_1430315_-	hypothetical protein	NA	A0A0M3LPW4	Mannheimia_phage	100.0	1.6e-83
WP_006250093.1|1430304_1430874_-	recombination protein NinG	NA	A0A0M3LTG3	Mannheimia_phage	100.0	3.2e-102
WP_006250091.1|1431001_1431196_-	hypothetical protein	NA	A0A0M3LSN2	Mannheimia_phage	100.0	4.6e-29
WP_006250090.1|1431241_1431454_-	hypothetical protein	NA	A0A0M3LQX8	Mannheimia_phage	100.0	8.3e-32
WP_006250089.1|1431503_1432010_-	DUF1367 family protein	NA	A0A0M3LR84	Mannheimia_phage	100.0	7.7e-92
WP_006250088.1|1431993_1432209_-	hypothetical protein	NA	A0A0M3LR43	Mannheimia_phage	100.0	7.2e-39
WP_006250086.1|1432299_1432836_-	DNA methyltransferase	NA	A0A0M3LPV8	Mannheimia_phage	100.0	2.2e-105
WP_006250085.1|1432832_1434194_-	DNA helicase	NA	A0A0M3LQC0	Mannheimia_phage	100.0	7.1e-257
WP_006250084.1|1434190_1435060_-	replication protein	NA	A0A0M3LQL8	Mannheimia_phage	100.0	1.8e-165
WP_006250083.1|1435034_1435205_-	hypothetical protein	NA	A0A0M3LPV5	Mannheimia_phage	100.0	9.7e-23
WP_006253537.1|1435368_1435629_-	hypothetical protein	NA	A0A0M3LTF5	Mannheimia_phage	100.0	3.3e-38
WP_006250080.1|1435649_1435856_-	helix-turn-helix transcriptional regulator	NA	A0A0M3LSY2	Mannheimia_phage	100.0	4.8e-32
WP_006250079.1|1435985_1436645_+	LexA family transcriptional regulator	NA	A0A0M3LSL8	Mannheimia_phage	100.0	1.2e-124
WP_006248823.1|1436695_1437076_+	hypothetical protein	NA	A0A0M3LQX0	Mannheimia_phage	100.0	1.6e-73
WP_020824298.1|1437068_1437566_+	hypothetical protein	NA	A0A0M3LR76	Mannheimia_phage	100.0	2.4e-45
WP_096864247.1|1437675_1438716_+|transposase	IS481 family transposase	transposase	A0A0M3LQ52	Mannheimia_phage	99.7	3.2e-201
WP_006253368.1|1438853_1439159_-	HigA family addiction module antidote protein	NA	A0A0M3LPV0	Mannheimia_phage	100.0	6.6e-54
WP_006250986.1|1439167_1439443_-	plasmid maintenance system killer	NA	A0A0M3LQB1	Mannheimia_phage	100.0	1.7e-48
WP_006250250.1|1439734_1439965_+	hypothetical protein	NA	A0A0M3LQL0	Mannheimia_phage	100.0	6.5e-38
WP_006250251.1|1440346_1440583_+	hypothetical protein	NA	A0A0M3LPU3	Mannheimia_phage	100.0	2.1e-36
WP_006250253.1|1441151_1441658_+	hypothetical protein	NA	A0A0M3LTE5	Mannheimia_phage	100.0	5.7e-95
WP_006250254.1|1441661_1442021_+	hypothetical protein	NA	A0A0M3LSX3	Mannheimia_phage	100.0	4.5e-62
WP_006250255.1|1442017_1442497_+	hypothetical protein	NA	A0A0M3LSK4	Mannheimia_phage	100.0	2.4e-79
WP_006250256.1|1442630_1442843_+	hypothetical protein	NA	A0A0M3LQW3	Mannheimia_phage	100.0	5.8e-33
WP_006253370.1|1442855_1443806_+	hypothetical protein	NA	A0A0M3LR66	Mannheimia_phage	100.0	3.1e-158
WP_006250257.1|1443846_1444641_+	phage recombination protein Bet	NA	A0A0M3LR26	Mannheimia_phage	100.0	5.4e-148
WP_006250258.1|1444637_1445273_+	YqaJ viral recombinase family protein	NA	A0A0M3LPU0	Mannheimia_phage	100.0	3.8e-120
WP_006250259.1|1445285_1445462_+	hypothetical protein	NA	A0A0M3LPL3	Mannheimia_phage	93.5	3.1e-08
WP_015484282.1|1445482_1445935_+	hypothetical protein	NA	A0A0M3LQA6	Mannheimia_phage	100.0	6.3e-85
WP_006250261.1|1446012_1446540_+	DUF551 domain-containing protein	NA	A0A0M3LQK2	Mannheimia_phage	100.0	1.7e-86
WP_006250262.1|1446536_1446740_+	hypothetical protein	NA	A0A0M3LPT5	Mannheimia_phage	100.0	1.0e-31
WP_006250263.1|1446723_1447188_+	hypothetical protein	NA	A0A0M3LTD8	Mannheimia_phage	100.0	5.3e-87
WP_020824296.1|1447687_1448179_+	class I SAM-dependent methyltransferase	NA	A0A0M3LQH0	Mannheimia_phage	100.0	5.4e-98
WP_015484286.1|1448205_1448463_+	hypothetical protein	NA	A0A0M3LQR4	Mannheimia_phage	100.0	1.2e-40
WP_015484287.1|1448459_1449449_-|integrase	site-specific integrase	integrase	A0A0M3LQN1	Mannheimia_phage	100.0	7.6e-184
WP_006249379.1|1449921_1451325_+|tRNA	asparagine--tRNA ligase	tRNA	A0A1V0SDB6	Indivirus	37.7	6.9e-82
WP_006249378.1|1451424_1452417_-	EF-P beta-lysylation protein EpmB	NA	NA	NA	NA	NA
WP_006253558.1|1452470_1453040_-	hypothetical protein	NA	NA	NA	NA	NA
WP_006250738.1|1453206_1453773_+	elongation factor P	NA	NA	NA	NA	NA
WP_006250739.1|1453839_1454730_-	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_006250301.1|1454836_1455412_+	NAD(P)H-binding protein	NA	NA	NA	NA	NA
WP_006250302.1|1455462_1455906_+	nuclear transport factor 2 family protein	NA	NA	NA	NA	NA
WP_006250304.1|1456066_1457737_+|tRNA	glutamine--tRNA ligase	tRNA	A0A222YZ70	Escherichia_phage	77.5	3.6e-255
WP_006253559.1|1458003_1458969_-	LacI family DNA-binding transcriptional regulator	NA	NA	NA	NA	NA
WP_006250748.1|1459130_1460471_-	NADP-specific glutamate dehydrogenase	NA	NA	NA	NA	NA
WP_006249037.1|1460663_1461005_-	outer membrane protein assembly factor BamE	NA	NA	NA	NA	NA
WP_006249038.1|1461071_1462073_-	nucleoid-associated protein YejK	NA	A0A1V0E8C0	Vibrio_phage	46.5	5.3e-76
WP_006249039.1|1462153_1462540_+	RidA family protein	NA	NA	NA	NA	NA
WP_006249040.1|1462571_1463309_+	peptidoglycan editing factor PgeF	NA	NA	NA	NA	NA
WP_006250224.1|1463680_1464895_+|integrase	tyrosine-type recombinase/integrase	integrase	A0A1B5FPC6	Escherichia_phage	35.5	6.2e-55
WP_006250227.1|1465364_1465571_+	AlpA family transcriptional regulator	NA	A0A1V0E8E5	Vibrio_phage	35.0	1.7e-05
WP_006250228.1|1465580_1466240_+	hypothetical protein	NA	NA	NA	NA	NA
WP_006250229.1|1466250_1467201_+|capsid	phage capsid protein	capsid	E5G6M6	Salmonella_phage	37.1	4.0e-49
WP_006250230.1|1467197_1467392_+	hypothetical protein	NA	NA	NA	NA	NA
WP_006250231.1|1467509_1468358_+	hypothetical protein	NA	NA	NA	NA	NA
WP_006250232.1|1468435_1468687_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_006250233.1|1468686_1469067_+	hypothetical protein	NA	NA	NA	NA	NA
WP_006250235.1|1469377_1470439_+	ash family protein	NA	NA	NA	NA	NA
WP_006250236.1|1470431_1470596_+	hypothetical protein	NA	NA	NA	NA	NA
WP_006250237.1|1470588_1471224_+	hypothetical protein	NA	NA	NA	NA	NA
WP_006250238.1|1471217_1471436_+	hypothetical protein	NA	NA	NA	NA	NA
WP_006253562.1|1471577_1472063_+	hypothetical protein	NA	NA	NA	NA	NA
WP_006253564.1|1472944_1473424_+|integrase	integrase arm-type DNA-binding domain-containing protein	integrase	NA	NA	NA	NA
WP_134983791.1|1473392_1474157_+|integrase	tyrosine-type recombinase/integrase	integrase	A0A1B5FPC6	Escherichia_phage	44.5	2.8e-53
WP_006250240.1|1474206_1474497_+	hypothetical protein	NA	NA	NA	NA	NA
WP_076621564.1|1475230_1475506_+	hypothetical protein	NA	NA	NA	NA	NA
WP_006250242.1|1475483_1475807_+	putative addiction module antidote protein	NA	A4JWV1	Burkholderia_virus	44.7	7.8e-13
WP_006250244.1|1476374_1476623_+	DUF4102 domain-containing protein	NA	NA	NA	NA	NA
WP_006250245.1|1476674_1477262_+	SocA family protein	NA	NA	NA	NA	NA
WP_006250946.1|1478580_1480968_+	autotransporter domain-containing protein	NA	NA	NA	NA	NA
WP_006249222.1|1481134_1481671_-	hypoxanthine phosphoribosyltransferase	NA	A0A218MMB5	uncultured_virus	33.9	9.9e-13
WP_006249223.1|1481709_1483059_-|protease	metalloprotease PmbA	protease	NA	NA	NA	NA
WP_006249224.1|1483157_1483688_+	ribosome-associated protein	NA	NA	NA	NA	NA
WP_006249225.1|1483693_1484065_+	SirB2 family protein	NA	NA	NA	NA	NA
WP_006249226.1|1484077_1484791_+	DUF554 domain-containing protein	NA	NA	NA	NA	NA
WP_031192904.1|1484793_1485357_+	UbiX family flavin prenyltransferase	NA	NA	NA	NA	NA
WP_006249228.1|1485419_1485860_+	hypothetical protein	NA	NA	NA	NA	NA
WP_006249229.1|1485863_1486739_-	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_006249230.1|1486844_1488920_+	TonB-dependent siderophore receptor	NA	NA	NA	NA	NA
WP_006249231.1|1488963_1490400_+	DUF3327 domain-containing protein	NA	NA	NA	NA	NA
WP_075271292.1|1490804_1491344_-|tail	phage tail tape measure protein	tail	A0A0M3LPB6	Mannheimia_phage	78.1	2.5e-56
1490450:1490540	attR	TTGTAGAAGATCAAACCTAATCTGACAGTCCCCCGTTTTAAATTACCGTGTCTGTCAGATTAATTTGAGCTTAAATTCTTTTCCACCCAAA	NA	NA	NA	NA
WP_006253419.1|1491442_1491694_+	helix-turn-helix transcriptional regulator	NA	F6MII3	Haemophilus_phage	77.4	7.8e-29
WP_006249232.1|1491889_1492090_-	sulfurtransferase TusA family protein	NA	NA	NA	NA	NA
WP_006249233.1|1492148_1492661_-	hemerythrin domain-containing protein	NA	NA	NA	NA	NA
WP_006249234.1|1492673_1493828_-|tRNA	tRNA guanosine(34) transglycosylase Tgt	tRNA	A0A1B1IVQ4	uncultured_Mediterranean_phage	46.2	4.8e-89
>prophage 8
NC_020833	Mannheimia haemolytica USDA-ARS-USMARC-183, complete sequence	2657957	1637943	1644728	2657957		Organic_Lake_phycodnavirus(16.67%)	9	NA	NA
WP_006248955.1|1637943_1638996_-	rod shape-determining protein	NA	F2Y2E1	Organic_Lake_phycodnavirus	22.1	1.2e-06
WP_006248954.1|1639110_1639740_-	amino acid transporter	NA	NA	NA	NA	NA
WP_006248953.1|1639843_1640491_+	uridine kinase	NA	A0A1V0SAA3	Catovirus	36.6	4.7e-33
WP_006248952.1|1640505_1641087_+	dCTP deaminase	NA	I4AZP2	Saccharomonospora_phage	38.4	5.9e-27
WP_006248951.1|1641164_1641320_+	DUF1328 domain-containing protein	NA	NA	NA	NA	NA
WP_006248950.1|1641448_1642051_-	DedA family protein	NA	NA	NA	NA	NA
WP_006248949.1|1642052_1643072_-	HTH-type transcriptional repressor PurR	NA	C6ZCU4	Enterobacteria_phage	32.9	1.9e-33
WP_006248948.1|1643207_1643936_-	carboxy-S-adenosyl-L-methionine synthase CmoA	NA	H9YRL8	environmental_Halophage	29.1	7.1e-22
WP_006253612.1|1643945_1644728_-	alpha/beta fold hydrolase	NA	G1DB77	Mycobacterium_phage	36.4	1.3e-05
>prophage 9
NC_020833	Mannheimia haemolytica USDA-ARS-USMARC-183, complete sequence	2657957	2056643	2140605	2657957	plate,protease,transposase,tail,tRNA,head	Mannheimia_phage(18.75%)	93	NA	NA
WP_006249053.1|2056643_2057891_+|protease	ATP-dependent protease ATP-binding subunit ClpX	protease	G3M9Z9	Bacillus_virus	54.4	1.3e-119
WP_006249052.1|2057929_2058682_+	Fic family protein	NA	NA	NA	NA	NA
WP_006249051.1|2058717_2059047_-	hypothetical protein	NA	NA	NA	NA	NA
WP_006249050.1|2059050_2059233_-	hypothetical protein	NA	NA	NA	NA	NA
WP_006249049.1|2059367_2059772_+	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_006249048.1|2059773_2060775_+	tetraacyldisaccharide 4'-kinase	NA	NA	NA	NA	NA
WP_006249047.1|2060752_2060914_+	tetraacyldisaccharide 4'-kinase	NA	NA	NA	NA	NA
WP_006249046.1|2061001_2062018_+	UDP-glucose 4-epimerase GalE	NA	A0A2K9L1R4	Tupanvirus	48.9	7.2e-89
WP_006249045.1|2062077_2063238_+	hypothetical protein	NA	NA	NA	NA	NA
WP_006249044.1|2063286_2064069_-	methylenetetrahydrofolate reductase	NA	NA	NA	NA	NA
WP_006249043.1|2064116_2066003_+	TonB-dependent receptor plug domain-containing protein	NA	NA	NA	NA	NA
WP_006249042.1|2065992_2066316_-	putative addiction module antidote protein	NA	NA	NA	NA	NA
WP_006253677.1|2066299_2066635_-	type II toxin-antitoxin system RelE/ParE family toxin	NA	NA	NA	NA	NA
WP_006249330.1|2066815_2067784_+	iron ABC transporter permease	NA	NA	NA	NA	NA
WP_006249329.1|2067780_2068518_+	ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	27.6	8.0e-13
WP_006253678.1|2068785_2069421_-	hypothetical protein	NA	NA	NA	NA	NA
WP_006251873.1|2069423_2070158_-	restriction endonuclease subunit S	NA	NA	NA	NA	NA
WP_006250042.1|2071639_2073643_-	N-6 DNA methylase	NA	B3GAM1	uncultured_virus	37.3	1.5e-16
WP_006250041.1|2073750_2077467_-	methionine synthase	NA	A0A140XBC7	Dickeya_phage	70.0	1.3e-18
WP_006250039.1|2077632_2078916_+	MFS transporter	NA	NA	NA	NA	NA
WP_006250037.1|2079259_2079928_+	ABC transporter ATP-binding protein	NA	F2Y2R6	Organic_Lake_phycodnavirus	28.9	2.0e-10
WP_005624547.1|2079924_2080806_+	ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_015484414.1|2080805_2081621_+	iron chelate uptake ABC transporter family permease subunit	NA	NA	NA	NA	NA
WP_015484415.1|2081617_2082754_+	iron ABC transporter permease	NA	A0A2H4IY97	uncultured_Caudovirales_phage	27.5	1.8e-19
WP_006253680.1|2082781_2083180_+	TonB-dependent receptor plug domain-containing protein	NA	NA	NA	NA	NA
WP_006253681.1|2083214_2084918_+	TonB-dependent siderophore receptor	NA	NA	NA	NA	NA
WP_006250036.1|2085029_2085674_+	adenylate kinase	NA	A0A1B4XWI3	Tenacibaculum_phage	36.6	6.5e-11
WP_006250035.1|2085735_2086551_-	hypothetical protein	NA	NA	NA	NA	NA
WP_006250034.1|2086740_2086956_+	YdcH family protein	NA	NA	NA	NA	NA
WP_006250033.1|2087014_2088172_-	chorismate mutase	NA	NA	NA	NA	NA
WP_006250032.1|2088293_2090360_-	oligopeptidase A	NA	A0A1V0SD92	Indivirus	23.8	1.2e-50
WP_006250031.1|2090490_2091231_-	pyruvate formate lyase 1-activating protein	NA	A0A2P0VNQ0	Tetraselmis_virus	25.7	4.2e-22
WP_006250030.1|2091479_2092505_-	virulence RhuM family protein	NA	Q9JMN3	Wolbachia_phage	54.3	1.3e-90
WP_006249872.1|2092739_2095064_-	formate C-acetyltransferase	NA	A0A2P0VNR5	Tetraselmis_virus	41.4	1.4e-159
WP_006249873.1|2095153_2095978_-	formate transporter FocA	NA	NA	NA	NA	NA
WP_006253683.1|2096178_2096673_+	DedA family protein	NA	NA	NA	NA	NA
WP_006253684.1|2096726_2097596_-|protease	protease HtpX	protease	NA	NA	NA	NA
WP_006253685.1|2097683_2098766_-	DNA polymerase IV	NA	NA	NA	NA	NA
WP_006249627.1|2098888_2099800_+	lysine exporter LysO family protein	NA	NA	NA	NA	NA
WP_006249628.1|2099954_2101721_+|tRNA	aspartate--tRNA ligase	tRNA	A0A2K9L3L6	Tupanvirus	25.5	1.0e-13
WP_006249629.1|2102040_2104479_+	S6 family igA-specific metalloendopeptidase	NA	Q9LA58	Enterobacterial_phage	33.7	6.0e-49
WP_006249630.1|2104515_2105304_-	hypothetical protein	NA	F6MIM2	Haemophilus_phage	68.3	2.5e-105
WP_006249632.1|2105655_2106360_-	hypothetical protein	NA	NA	NA	NA	NA
WP_006249633.1|2106352_2106517_-	hypothetical protein	NA	NA	NA	NA	NA
WP_006249634.1|2106526_2106814_-	hypothetical protein	NA	NA	NA	NA	NA
WP_006249635.1|2106813_2107089_-	hypothetical protein	NA	A0A0M3LNN9	Mannheimia_phage	73.5	5.4e-31
WP_006249636.1|2107072_2107675_-	hypothetical protein	NA	A0A0R6PC75	Moraxella_phage	31.4	5.0e-05
WP_006249637.1|2107675_2109955_-|tail	tail fiber protein	tail	A0A0R6PHL4	Moraxella_phage	33.3	1.4e-18
WP_006249638.1|2109964_2110531_-|tail	phage tail protein	tail	Q6QI98	Burkholderia_phage	48.7	2.8e-42
WP_006249639.1|2110523_2111627_-|plate	baseplate J/gp47 family protein	plate	Q6QI99	Burkholderia_phage	37.3	9.4e-58
WP_006249640.1|2111636_2111999_-|plate	phage baseplate protein	plate	NA	NA	NA	NA
WP_006249641.1|2112053_2112590_-|plate	phage baseplate assembly protein V	plate	NA	NA	NA	NA
WP_006249642.1|2112576_2113641_-	hypothetical protein	NA	A4JWL3	Burkholderia_virus	41.6	5.6e-68
WP_006249643.1|2113633_2113861_-	membrane protein	NA	A4JWL2	Burkholderia_virus	47.8	7.1e-13
WP_006249644.1|2113844_2114768_-|tail	phage tail protein	tail	Q6QIA4	Burkholderia_phage	29.1	3.6e-18
WP_006249645.1|2114777_2117435_-|tail	phage tail tape measure protein	tail	Q19UR0	Mannheimia_phage	47.4	1.4e-14
WP_006249646.1|2117482_2117785_+	hypothetical protein	NA	NA	NA	NA	NA
WP_080542703.1|2117763_2117916_-|tail	GpE family phage tail protein	tail	NA	NA	NA	NA
WP_006249647.1|2117912_2118227_-|tail	phage tail assembly protein	tail	NA	NA	NA	NA
WP_006249648.1|2118322_2118838_-|tail	phage major tail tube protein	tail	K4NZR9	Burkholderia_phage	25.3	4.6e-07
WP_006249649.1|2118848_2120234_-|tail	phage tail protein	tail	A4JWK5	Burkholderia_virus	43.3	3.2e-95
WP_006249650.1|2120318_2120816_-	hypothetical protein	NA	NA	NA	NA	NA
WP_006249651.1|2120821_2121256_-	DUF1320 domain-containing protein	NA	A4JWK2	Burkholderia_virus	40.7	7.7e-16
WP_006249652.1|2121255_2121537_-	hypothetical protein	NA	NA	NA	NA	NA
WP_006249653.1|2121605_2122532_-	hypothetical protein	NA	A4JWK0	Burkholderia_virus	48.7	5.4e-75
WP_006249654.1|2122562_2123678_-	hypothetical protein	NA	A4JWJ9	Burkholderia_virus	38.4	2.3e-64
WP_006249655.1|2123912_2124377_-	phage virion morphogenesis protein	NA	R9U1C4	Rhizobium_phage	35.2	1.6e-14
WP_006249656.1|2124440_2124785_+	hypothetical protein	NA	NA	NA	NA	NA
WP_006249658.1|2124986_2126264_-|head	phage head morphogenesis protein	head	J9STS2	Pseudomonas_phage	48.6	1.3e-55
WP_006249659.1|2126256_2127711_-	DUF935 family protein	NA	Q6QIC0	Burkholderia_phage	46.8	4.8e-118
WP_006249661.1|2127829_2129386_-	hypothetical protein	NA	A0A2I7S9C5	Vibrio_phage	60.2	1.4e-160
WP_006249662.1|2129385_2129958_-	DUF3486 family protein	NA	M4MCR3	Vibrio_phage	45.5	8.0e-37
WP_006249663.1|2129980_2130277_-	hypothetical protein	NA	A0A0C4UR00	Shigella_phage	58.9	3.6e-25
WP_006249664.1|2130278_2130614_-	DUF2730 domain-containing protein	NA	NA	NA	NA	NA
WP_006249665.1|2130613_2130766_-	hypothetical protein	NA	A0A0M3LQ02	Mannheimia_phage	51.1	1.1e-06
WP_015484419.1|2130792_2131140_-	DUF2681 domain-containing protein	NA	A0A0M3LP93	Mannheimia_phage	60.9	3.4e-30
WP_006249667.1|2131133_2131403_-	DUF2644 domain-containing protein	NA	NA	NA	NA	NA
WP_006249668.1|2131405_2131915_-	glycoside hydrolase family 108 protein	NA	A0A0M3LSH2	Mannheimia_phage	66.2	1.1e-56
WP_006249669.1|2132050_2132410_-	transcriptional regulator	NA	Q6QIE8	Burkholderia_phage	45.1	1.1e-23
WP_006249670.1|2132574_2133108_-	hypothetical protein	NA	F6MIJ5	Haemophilus_phage	53.7	5.0e-41
WP_006249671.1|2133094_2133640_-	DUF1018 domain-containing protein	NA	A0A2I7S9B8	Vibrio_phage	33.2	7.5e-16
WP_006249672.1|2133758_2134046_-	hypothetical protein	NA	NA	NA	NA	NA
WP_006249673.1|2134094_2134484_-	hypothetical protein	NA	NA	NA	NA	NA
WP_006249674.1|2134500_2134683_-	hypothetical protein	NA	A0A0M3LSN0	Mannheimia_phage	81.7	1.1e-19
WP_051133738.1|2134692_2134911_-	ANR family transcriptional regulator	NA	A0A0M3LSH0	Mannheimia_phage	85.0	1.1e-10
WP_006249676.1|2135032_2135326_-	hypothetical protein	NA	NA	NA	NA	NA
WP_006249677.1|2135309_2135546_-	hypothetical protein	NA	NA	NA	NA	NA
WP_006249678.1|2135557_2135872_-	hypothetical protein	NA	F6MII9	Haemophilus_phage	61.5	1.6e-26
WP_006249679.1|2135874_2136816_-	AAA family ATPase	NA	A0A0C4UQR3	Shigella_phage	48.4	1.3e-63
WP_006253638.1|2136847_2137336_+	hypothetical protein	NA	NA	NA	NA	NA
WP_006249681.1|2137515_2139486_-|transposase	transposase	transposase	C9DGL1	Escherichia_phage	44.1	4.3e-146
WP_006253637.1|2139495_2139714_-	transcriptional regulator	NA	A0A0M3LPY8	Mannheimia_phage	71.8	1.1e-21
WP_006249683.1|2139927_2140605_+	helix-turn-helix transcriptional regulator	NA	A0A0M3LP76	Mannheimia_phage	36.6	6.2e-36
