The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
NZ_CP012179	Pseudomonas syringae pv. actinidiae ICMP 18708 chromosome, complete genome	6555571	220726	284664	6555571	transposase,protease	Planktothrix_phage(20.0%)	56	NA	NA
WP_170870105.1|220726_221170_-|protease	ATP-dependent zinc protease	protease	NA	NA	NA	NA
WP_020313765.1|221219_222002_-	EAL domain-containing protein	NA	NA	NA	NA	NA
WP_017683485.1|222169_222577_+	RNA-binding protein S4	NA	NA	NA	NA	NA
WP_017683486.1|222736_223639_+	Hsp33 family molecular chaperone HslO	NA	NA	NA	NA	NA
WP_003377905.1|223818_225363_+	phosphoenolpyruvate carboxykinase	NA	A0A2H4PQN1	Staphylococcus_phage	49.0	1.2e-127
WP_017683487.1|225435_225867_-	type VI secretion system amidase immunity protein Tai4	NA	NA	NA	NA	NA
WP_017683488.1|226623_227808_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017683490.1|228412_228913_+	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_003382330.1|228936_229551_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003382329.1|229647_230355_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017683492.1|230482_230932_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003382327.1|231367_232081_-	DUF861 domain-containing protein	NA	NA	NA	NA	NA
WP_003382326.1|232416_233274_-	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_017683494.1|233806_234475_+	haloacid dehalogenase type II	NA	NA	NA	NA	NA
WP_003382324.1|234540_235815_+	FAD-binding oxidoreductase	NA	NA	NA	NA	NA
WP_003382322.1|235908_237546_+	ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_017683495.1|237578_238535_+	ABC transporter permease	NA	NA	NA	NA	NA
WP_017683496.1|238531_239410_+	ABC transporter permease	NA	NA	NA	NA	NA
WP_003382317.1|239411_241253_+	ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	33.2	5.3e-21
WP_003382315.1|241249_241561_+	(2Fe-2S)-binding protein	NA	NA	NA	NA	NA
WP_017683497.1|241539_242949_+	FAD-dependent oxidoreductase	NA	NA	NA	NA	NA
WP_003382312.1|242945_244100_+	FAD-binding oxidoreductase	NA	NA	NA	NA	NA
WP_003382311.1|244096_245254_+	acetylornithine deacetylase	NA	NA	NA	NA	NA
WP_017683498.1|245368_246826_+	NAD-dependent succinate-semialdehyde dehydrogenase	NA	NA	NA	NA	NA
WP_017682616.1|247043_248303_+|transposase	IS256 family transposase	transposase	A0A218MNI5	uncultured_virus	41.7	5.7e-43
WP_003382309.1|250252_251182_-	glyoxylate/hydroxypyruvate reductase A	NA	M1I636	Acanthocystis_turfacea_Chlorella_virus	26.8	1.7e-12
WP_017683995.1|251466_252771_+	4-aminobutyrate--2-oxoglutarate transaminase	NA	NA	NA	NA	NA
WP_020304346.1|252852_253509_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002555947.1|253556_254045_+	Lrp/AsnC family transcriptional regulator	NA	NA	NA	NA	NA
WP_017683994.1|254073_254532_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_017683993.1|254937_256449_+	methyl-accepting chemotaxis protein	NA	A0A2H4J162	uncultured_Caudovirales_phage	45.1	1.7e-33
WP_017683992.1|256464_258048_-	ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	34.0	4.5e-21
WP_017683991.1|258049_259072_-	ABC transporter permease	NA	NA	NA	NA	NA
WP_005745742.1|259071_260139_-	microcin C ABC transporter permease YejB	NA	NA	NA	NA	NA
WP_017683990.1|260140_262024_-	ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_017683989.1|262168_264994_-	TonB-dependent receptor	NA	A0A0P0I887	Acinetobacter_phage	24.3	3.2e-33
WP_005739842.1|265093_265495_-	biopolymer transporter ExbD	NA	NA	NA	NA	NA
WP_005887863.1|265494_266202_-	MotA/TolQ/ExbB proton channel family protein	NA	NA	NA	NA	NA
WP_074556880.1|266252_267074_-	energy transducer TonB	NA	NA	NA	NA	NA
WP_017683987.1|268272_269427_-	aminotransferase class V-fold PLP-dependent enzyme	NA	A0A1X7C038	Faustovirus	30.9	1.3e-30
WP_005613713.1|269783_270254_+	Lrp/AsnC family transcriptional regulator	NA	NA	NA	NA	NA
WP_017683986.1|270337_270592_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017683985.1|270693_271368_-	HAD family hydrolase	NA	NA	NA	NA	NA
WP_164706461.1|271778_272955_+|transposase	IS3 family transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	39.0	6.3e-52
WP_017684969.1|272977_273841_-	PDZ domain-containing protein	NA	NA	NA	NA	NA
WP_017684971.1|274538_275483_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017684972.1|275843_276434_-	hypothetical protein	NA	NA	NA	NA	NA
WP_074291564.1|276531_277671_-	RNA-directed DNA polymerase	NA	NA	NA	NA	NA
WP_032685461.1|277761_278829_+|transposase	IS630-like element ISPsy32 family transposase	transposase	NA	NA	NA	NA
WP_017685226.1|278920_279160_-	hypothetical protein	NA	A4JWV2	Burkholderia_virus	46.3	5.6e-08
WP_017685014.1|279722_280424_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017685013.1|280819_281890_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017685012.1|282184_282526_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017685011.1|282525_282837_-	hypothetical protein	NA	NA	NA	NA	NA
WP_020362375.1|282846_283083_-	hypothetical protein	NA	NA	NA	NA	NA
WP_032685517.1|283326_284664_+|transposase	IS4-like element ISPsy33 family transposase	transposase	NA	NA	NA	NA
>prophage 2
NZ_CP012179	Pseudomonas syringae pv. actinidiae ICMP 18708 chromosome, complete genome	6555571	287704	324803	6555571	transposase,head,integrase,terminase,plate,lysis,tail,capsid,portal	Pseudomonas_phage(70.0%)	47	284734:284780	321603:321649
284734:284780	attL	TATGGTGCCGGCACCAGGAGTCGAACCCGGGACCTACTGATTACAAG	NA	NA	NA	NA
WP_017684991.1|287704_288694_-|integrase	integrase	integrase	V9IQN0	Stenotrophomonas_phage	40.5	2.3e-63
WP_099818608.1|288719_290299_-|transposase	IS3-like element ISPsy31 family transposase	transposase	NA	NA	NA	NA
WP_017685236.1|290393_290624_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017699573.1|290717_291014_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017684588.1|291023_293735_-	toprim domain-containing protein	NA	A0A2H4J936	uncultured_Caudovirales_phage	53.8	1.1e-282
WP_017684589.1|293734_293968_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017684590.1|294045_294411_-	hypothetical protein	NA	NA	NA	NA	NA
WP_005730150.1|294407_294908_-	hypothetical protein	NA	A0A2H4JG61	uncultured_Caudovirales_phage	58.3	5.4e-45
WP_005730151.1|294916_295117_-	DNA-binding protein	NA	A0A2H4JE67	uncultured_Caudovirales_phage	50.8	2.5e-09
WP_010209639.1|295201_295537_+	helix-turn-helix transcriptional regulator	NA	K4NXA8	Burkholderia_phage	48.8	1.7e-10
WP_005730154.1|295638_295815_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003373152.1|295856_296117_-	ogr/Delta-like zinc finger family protein	NA	Q8HA63	Vibrio_phage	45.0	9.6e-14
WP_025987065.1|296192_297074_-|portal	phage portal protein	portal	A0A0U4B0L9	Pseudomonas_phage	77.4	7.1e-101
WP_017684592.1|296970_299025_-|terminase	terminase	terminase	A0A0U4JIZ9	Pseudomonas_phage	72.0	1.3e-267
WP_003373145.1|299186_300119_+|capsid	GPO family capsid scaffolding protein	capsid	A0A0U4JVV6	Pseudomonas_phage	55.9	5.3e-62
WP_003373144.1|300120_301143_+|capsid	phage major capsid protein, P2 family	capsid	A0A0U4K5I9	Pseudomonas_phage	65.6	4.7e-120
WP_017684593.1|301139_301862_+|terminase	terminase	terminase	A0A0U4JEJ1	Pseudomonas_phage	70.4	1.0e-81
WP_017684448.1|302006_302306_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017684447.1|302404_302701_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017684446.1|302799_303096_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017684445.1|303131_303593_+|head	head completion/stabilization protein	head	A0A0U4J933	Pseudomonas_phage	59.5	8.7e-42
WP_010216271.1|303589_304033_+|tail	phage tail protein	tail	A0A0U4IBS7	Pseudomonas_phage	64.4	9.3e-49
WP_017684444.1|304022_304700_+	phage virion morphogenesis protein	NA	A0A0U4ISN1	Pseudomonas_phage	55.7	7.0e-56
WP_017684443.1|304714_305827_+	DUF2586 family protein	NA	A0A0U4KLE6	Pseudomonas_phage	66.3	1.9e-135
WP_017684442.1|305934_306270_+	DUF2597 family protein	NA	A0A0U3TH58	Pseudomonas_phage	72.7	5.4e-41
WP_010216281.1|306269_306482_+	TraR/DksA family transcriptional regulator	NA	NA	NA	NA	NA
WP_017684441.1|306478_306685_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017684440.1|306681_307209_+	lysozyme	NA	NA	NA	NA	NA
WP_017684439.1|307205_307685_+|lysis	lysis protein	lysis	A0A0U4JXC2	Pseudomonas_phage	44.3	4.4e-20
WP_010216289.1|307718_308009_+	hypothetical protein	NA	A0A0U4B0P2	Pseudomonas_phage	65.5	3.7e-22
WP_003342293.1|308029_308173_+	hypothetical protein	NA	A0A0U4B0S4	Pseudomonas_phage	73.9	1.1e-14
WP_017684438.1|308178_310470_+|tail	phage tail tape measure protein	tail	A0A0U4IJ81	Pseudomonas_phage	44.0	8.3e-117
WP_003342289.1|310469_310787_+	DUF2590 family protein	NA	A0A0U4B0N5	Pseudomonas_phage	78.4	1.3e-36
WP_017684437.1|310783_311953_+|plate	baseplate J/gp47 family protein	plate	A0A0U4JJ14	Pseudomonas_phage	70.0	6.0e-156
WP_004407232.1|311949_312474_+|tail	phage tail protein	tail	A0A0U4JVX3	Pseudomonas_phage	75.9	2.9e-73
WP_017684436.1|312482_314927_+|tail	phage tail protein	tail	A0A0U4K5K2	Pseudomonas_phage	59.6	3.3e-119
WP_017684435.1|314927_315527_+|tail	tail protein	tail	B5TK82	Pseudomonas_phage	41.7	6.7e-18
WP_017684434.1|315523_316450_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017699497.1|316446_316977_+	hypothetical protein	NA	A0A0U4J942	Pseudomonas_phage	57.0	2.5e-48
WP_017684846.1|316973_317684_+	hypothetical protein	NA	A0A2I7RNK1	Vibrio_phage	38.3	2.6e-37
WP_017684847.1|317656_318628_+	hypothetical protein	NA	A0A0U4IBV2	Pseudomonas_phage	65.0	3.1e-121
WP_017684848.1|318711_319497_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017684850.1|319885_320134_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017684851.1|320595_321006_-	hypothetical protein	NA	NA	NA	NA	NA
WP_020313716.1|321784_322027_+	hypothetical protein	NA	NA	NA	NA	NA
321603:321649	attR	TATGGTGCCGGCACCAGGAGTCGAACCCGGGACCTACTGATTACAAG	NA	NA	NA	NA
WP_017684853.1|322439_323453_+	J domain-containing protein	NA	F2Y2Y5	Organic_Lake_phycodnavirus	45.9	2.8e-08
WP_017682616.1|323543_324803_+|transposase	IS256 family transposase	transposase	A0A218MNI5	uncultured_virus	41.7	5.7e-43
>prophage 3
NZ_CP012179	Pseudomonas syringae pv. actinidiae ICMP 18708 chromosome, complete genome	6555571	466372	539304	6555571	transposase,tRNA,plate,lysis,tail	Pseudomonas_phage(42.42%)	66	NA	NA
WP_085991147.1|466372_467951_+|transposase	IS3-like element ISPsy31 family transposase	transposase	NA	NA	NA	NA
WP_017683806.1|469673_471383_-	RNA-directed DNA polymerase	NA	NA	NA	NA	NA
WP_017704201.1|471826_473245_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017683805.1|474051_474375_-	winged helix-turn-helix transcriptional regulator	NA	A0A0K0PVG9	Roseobacter_phage	46.7	1.5e-08
WP_017683804.1|475428_477906_-	EAL domain-containing protein	NA	A0A127AWB9	Bacillus_phage	37.5	6.4e-14
WP_017683803.1|478164_480015_-	RNA polymerase sigma factor RpoD	NA	A0A2I7SAT0	Vibrio_phage	34.7	2.6e-36
WP_003377265.1|480082_482041_-	DNA primase	NA	A0A0K1LMQ9	Caulobacter_phage	38.0	2.8e-73
WP_002551877.1|482509_482725_-	30S ribosomal protein S21	NA	NA	NA	NA	NA
WP_003377268.1|482922_483948_+|tRNA	tRNA (adenosine(37)-N6)-threonylcarbamoyltransferase complex transferase subunit TsaD	tRNA	A0A0R6PI74	Moraxella_phage	56.1	6.1e-104
WP_005614129.1|484000_484570_-	glycerol-3-phosphate 1-O-acyltransferase PlsY	NA	NA	NA	NA	NA
WP_003377271.1|484644_484998_+	dihydroneopterin aldolase	NA	NA	NA	NA	NA
WP_003377273.1|484988_485513_+	2-amino-4-hydroxy-6- hydroxymethyldihydropteridine diphosphokinase	NA	NA	NA	NA	NA
WP_017683802.1|485609_486839_-	multifunctional CCA addition/repair protein	NA	A0A0F6YPT7	Sinorhizobium_phage	46.5	3.0e-81
WP_003377278.1|486936_488499_-	SpoVR family protein	NA	NA	NA	NA	NA
WP_003377280.1|488495_489767_-	YeaH/YhbH family protein	NA	A0A140HLI1	Bacillus_phage	40.4	4.9e-10
WP_017683801.1|489888_491811_-	PrkA family serine protein kinase	NA	NA	NA	NA	NA
WP_003377284.1|492096_492417_-	thiosulfate sulfurtransferase GlpE	NA	NA	NA	NA	NA
WP_003377287.1|492413_493316_-	symmetrical bis(5'-nucleosyl)-tetraphosphatase	NA	A0A291L9W7	Bordetella_phage	43.8	2.8e-07
WP_003377289.1|493315_493696_-	Co2+/Mg2+ efflux protein ApaG	NA	NA	NA	NA	NA
WP_003377290.1|493809_494616_-	16S rRNA (adenine(1518)-N(6)/adenine(1519)-N(6))- dimethyltransferase RsmA	NA	NA	NA	NA	NA
WP_003377292.1|494612_495602_-	4-hydroxythreonine-4-phosphate dehydrogenase PdxA	NA	NA	NA	NA	NA
WP_003377294.1|495598_496921_-	peptidylprolyl isomerase	NA	NA	NA	NA	NA
WP_003377296.1|496901_499682_-	LPS-assembly protein LptD	NA	NA	NA	NA	NA
WP_017683799.1|499811_500837_+	phosphotransferase	NA	NA	NA	NA	NA
WP_003377300.1|500916_501588_+	nucleotidyltransferase family protein	NA	NA	NA	NA	NA
WP_003377303.1|501588_502356_+	TerB family tellurite resistance protein	NA	NA	NA	NA	NA
WP_017683797.1|502386_503367_-	alpha/beta hydrolase family protein	NA	NA	NA	NA	NA
WP_003377307.1|503445_505494_+	transporter substrate-binding domain-containing protein	NA	NA	NA	NA	NA
WP_003377309.1|505490_506120_+	response regulator transcription factor	NA	NA	NA	NA	NA
WP_017683796.1|506461_507586_+	ABC transporter ATP-binding protein	NA	G3M9Y6	Bacillus_virus	34.0	3.0e-27
WP_017683795.1|507668_508703_+	polyamine ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_017683794.1|508780_510028_+	ABC transporter permease	NA	NA	NA	NA	NA
WP_003377317.1|510039_510861_+	ABC transporter permease	NA	NA	NA	NA	NA
WP_010218875.1|511002_511677_+	ribulose-phosphate 3-epimerase	NA	NA	NA	NA	NA
WP_003377321.1|511673_512492_+	phosphoglycolate phosphatase	NA	NA	NA	NA	NA
WP_003377323.1|512561_514043_+	anthranilate synthase component I	NA	NA	NA	NA	NA
WP_050545703.1|514264_516148_-	autotransporter domain-containing esterase	NA	NA	NA	NA	NA
WP_019331326.1|516324_517755_-|transposase	IS1182-like element ISPsy36 family transposase	transposase	NA	NA	NA	NA
WP_003377326.1|517955_518198_-	pyocin activator PrtN family protein	NA	A0A2H4J8B4	uncultured_Caudovirales_phage	50.0	5.6e-16
WP_003377328.1|518319_518568_-	DUF1654 domain-containing protein	NA	NA	NA	NA	NA
WP_003377329.1|518720_519332_-	helix-turn-helix domain-containing protein	NA	A0A0M4QWY1	Salmonella_phage	49.7	1.4e-50
WP_017683431.1|519521_519959_+	hypothetical protein	NA	A0A2H4J8A5	uncultured_Caudovirales_phage	46.7	1.3e-23
WP_003377332.1|520238_520424_+	Com family DNA-binding transcriptional regulator	NA	B5TK59	Pseudomonas_phage	89.7	1.5e-13
WP_017683433.1|520435_520861_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017683434.1|520967_521609_+	cellulase family glycosylhydrolase	NA	NA	NA	NA	NA
WP_005614154.1|521732_522122_+	hypothetical protein	NA	A0A059VK40	Pseudomonas_phage	74.8	1.1e-42
WP_005768026.1|522102_522441_+	hypothetical protein	NA	A0A059VJW1	Pseudomonas_phage	59.2	2.0e-19
WP_017683435.1|522486_523077_+	hypothetical protein	NA	B5TK65	Pseudomonas_phage	51.5	7.7e-51
WP_017683436.1|523073_523262_+	DUF2635 domain-containing protein	NA	B5TK66	Pseudomonas_phage	76.6	4.1e-14
WP_017683437.1|523280_524777_+|tail	phage tail sheath subtilisin-like domain-containing protein	tail	B5TK67	Pseudomonas_phage	79.7	2.1e-233
WP_005614159.1|524838_525186_+|tail	phage tail tube protein	tail	B5TK68	Pseudomonas_phage	67.8	5.6e-41
WP_017683438.1|525182_525479_+|tail	phage tail assembly protein	tail	B5TK69	Pseudomonas_phage	75.3	4.7e-33
WP_017683439.1|525609_527754_+|tail	phage tail tape measure protein	tail	U5P420	Shigella_phage	40.7	1.9e-75
WP_017683440.1|527750_529163_+	DNA circularization N-terminal domain-containing protein	NA	B5TK71	Pseudomonas_phage	44.4	3.1e-106
WP_017683441.1|529166_530276_+	hypothetical protein	NA	B5TK72	Pseudomonas_phage	59.8	2.1e-113
WP_017683442.1|530272_530785_+|plate	phage baseplate assembly protein	plate	B5TK73	Pseudomonas_phage	74.4	3.7e-65
WP_005768009.1|530781_531180_+	phage GP46 family protein	NA	B5TK74	Pseudomonas_phage	65.2	8.0e-44
WP_017683443.1|531169_532210_+|plate	baseplate J/gp47 family protein	plate	B5TK75	Pseudomonas_phage	71.5	1.5e-134
WP_017683444.1|532197_532797_+	DUF2313 domain-containing protein	NA	B5TK76	Pseudomonas_phage	71.9	8.3e-85
WP_017683445.1|532807_534685_+	hypothetical protein	NA	A0A077K818	Ralstonia_phage	52.6	7.0e-37
WP_003377342.1|534695_535241_+|tail	tail fiber assembly protein	tail	NA	NA	NA	NA
WP_003377344.1|535337_535883_+	glycoside hydrolase family 19 protein	NA	A0A2H4JHX4	uncultured_Caudovirales_phage	71.1	1.4e-67
WP_003377345.1|535879_536389_+|lysis	lysis protein	lysis	A0A2H4JBH9	uncultured_Caudovirales_phage	48.8	2.0e-26
WP_003377435.1|536800_537400_+	aminodeoxychorismate/anthranilate synthase component II	NA	A0A0P0IKJ1	Acinetobacter_phage	64.7	1.1e-73
WP_003377436.1|537421_538471_+	anthranilate phosphoribosyltransferase	NA	A0A0N7IRD9	Acinetobacter_phage	57.7	3.1e-111
WP_003377438.1|538467_539304_+	indole-3-glycerol phosphate synthase TrpC	NA	A0A0P0IR83	Acinetobacter_phage	56.2	2.6e-68
>prophage 4
NZ_CP012179	Pseudomonas syringae pv. actinidiae ICMP 18708 chromosome, complete genome	6555571	694805	756615	6555571	transposase,protease	Ralstonia_phage(28.57%)	39	NA	NA
WP_032685519.1|694805_696143_+|transposase	IS4-like element ISPsy33 family transposase	transposase	NA	NA	NA	NA
WP_003383177.1|696907_698461_-	ABC transporter ATP-binding protein	NA	A0A2H4PQG7	Staphylococcus_phage	29.1	1.7e-17
WP_003383176.1|698983_699577_-	YigZ family protein	NA	NA	NA	NA	NA
WP_003383175.1|699609_700266_-	TetR/AcrR family transcriptional regulator	NA	NA	NA	NA	NA
WP_003383174.1|700364_701762_-	purine permease	NA	H9YQ34	environmental_Halophage	38.0	1.9e-15
WP_003383173.1|701948_702869_-	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_003383172.1|702996_704343_+	aspartate aminotransferase family protein	NA	NA	NA	NA	NA
WP_003383170.1|704436_705930_+	CoA-acylating methylmalonate-semialdehyde dehydrogenase	NA	NA	NA	NA	NA
WP_003382200.1|711950_715427_+	exodeoxyribonuclease V subunit gamma	NA	NA	NA	NA	NA
WP_017684540.1|715423_719116_+	exodeoxyribonuclease V subunit beta	NA	S5M596	Bacillus_phage	22.6	2.6e-11
WP_017684539.1|719112_721206_+	exodeoxyribonuclease V subunit alpha	NA	A0A1P8DII4	Virus_Rctr197k	26.8	3.2e-22
WP_017684538.1|721448_722351_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017699749.1|722493_723537_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017684234.1|726375_726927_-	DUF4123 domain-containing protein	NA	NA	NA	NA	NA
WP_017684235.1|726923_728990_-	type VI secretion system tip protein VgrG	NA	A0A077K8Q4	Ralstonia_phage	28.0	5.5e-35
WP_003379982.1|729487_730711_+	type III secretion system effector protein	NA	NA	NA	NA	NA
WP_017684236.1|730827_732360_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017684237.1|733503_733740_-	carbon storage regulator	NA	NA	NA	NA	NA
WP_017684238.1|733941_734520_-	AAA family ATPase	NA	NA	NA	NA	NA
WP_032609899.1|734519_735176_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017684239.1|735212_736415_-	aspartate aminotransferase family protein	NA	NA	NA	NA	NA
WP_017684240.1|736455_737490_-	sulfotransferase	NA	NA	NA	NA	NA
WP_020313563.1|737507_738428_-	TauD/TfdA family dioxygenase	NA	NA	NA	NA	NA
WP_017703697.1|738573_739221_-	histidine phosphatase family protein	NA	NA	NA	NA	NA
WP_017704392.1|739561_740497_-	syringolide biosynthetic protein AvrD1	NA	NA	NA	NA	NA
WP_017684243.1|741445_741865_-	type II toxin-antitoxin system VapC family toxin	NA	NA	NA	NA	NA
WP_003381346.1|741861_742119_-	Arc family DNA-binding protein	NA	NA	NA	NA	NA
WP_017684244.1|742473_743130_+	hypothetical protein	NA	L7TKZ9	Rhizobium_phage	34.1	6.6e-27
WP_003381350.1|743177_743432_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003383614.1|744248_745211_-	type III effector	NA	NA	NA	NA	NA
WP_074556883.1|746580_747648_+|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_078983215.1|747858_748401_+|protease	YopT-type cysteine protease domain-containing protein	protease	NA	NA	NA	NA
WP_032685463.1|748960_750028_+|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_017685026.1|750113_750500_+	CesT family type III secretion system chaperone	NA	NA	NA	NA	NA
WP_110455589.1|750599_751637_+	hypothetical protein	NA	NA	NA	NA	NA
WP_005782565.1|752106_752667_+	recombinase family protein	NA	A0A1W5LU24	Ralstonia_phage	41.5	8.4e-31
WP_017685028.1|752650_754309_+|transposase	IS481 family transposase	transposase	NA	NA	NA	NA
WP_017685029.1|754298_755270_+	AAA family ATPase	NA	NA	NA	NA	NA
WP_074556885.1|755547_756615_+|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
>prophage 5
NZ_CP012179	Pseudomonas syringae pv. actinidiae ICMP 18708 chromosome, complete genome	6555571	921265	983796	6555571	transposase,tRNA	Acinetobacter_phage(15.38%)	58	NA	NA
WP_032685467.1|921265_922333_-|transposase	IS630-like element ISPsy32 family transposase	transposase	NA	NA	NA	NA
WP_164706461.1|923194_924372_-|transposase	IS3 family transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	39.0	6.3e-52
WP_017684881.1|924774_925719_-	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_003381324.1|925876_927403_+	CoA-acylating methylmalonate-semialdehyde dehydrogenase	NA	NA	NA	NA	NA
WP_003381322.1|927437_928328_+	3-hydroxyisobutyrate dehydrogenase	NA	NA	NA	NA	NA
WP_017684882.1|928442_930413_+	TonB-dependent receptor	NA	A0A0P0I887	Acinetobacter_phage	34.0	4.3e-13
WP_017698444.1|930610_931957_-	HAMP domain-containing protein	NA	NA	NA	NA	NA
WP_003381319.1|931986_932751_-	response regulator transcription factor	NA	W8CYM9	Bacillus_phage	31.9	6.5e-26
WP_017684321.1|933043_934771_+	gamma-glutamyltransferase	NA	NA	NA	NA	NA
WP_003381317.1|934851_935619_-	phosphonate ABC transporter, permease protein PhnE	NA	NA	NA	NA	NA
WP_003381316.1|935615_936443_-	ABC transporter permease	NA	NA	NA	NA	NA
WP_003381315.1|936436_937234_-	ATP-binding cassette domain-containing protein	NA	G9BWD6	Planktothrix_phage	30.2	1.0e-13
WP_017684322.1|937230_938082_-	putative selenate ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_017684323.1|938319_939354_+	selenide, water dikinase SelD	NA	NA	NA	NA	NA
WP_003381312.1|939353_940454_+|tRNA	tRNA 2-selenouridine(34) synthase MnmH	tRNA	NA	NA	NA	NA
WP_017684324.1|940488_941253_+	sulfite exporter TauE/SafE family protein	NA	NA	NA	NA	NA
WP_003381308.1|941325_942294_-	polyprenyl synthetase family protein	NA	A0A1V0SE37	Indivirus	23.5	9.5e-06
WP_003381306.1|942533_942845_+	50S ribosomal protein L21	NA	NA	NA	NA	NA
WP_002551972.1|942877_943153_+	50S ribosomal protein L27	NA	NA	NA	NA	NA
WP_003381305.1|943369_944593_+	Obg family GTPase CgtA	NA	NA	NA	NA	NA
WP_003381304.1|944683_945802_+	glutamate 5-kinase	NA	A0A1X9I5D0	Streptococcus_phage	38.6	2.7e-60
WP_003381303.1|945827_946298_+	CreA family protein	NA	NA	NA	NA	NA
WP_074291269.1|946433_946739_+	IS66 family insertion sequence element accessory protein TnpB	NA	NA	NA	NA	NA
WP_017683608.1|947145_948414_+	group II intron reverse transcriptase/maturase	NA	A0A0U4J920	Pseudomonas_phage	30.1	4.7e-29
WP_078983159.1|948441_948651_+	IS66 family insertion sequence element accessory protein TnpB	NA	NA	NA	NA	NA
WP_051120728.1|948668_950201_+|transposase	IS66 family transposase	transposase	S5VTD3	Leptospira_phage	36.0	1.3e-81
WP_005736831.1|950535_950910_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017683975.1|950986_951367_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017683974.1|951437_951815_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017683973.1|952285_953263_-	hypothetical protein	NA	NA	NA	NA	NA
WP_005736826.1|953272_953761_-	type VI secretion system tube protein Hcp	NA	NA	NA	NA	NA
WP_005620771.1|953955_954294_-	osmotically-inducible lipoprotein OsmE	NA	NA	NA	NA	NA
WP_003376390.1|954566_954800_+	hypothetical protein	NA	NA	NA	NA	NA
WP_020309118.1|954796_955678_-	DMT family transporter	NA	NA	NA	NA	NA
WP_003376394.1|955831_956122_+	phosphate starvation-inducible protein PsiF	NA	NA	NA	NA	NA
WP_003376396.1|956310_957321_+	AI-2E family transporter	NA	NA	NA	NA	NA
WP_003376398.1|957434_958700_-	Hsp70 family protein	NA	A0A1V0SG59	Hokovirus	23.7	1.6e-05
WP_003376401.1|959010_959955_+	curved DNA-binding protein	NA	A0A0P0YNN4	Yellowstone_lake_phycodnavirus	27.4	1.6e-13
WP_017683971.1|959990_961121_-	HAMP domain-containing histidine kinase	NA	A0A1B0VMK3	Pseudomonas_phage	38.0	7.3e-66
WP_003376406.1|961277_961541_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017683970.1|961596_963297_-	urease subunit alpha	NA	NA	NA	NA	NA
WP_003376410.1|963575_963881_-	urease subunit beta	NA	NA	NA	NA	NA
WP_003376412.1|963877_964411_-	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_003376413.1|964421_964964_-	N-acetyltransferase	NA	NA	NA	NA	NA
WP_003376415.1|964974_965277_-	urease subunit gamma	NA	NA	NA	NA	NA
WP_003376417.1|965364_966228_-	urease accessory protein UreD	NA	NA	NA	NA	NA
WP_003376418.1|966276_966975_-	urea ABC transporter ATP-binding subunit UrtE	NA	A0A2H4PQG7	Staphylococcus_phage	27.1	5.6e-16
WP_003376420.1|967075_967936_-	urea ABC transporter ATP-binding protein UrtD	NA	A0A2R8FG22	Brazilian_cedratvirus	26.0	1.0e-11
WP_003376422.1|967932_969012_-	urea ABC transporter permease subunit UrtC	NA	NA	NA	NA	NA
WP_017683969.1|969011_970613_-	urea ABC transporter permease subunit UrtB	NA	NA	NA	NA	NA
WP_003376425.1|970857_972123_-	urea ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_121509270.1|972582_974162_-|transposase	IS3-like element ISPsy31 family transposase	transposase	NA	NA	NA	NA
WP_085991147.1|975164_976743_+|transposase	IS3-like element ISPsy31 family transposase	transposase	NA	NA	NA	NA
WP_017684769.1|977156_980585_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003376429.1|980836_982210_-	PepSY domain-containing protein	NA	NA	NA	NA	NA
WP_003376431.1|982292_982727_-	DUF2946 domain-containing protein	NA	NA	NA	NA	NA
WP_003376434.1|982740_983202_-	copper chaperone PCu(A)C	NA	NA	NA	NA	NA
WP_003376435.1|983337_983796_+|transposase	transposase	transposase	NA	NA	NA	NA
>prophage 6
NZ_CP012179	Pseudomonas syringae pv. actinidiae ICMP 18708 chromosome, complete genome	6555571	1064630	1115588	6555571	transposase,tRNA	Pseudomonas_phage(15.38%)	43	NA	NA
WP_017682616.1|1064630_1065890_+|transposase	IS256 family transposase	transposase	A0A218MNI5	uncultured_virus	41.7	5.7e-43
WP_003376571.1|1066160_1067198_-	DNA polymerase III subunit delta	NA	NA	NA	NA	NA
WP_003376573.1|1067239_1067845_-	lipoprotein	NA	NA	NA	NA	NA
WP_017683727.1|1067934_1070541_-|tRNA	leucine--tRNA ligase	tRNA	A0A2H4PQS0	Staphylococcus_phage	42.4	5.8e-191
WP_003376578.1|1070852_1071203_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003376580.1|1071273_1072044_+	YdcF family protein	NA	NA	NA	NA	NA
WP_017683726.1|1072095_1073616_-	apolipoprotein N-acyltransferase	NA	NA	NA	NA	NA
WP_003376583.1|1073657_1074500_-	HlyC/CorC family transporter	NA	NA	NA	NA	NA
WP_003376585.1|1074505_1075006_-	rRNA maturation RNase YbeY	NA	NA	NA	NA	NA
WP_003376587.1|1074998_1076021_-	PhoH family protein	NA	A0A0S0MVD6	Pseudomonas_phage	44.5	9.0e-47
WP_005620645.1|1076198_1077527_-|tRNA	tRNA (N6-isopentenyl adenosine(37)-C2)-methylthiotransferase MiaB	tRNA	NA	NA	NA	NA
WP_003376593.1|1077826_1078375_-	sel1 repeat family protein	NA	NA	NA	NA	NA
WP_005620644.1|1078669_1079953_-	glutamate-1-semialdehyde 2,1-aminomutase	NA	A0A1V0SKB7	Klosneuvirus	26.3	7.6e-11
WP_003376597.1|1080205_1080823_-	thiamine phosphate synthase	NA	NA	NA	NA	NA
WP_003376599.1|1080846_1081644_-	hydroxymethylpyrimidine/phosphomethylpyrimidine kinase	NA	NA	NA	NA	NA
WP_017683723.1|1082078_1084085_+	hybrid sensor histidine kinase/response regulator	NA	A0A1V0SGX0	Hokovirus	33.3	5.2e-30
WP_003376603.1|1084243_1085707_+	AMP nucleosidase	NA	NA	NA	NA	NA
WP_161458260.1|1085882_1086419_+	pseudouridine synthase	NA	NA	NA	NA	NA
WP_003376607.1|1086432_1086912_-	Lrp/AsnC family transcriptional regulator	NA	NA	NA	NA	NA
WP_170870107.1|1087274_1087811_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017683720.1|1087802_1088519_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003376613.1|1088503_1089418_-	cation diffusion facilitator family transporter	NA	NA	NA	NA	NA
WP_017683719.1|1089433_1089853_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003383525.1|1090209_1090791_-	RNA 2'-phosphotransferase	NA	A0A2H5BJP0	Erwinia_phage	41.7	2.6e-27
WP_003383522.1|1090954_1091881_+	Gfo/Idh/MocA family oxidoreductase	NA	NA	NA	NA	NA
WP_003383521.1|1091955_1092927_+	alpha/beta hydrolase	NA	NA	NA	NA	NA
WP_003383520.1|1092937_1093570_-	thioredoxin domain-containing protein	NA	NA	NA	NA	NA
WP_017683718.1|1093597_1094272_-|tRNA	tRNA (adenine(22)-N(1))-methyltransferase TrmK	tRNA	NA	NA	NA	NA
WP_003383518.1|1094460_1094844_+	RidA family protein	NA	NA	NA	NA	NA
WP_121509270.1|1095086_1096666_-|transposase	IS3-like element ISPsy31 family transposase	transposase	NA	NA	NA	NA
WP_017685108.1|1097023_1098394_+	DnaJ domain-containing protein	NA	A0A2K9V7V1	Bandra_megavirus	47.7	1.6e-06
WP_017683955.1|1099062_1099818_-	ATP-binding protein	NA	K4HZD4	Acidithiobacillus_phage	53.9	6.6e-71
WP_032685482.1|1099838_1101353_-|transposase	IS21-like element ISPsy40 family transposase	transposase	K4I413	Acidithiobacillus_phage	52.8	4.8e-145
WP_017699620.1|1101812_1102745_+	DEAD/DEAH box helicase	NA	K7YWK7	Megavirus	28.0	2.7e-05
WP_017685110.1|1102752_1103445_-	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_164706461.1|1103811_1104989_-|transposase	IS3 family transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	39.0	6.3e-52
WP_017699610.1|1106187_1107495_+	hypothetical protein	NA	Q6NE04	Leptospira_phage	40.7	6.9e-84
WP_017685019.1|1107514_1109587_+	hypothetical protein	NA	NA	NA	NA	NA
WP_032685463.1|1109669_1110737_-|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_017685150.1|1110830_1112021_+	GIY-YIG nuclease family protein	NA	NA	NA	NA	NA
WP_074291269.1|1113379_1113685_+	IS66 family insertion sequence element accessory protein TnpB	NA	NA	NA	NA	NA
WP_017683608.1|1114091_1115360_+	group II intron reverse transcriptase/maturase	NA	A0A0U4J920	Pseudomonas_phage	30.1	4.7e-29
WP_074556891.1|1115441_1115588_+|transposase	transposase	transposase	NA	NA	NA	NA
>prophage 7
NZ_CP012179	Pseudomonas syringae pv. actinidiae ICMP 18708 chromosome, complete genome	6555571	1734472	1784286	6555571	transposase,integrase	uncultured_Caudovirales_phage(40.0%)	49	1755665:1755678	1787633:1787646
WP_029768382.1|1734472_1735690_-|integrase	site-specific integrase	integrase	NA	NA	NA	NA
WP_017685142.1|1735736_1735922_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017685141.1|1735918_1737649_-	TraI domain-containing protein	NA	NA	NA	NA	NA
WP_085991147.1|1737715_1739295_-|transposase	IS3-like element ISPsy31 family transposase	transposase	NA	NA	NA	NA
WP_017699761.1|1739924_1740617_-	SOS response-associated peptidase family protein	NA	A0A2H4J991	uncultured_Caudovirales_phage	52.0	8.5e-57
WP_020316415.1|1740732_1741167_+	peptidase S24	NA	A0A2H4J538	uncultured_Caudovirales_phage	38.6	7.7e-16
WP_017684917.1|1741767_1742172_-	hypothetical protein	NA	NA	NA	NA	NA
WP_085988115.1|1742689_1743787_+	DUF4113 domain-containing protein	NA	I6RSM4	Salmonella_phage	44.4	3.6e-78
WP_017684915.1|1744011_1744398_+	DUF3742 family protein	NA	NA	NA	NA	NA
WP_017684914.1|1744436_1745969_-	conjugal transfer protein TraG	NA	NA	NA	NA	NA
WP_017684913.1|1745965_1746340_-	hypothetical protein	NA	NA	NA	NA	NA
WP_020358355.1|1746342_1747731_-	integrating conjugative element protein	NA	NA	NA	NA	NA
WP_024533459.1|1747730_1748669_-	TIGR03756 family integrating conjugative element protein	NA	NA	NA	NA	NA
WP_170870112.1|1748665_1749145_-	TIGR03757 family integrating conjugative element protein	NA	NA	NA	NA	NA
WP_017685198.1|1749399_1749588_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017685199.1|1749896_1750121_+	carbon storage regulator	NA	NA	NA	NA	NA
WP_017685160.1|1751614_1751926_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017685161.1|1751939_1752200_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017685163.1|1752345_1752927_-	hypothetical protein	NA	NA	NA	NA	NA
WP_051120731.1|1752927_1753611_-	thioredoxin domain-containing protein	NA	NA	NA	NA	NA
WP_024533428.1|1753607_1753907_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017684761.1|1753903_1756912_-	conjugative transfer ATPase	NA	NA	NA	NA	NA
1755665:1755678	attL	TTCAAGATGAGCTT	NA	NA	NA	NA
WP_017684760.1|1756911_1757373_-	TIGR03751 family conjugal transfer lipoprotein	NA	NA	NA	NA	NA
WP_017684759.1|1757350_1758838_-	TIGR03752 family integrating conjugative element protein	NA	NA	NA	NA	NA
WP_017684758.1|1758827_1759751_-	TIGR03749 family integrating conjugative element protein	NA	NA	NA	NA	NA
WP_017684757.1|1759747_1760416_-	TIGR03746 family integrating conjugative element protein	NA	NA	NA	NA	NA
WP_017684756.1|1760412_1760805_-	TIGR03750 family conjugal transfer protein	NA	NA	NA	NA	NA
WP_017684755.1|1760820_1761189_-	TIGR03745 family integrating conjugative element membrane protein	NA	NA	NA	NA	NA
WP_017684754.1|1761209_1761449_-	TIGR03758 family integrating conjugative element protein	NA	NA	NA	NA	NA
WP_003381923.1|1761445_1761808_-	RAQPRD family integrative conjugative element protein	NA	NA	NA	NA	NA
WP_017685221.1|1761887_1762220_-	DUF4177 domain-containing protein	NA	NA	NA	NA	NA
WP_032685473.1|1762511_1763579_+|transposase	IS630-like element ISPsy32 family transposase	transposase	NA	NA	NA	NA
WP_085991147.1|1763793_1765373_-|transposase	IS3-like element ISPsy31 family transposase	transposase	NA	NA	NA	NA
WP_017706673.1|1765517_1766825_+	MFS transporter	NA	NA	NA	NA	NA
WP_017684858.1|1767761_1768862_+	amidinotransferase	NA	D5GV78	Campylobacter_virus	30.0	1.3e-35
WP_017684857.1|1768948_1770202_+	HPr kinase	NA	NA	NA	NA	NA
WP_017684856.1|1770254_1771499_+	HPr kinase	NA	NA	NA	NA	NA
WP_031313254.1|1771664_1773122_-	ATP-dependent helicase	NA	A0A088C4M0	Shewanella_sp._phage	31.3	2.4e-45
WP_019334008.1|1773131_1773881_-	TIGR03747 family integrating conjugative element membrane protein	NA	NA	NA	NA	NA
WP_032685506.1|1773926_1776086_-	type IV conjugative transfer system coupling protein TraD	NA	NA	NA	NA	NA
WP_020362878.1|1776096_1776603_-	integrating conjugative element protein	NA	NA	NA	NA	NA
WP_032685505.1|1776599_1777157_-	lytic transglycosylase	NA	NA	NA	NA	NA
WP_017685219.1|1777141_1777888_-	TIGR03759 family integrating conjugative element protein	NA	NA	NA	NA	NA
WP_017685218.1|1777896_1778607_-	hypothetical protein	NA	NA	NA	NA	NA
WP_074556898.1|1779069_1780137_+|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_003381911.1|1780184_1780490_+	hypothetical protein	NA	NA	NA	NA	NA
WP_020314360.1|1781287_1782328_+	peptidase C55	NA	NA	NA	NA	NA
WP_017704372.1|1782782_1783439_+	type III secretion system effector protein	NA	NA	NA	NA	NA
WP_017684097.1|1783482_1784286_-|integrase	tyrosine-type recombinase/integrase	integrase	NA	NA	NA	NA
1787633:1787646	attR	AAGCTCATCTTGAA	NA	NA	NA	NA
>prophage 8
NZ_CP012179	Pseudomonas syringae pv. actinidiae ICMP 18708 chromosome, complete genome	6555571	2520970	2528922	6555571	tRNA	uncultured_Caudovirales_phage(71.43%)	9	NA	NA
WP_017682679.1|2520970_2522251_+|tRNA	serine--tRNA ligase	tRNA	A0A1B1IVT2	uncultured_Mediterranean_phage	45.6	2.6e-96
WP_003380158.1|2522251_2523646_+	uroporphyrinogen-III C-methyltransferase	NA	NA	NA	NA	NA
WP_003380160.1|2523697_2524696_-	glutathione S-transferase family protein	NA	NA	NA	NA	NA
WP_003380162.1|2524804_2525806_-	glycosyl transferase family protein	NA	A0A2H4JBY5	uncultured_Caudovirales_phage	83.5	4.4e-163
WP_003380166.1|2525802_2526138_-	TusE/DsrC/DsvC family sulfur relay protein	NA	A0A2H4J8B6	uncultured_Caudovirales_phage	75.7	8.3e-42
WP_017682680.1|2526134_2526434_-	sulfurtransferase complex subunit TusB	NA	A0A2H4JG28	uncultured_Caudovirales_phage	59.6	1.1e-26
WP_005738151.1|2526433_2526796_-	sulfurtransferase complex subunit TusC	NA	A0A2H4J8C0	uncultured_Caudovirales_phage	62.5	3.9e-37
WP_003380170.1|2526797_2527190_-	sulfurtransferase complex subunit TusD	NA	A0A2H4JA39	uncultured_Caudovirales_phage	82.3	6.3e-57
WP_017682682.1|2527620_2528922_+	MFS transporter	NA	Q6JIH2	Burkholderia_virus	35.8	1.3e-61
>prophage 9
NZ_CP012179	Pseudomonas syringae pv. actinidiae ICMP 18708 chromosome, complete genome	6555571	2800800	2863637	6555571	transposase,integrase,tRNA	Tupanvirus(28.57%)	55	2798721:2798780	2868798:2870602
2798721:2798780	attL	CCCCTGCCACACCACCCGGCATGCGGGTCCGCACCGGGCGGTTCGAGAGGTTGAGGTCAG	NA	NA	NA	NA
WP_003383538.1|2800800_2802282_+|tRNA	glutamate--tRNA ligase	tRNA	NA	NA	NA	NA
WP_032685472.1|2803392_2804760_-	group II intron reverse transcriptase/maturase	NA	A0A0U4J920	Pseudomonas_phage	30.9	6.4e-32
WP_003382047.1|2805479_2805941_+	acyl-CoA thioesterase	NA	NA	NA	NA	NA
WP_017684178.1|2805969_2806935_+|tRNA	tRNA-dihydrouridine synthase	tRNA	NA	NA	NA	NA
WP_003382044.1|2807063_2807507_+	Hsp20 family protein	NA	A0A0C5AE28	Cyanophage	36.3	5.1e-15
WP_017684179.1|2807562_2809755_-	phosphodiesterase	NA	A0A127AWB9	Bacillus_phage	32.6	3.0e-15
WP_003382041.1|2809823_2810696_-	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_003382039.1|2810841_2812269_+	3-isopropylmalate dehydratase large subunit	NA	NA	NA	NA	NA
WP_003382037.1|2812265_2812907_+	3-isopropylmalate dehydratase small subunit	NA	NA	NA	NA	NA
WP_003382036.1|2813053_2814136_+	3-isopropylmalate dehydrogenase	NA	NA	NA	NA	NA
WP_003382035.1|2814206_2815319_+	aspartate-semialdehyde dehydrogenase	NA	NA	NA	NA	NA
WP_003382034.1|2815484_2816489_+	2-dehydro-3-deoxygalactonokinase	NA	NA	NA	NA	NA
WP_003382033.1|2816490_2817126_+	2-dehydro-3-deoxy-6-phosphogalactonate aldolase	NA	NA	NA	NA	NA
WP_003382032.1|2817186_2818335_+	galactonate dehydratase	NA	Q6A202	Oenococcus_phage	36.6	1.1e-56
WP_005738096.1|2818556_2819867_+	MFS transporter	NA	NA	NA	NA	NA
WP_017684180.1|2819948_2820758_+	IclR family transcriptional regulator	NA	NA	NA	NA	NA
WP_017684181.1|2820769_2821756_-	NAD(P)-dependent alcohol dehydrogenase	NA	A0A2K9L7I1	Tupanvirus	43.5	2.1e-72
WP_017684182.1|2822176_2823229_+	NAD(P)-dependent alcohol dehydrogenase	NA	A0A2K9L7I1	Tupanvirus	43.3	5.2e-82
WP_032685463.1|2823464_2824532_+|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_017685217.1|2824739_2825141_-	hypothetical protein	NA	NA	NA	NA	NA
WP_032685473.1|2825257_2826325_+|transposase	IS630-like element ISPsy32 family transposase	transposase	NA	NA	NA	NA
WP_017704755.1|2826913_2827255_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_017685113.1|2827311_2827692_+	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_017685114.1|2828048_2828555_-	AAA family ATPase	NA	NA	NA	NA	NA
WP_017685115.1|2828656_2829265_-	DUF1851 domain-containing protein	NA	NA	NA	NA	NA
WP_017685116.1|2829276_2829762_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017683597.1|2831382_2831814_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017683598.1|2831810_2832233_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017683599.1|2832402_2833887_-|integrase	site-specific integrase	integrase	NA	NA	NA	NA
WP_003382023.1|2834307_2835201_+	AraC family transcriptional regulator	NA	NA	NA	NA	NA
WP_003382022.1|2835242_2836898_-	electron transfer flavoprotein-ubiquinone oxidoreductase	NA	NA	NA	NA	NA
WP_003382021.1|2837421_2838171_+	electron transfer flavoprotein subunit beta/FixA family protein	NA	NA	NA	NA	NA
WP_017683600.1|2838171_2839101_+	electron transfer flavoprotein subunit alpha	NA	NA	NA	NA	NA
WP_017683601.1|2839221_2840049_+	transporter substrate-binding domain-containing protein	NA	NA	NA	NA	NA
WP_017683602.1|2840059_2840413_+	DUF4398 domain-containing protein	NA	NA	NA	NA	NA
WP_003382016.1|2840409_2841225_+	OmpA family protein	NA	NA	NA	NA	NA
WP_003382014.1|2841442_2842882_+	PLP-dependent aminotransferase family protein	NA	NA	NA	NA	NA
WP_003382012.1|2843069_2843651_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017683604.1|2843745_2844003_+	YkgJ family cysteine cluster protein	NA	NA	NA	NA	NA
WP_003382009.1|2844060_2844666_+	START domain-containing protein	NA	NA	NA	NA	NA
WP_003382008.1|2844735_2846025_-	citrate (Si)-synthase	NA	NA	NA	NA	NA
WP_005738085.1|2846388_2846763_+	succinate dehydrogenase, cytochrome b556 subunit	NA	NA	NA	NA	NA
WP_003382006.1|2846756_2847125_+	succinate dehydrogenase, hydrophobic membrane anchor protein	NA	NA	NA	NA	NA
WP_003382005.1|2847128_2848901_+	succinate dehydrogenase flavoprotein subunit	NA	NA	NA	NA	NA
WP_003382004.1|2848913_2849618_+	succinate dehydrogenase iron-sulfur subunit	NA	NA	NA	NA	NA
WP_003382003.1|2849877_2852709_+	2-oxoglutarate dehydrogenase E1 component	NA	NA	NA	NA	NA
WP_017683605.1|2852750_2853971_+	2-oxoglutarate dehydrogenase complex dihydrolipoyllysine-residue succinyltransferase	NA	NA	NA	NA	NA
WP_003382001.1|2854143_2855580_+	dihydrolipoyl dehydrogenase	NA	A0A2K5B2C5	Erysipelothrix_phage	27.2	3.1e-45
WP_002552981.1|2855788_2856955_+	ADP-forming succinate--CoA ligase subunit beta	NA	NA	NA	NA	NA
WP_005617294.1|2856954_2857836_+	succinate--CoA ligase subunit alpha	NA	NA	NA	NA	NA
WP_003381996.1|2857936_2858158_-	hypothetical protein	NA	NA	NA	NA	NA
WP_020365722.1|2858483_2859797_+	branched-chain amino acid transport system II carrier protein	NA	NA	NA	NA	NA
WP_020356716.1|2859947_2861285_+|transposase	IS4-like element ISPsy33 family transposase	transposase	NA	NA	NA	NA
WP_020315614.1|2861585_2862062_+	hypothetical protein	NA	NA	NA	NA	NA
WP_099818608.1|2862058_2863637_+|transposase	IS3-like element ISPsy31 family transposase	transposase	NA	NA	NA	NA
2868798:2870602	attR	CCCCTGCCACACCACCCGGCATGCGGGTCCGCACCGGGCGGTTCGAGAGGTTGAGGTCAGTAGAGTCGAGGCAGACCCAACCGATCAAACCACGCTACCGTCAGCACACCATGGATCAGCCCGGCACTGTTGTGCCAGATCCTATGGCTATCGCTGGCTATTGCTGCCGCCAAGTCAGAATTTGCACCCAACTTGCGAAGCTCTCGGTAGGTGGTTTTGCCAGTCTTCCATTGTTTGAGCTGAATTGCCCTGAGCCTTCGACGTATCCAGCCGTCCAGACTCTTCCATAAACCGGGAGCCTGAGACAATCCAAAGTACGCTTTCCAGCCGAGGAGGTAGGGCCTCAGGTTTTCCACCACTTGCGGCAGGCTGCGACCGCCACTACGCGGTGTCAGCCCCCGGATGCGATGTTTGAATACCTGTAGCGCCTTGAGTGCTACCCGCCGTTTGACCTCGCCTTTGGGAGACTGCCAGAAGCTGAATCCCAGAAACTTGCGGCCAAACGCACTGGCAACGGCGCTCTTGCTCTCGTTCACGCGCAACCCAAGACGGCCGTAAAGGCGACGGAGCAATGCCATCACCCGCTGTCCGGCTTTGGGGCTACGTACGTAAACGTTCGCATCGTCCGCGTACCTGACGAAGCAATGGCCTCGTCGCTCCAGCTCTTTGTCTACCTCGTCCAGCACCACATTGGCCAGCAGCGGTGAAAGTGGTCCACCTTGCGGTGTGCCCCTCGTGCTGGTCATGACCATGCCTTCGATCAATGCCCCACTGTTCAGATAAGCTCGAATCAAACGTAAAACGTCGCGATCCTTCACTTTTCTGCCCAGTCGGGCGATCAACAGATCGTGCTCGACGCAGTCGAAAAACTGCTCCAGATCGACATCGACCACAATTTGCCGCCCTGAGTGGATGTATTGCTGTGCCGCCAAAACCGCTTGGTGTGCACTGCGCTCCGGACGAAAACCATAGCTGTGGTTGCTGAAGTCAGGGTCCAGCAAGGGCTGCAACACTTGCAGTAATGCTTGCTGAATAAGTCTGTCCGTCACCGTAGGAATGCCCAGCTTGCGCTCGCCGCCACCGGGTTTGGGGATCAAGACTCGCCGAACCGGATCAGGCCGGTACGTCCCTGCCAACAACTGTGCGCGTATCCCGGGCCATGCCGTCTTCAGGTGCTCCGCTGTTTCGGCGATCCCAAGACCGTCGACACCGGCAGCACCCTTATTGGCGCGGACCTGTTTAAACGCCAGTTGCAGGTTGTCTCTTGTCAGGGCAGCTTGCAGCAACCCTGACCCTGTGGGGGTTGAGTCATGGCGCGGACAGCCGGCTTCATCGCTGGATGCTTTACGCGGGGCTTCACCCTCTGCAATTGCGTCCCGCCCCGGTTTGCCGGGCATCTGATGCATGGCCTGCTGTATCGTCATGTCAAACCTCACTTCTTCTCGTTTGGTCCTTCGCTGCAGCGCAGCTACTATGACCGCTGCTGACTTCTCGCTCCGGCTCACACCGTCGCCCTTTCAGGCATGAGGCGAGATCTCCCCAGGTAAGAACGCCATCCTTCACCGCACAACCGCCGCATTTACGTACCCGGCACTTAGGCCACAAGAGCTTTGCAGTCACTTGGCTGCTCGCCCTGTCCGGATCCGCCTCGAATGCGATTTGTGTACCTCGGCTCGCGGTTTACGCTCCACGCTTCCTCCCCACAGTCGGTCGCCCTTCTGCAGTTGCGCTTCGCTTCATTCACTGTGGCCAGCTTAAGAGAGGACTTTCACCTCTAGGATGGCGCCCATGCTGGGCGCACAAGT	NA	NA	NA	NA
>prophage 10
NZ_CP012179	Pseudomonas syringae pv. actinidiae ICMP 18708 chromosome, complete genome	6555571	2925512	2982875	6555571	transposase,plate	Salmonella_phage(25.0%)	44	NA	NA
WP_085991147.1|2925512_2927092_-|transposase	IS3-like element ISPsy31 family transposase	transposase	NA	NA	NA	NA
WP_157781629.1|2927278_2928766_+	CHAT domain-containing protein	NA	NA	NA	NA	NA
WP_017703875.1|2928881_2929385_-	hypothetical protein	NA	I6RSM4	Salmonella_phage	53.1	1.9e-29
WP_017703876.1|2929374_2929623_-	hypothetical protein	NA	A0A218MNF2	uncultured_virus	69.3	6.8e-25
WP_017685227.1|2929612_2930044_-	S24 family peptidase	NA	I6S1S3	Salmonella_phage	42.7	1.6e-05
WP_017684806.1|2930284_2930935_+	HAD family hydrolase	NA	NA	NA	NA	NA
WP_017684805.1|2931004_2932396_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017684804.1|2932524_2932839_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017699575.1|2933268_2936304_-	AAA family ATPase	NA	NA	NA	NA	NA
WP_017684802.1|2936300_2936900_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017684801.1|2936901_2938980_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017684800.1|2939196_2939598_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017684799.1|2939654_2940173_+	tetratricopeptide repeat protein	NA	NA	NA	NA	NA
WP_017684798.1|2940962_2941586_+	hypothetical protein	NA	NA	NA	NA	NA
WP_074291497.1|2941642_2941909_+|transposase	Mu transposase C-terminal domain-containing protein	transposase	NA	NA	NA	NA
WP_032685473.1|2942293_2943361_-|transposase	IS630-like element ISPsy32 family transposase	transposase	NA	NA	NA	NA
WP_017683645.1|2946717_2948295_+	ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_003382189.1|2948315_2949326_+	ABC transporter permease	NA	NA	NA	NA	NA
WP_003382188.1|2949322_2950174_+	ABC transporter permease	NA	NA	NA	NA	NA
WP_003382187.1|2950166_2951015_+	ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	31.2	2.9e-14
WP_003382186.1|2951011_2951725_+	ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	33.1	1.2e-24
WP_017683646.1|2951829_2952387_+	cytochrome b	NA	NA	NA	NA	NA
WP_017683647.1|2952455_2952995_+	RNA polymerase sigma factor	NA	NA	NA	NA	NA
WP_003382183.1|2952991_2953780_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003382180.1|2954015_2954525_+	sigma-70 family RNA polymerase sigma factor	NA	NA	NA	NA	NA
WP_017683648.1|2954521_2955487_+	FecR domain-containing protein	NA	NA	NA	NA	NA
WP_017683649.1|2955556_2957959_+	TonB-dependent receptor	NA	NA	NA	NA	NA
WP_003382174.1|2958282_2959659_+	diaminobutyrate--2-oxoglutarate transaminase	NA	A0A1V0SKB7	Klosneuvirus	26.0	4.2e-23
WP_017683650.1|2959849_2961634_+	achromobactin biosynthetic protein AcsD	NA	NA	NA	NA	NA
WP_003382171.1|2961626_2962835_+	type III PLP-dependent enzyme	NA	NA	NA	NA	NA
WP_003382170.1|2962831_2964238_+	DHA2 family efflux MFS transporter permease subunit	NA	NA	NA	NA	NA
WP_020315044.1|2964259_2966113_+	achromobactin biosynthetic protein AcsC	NA	NA	NA	NA	NA
WP_017683652.1|2966112_2966886_+	siderophore biosynthesis protein SbnG	NA	NA	NA	NA	NA
WP_017683653.1|2966890_2968774_+	IucA/IucC	NA	NA	NA	NA	NA
WP_017683654.1|2968763_2969684_+	iron-siderophore ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_017683655.1|2969680_2970670_+	iron ABC transporter permease	NA	NA	NA	NA	NA
WP_017683656.1|2970662_2971694_+	iron ABC transporter permease	NA	NA	NA	NA	NA
WP_017683657.1|2971704_2972496_+	ABC transporter ATP-binding protein	NA	Q9EMR9	Amsacta_moorei_entomopoxvirus	24.3	3.4e-09
WP_003382158.1|2972492_2973272_+	(2Fe-2S)-binding protein	NA	NA	NA	NA	NA
WP_017703642.1|2973268_2973901_+	RraA family protein	NA	NA	NA	NA	NA
WP_017682616.1|2973972_2975232_-|transposase	IS256 family transposase	transposase	A0A218MNI5	uncultured_virus	41.7	5.7e-43
WP_099818608.1|2975341_2976921_-|transposase	IS3-like element ISPsy31 family transposase	transposase	NA	NA	NA	NA
WP_153303628.1|2976917_2977514_-	endonuclease/exonuclease/phosphatase family protein	NA	NA	NA	NA	NA
WP_017684343.1|2981078_2982875_-|plate	type VI secretion system baseplate subunit TssF	plate	NA	NA	NA	NA
>prophage 11
NZ_CP012179	Pseudomonas syringae pv. actinidiae ICMP 18708 chromosome, complete genome	6555571	3278781	3300844	6555571	transposase	Enterobacteria_phage(33.33%)	17	NA	NA
WP_017682807.1|3278781_3281811_-|transposase	Tn3-like element ISPsy42 family transposase	transposase	NA	NA	NA	NA
WP_004666660.1|3281839_3282412_-	recombinase family protein	NA	A0A0A7NPV4	Enterobacteria_phage	54.9	5.6e-46
WP_003108276.1|3282591_3282843_+	AbrB/MazE/SpoVT family DNA-binding domain-containing protein	NA	NA	NA	NA	NA
WP_004666661.1|3282839_3283235_+	type II toxin-antitoxin system VapC family toxin	NA	NA	NA	NA	NA
WP_004666662.1|3283395_3283773_-	hypothetical protein	NA	NA	NA	NA	NA
WP_074556923.1|3284152_3285220_+|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_017685146.1|3286751_3287150_+	hypothetical protein	NA	NA	NA	NA	NA
WP_032685473.1|3287156_3288224_-|transposase	IS630-like element ISPsy32 family transposase	transposase	NA	NA	NA	NA
WP_032685473.1|3288328_3289396_-|transposase	IS630-like element ISPsy32 family transposase	transposase	NA	NA	NA	NA
WP_017685159.1|3290041_3290857_+	hypothetical protein	NA	NA	NA	NA	NA
WP_051120736.1|3290866_3292399_-|transposase	IS66 family transposase	transposase	S5VTD3	Leptospira_phage	36.5	1.2e-82
WP_078983159.1|3292416_3292626_-	IS66 family insertion sequence element accessory protein TnpB	NA	NA	NA	NA	NA
WP_017683608.1|3292653_3293922_-	group II intron reverse transcriptase/maturase	NA	A0A0U4J920	Pseudomonas_phage	30.1	4.7e-29
WP_074556959.1|3294328_3294634_-	IS66 family insertion sequence element accessory protein TnpB	NA	NA	NA	NA	NA
WP_136624442.1|3295669_3297250_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017684979.1|3298100_3298835_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017684980.1|3298831_3300844_+|transposase	Mu transposase C-terminal domain-containing protein	transposase	NA	NA	NA	NA
>prophage 12
NZ_CP012179	Pseudomonas syringae pv. actinidiae ICMP 18708 chromosome, complete genome	6555571	3307638	3359887	6555571	transposase,integrase	Acidithiobacillus_phage(57.14%)	39	3301909:3301968	3359913:3360024
3301909:3301968	attL	CTAGTGTGCTGTTTTCGAAATAACTTACCCATGACCTGCAACCTAAGTTCTTGATAAAAT	NA	NA	NA	NA
WP_032685482.1|3307638_3309153_+|transposase	IS21-like element ISPsy40 family transposase	transposase	K4I413	Acidithiobacillus_phage	52.8	4.8e-145
WP_017683955.1|3309173_3309929_+	ATP-binding protein	NA	K4HZD4	Acidithiobacillus_phage	53.9	6.6e-71
WP_010434693.1|3311227_3311659_-	S24 family peptidase	NA	I6S1S3	Salmonella_phage	44.0	2.1e-05
WP_017684610.1|3312262_3312925_+	HAD family hydrolase	NA	NA	NA	NA	NA
WP_017684611.1|3313173_3313947_+	HNH endonuclease	NA	NA	NA	NA	NA
WP_017684612.1|3314083_3314398_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017684615.1|3315460_3315991_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017684616.1|3316147_3316591_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017684617.1|3316787_3318524_-	hypothetical protein	NA	A0A1L2BY82	Clostridium_phage	28.0	5.6e-57
WP_017684618.1|3319133_3323450_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017699752.1|3323896_3324628_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017684620.1|3326611_3327892_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017684621.1|3328476_3329766_+	hypothetical protein	NA	NA	NA	NA	NA
WP_136624496.1|3329744_3330248_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017684622.1|3330262_3330478_+	NgoFVII family restriction endonuclease	NA	NA	NA	NA	NA
WP_017684623.1|3330894_3331215_+	hypothetical protein	NA	NA	NA	NA	NA
WP_085991147.1|3331215_3332795_-|transposase	IS3-like element ISPsy31 family transposase	transposase	NA	NA	NA	NA
WP_017685074.1|3333491_3334355_-	DUF4231 domain-containing protein	NA	NA	NA	NA	NA
WP_085991147.1|3335776_3337355_+|transposase	IS3-like element ISPsy31 family transposase	transposase	NA	NA	NA	NA
WP_085991147.1|3338048_3339627_+|transposase	IS3-like element ISPsy31 family transposase	transposase	NA	NA	NA	NA
WP_017684992.1|3339628_3339892_-	metallophosphoesterase family protein	NA	A0A142EZR4	Stenotrophomonas_phage	33.8	3.4e-06
WP_017684993.1|3340475_3340841_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017684994.1|3341247_3341715_+	transcriptional regulator	NA	NA	NA	NA	NA
WP_017684995.1|3341823_3342204_-	DNA binding protein	NA	NA	NA	NA	NA
WP_017684996.1|3342233_3342575_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017684997.1|3343804_3344617_+	DUF2813 domain-containing protein	NA	NA	NA	NA	NA
WP_017683955.1|3345340_3346096_-	ATP-binding protein	NA	K4HZD4	Acidithiobacillus_phage	53.9	6.6e-71
WP_032685482.1|3346116_3347631_-|transposase	IS21-like element ISPsy40 family transposase	transposase	K4I413	Acidithiobacillus_phage	52.8	4.8e-145
WP_032685463.1|3348966_3350034_-|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_017685222.1|3350090_3350546_-	hypothetical protein	NA	NA	NA	NA	NA
WP_032685503.1|3350649_3351717_-|transposase	IS630-like element ISPsy32 family transposase	transposase	NA	NA	NA	NA
WP_017685004.1|3352466_3352853_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017685005.1|3353317_3353614_+	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_110455601.1|3354090_3355164_-	TniQ family protein	NA	NA	NA	NA	NA
WP_017699607.1|3355165_3355639_-	TniB family NTP-binding protein	NA	NA	NA	NA	NA
WP_032685503.1|3355715_3356783_-|transposase	IS630-like element ISPsy32 family transposase	transposase	NA	NA	NA	NA
WP_074291587.1|3356805_3357177_-	TniB family NTP-binding protein	NA	NA	NA	NA	NA
WP_136624444.1|3357178_3358552_-|integrase,transposase	DDE-type integrase/transposase/recombinase	integrase,transposase	NA	NA	NA	NA
WP_032685473.1|3358819_3359887_+|transposase	IS630-like element ISPsy32 family transposase	transposase	NA	NA	NA	NA
3359913:3360024	attR	CTAGTGTGCTGTTTTCGAAATAACTTACCCATGACCTGCAACCTAAGTTCTTGATAAAATTTGAATTTTCCGCTAGCCAGTAGCTGGTTTATTCAAAAACAGTACACTAGAT	NA	NA	NA	NA
>prophage 13
NZ_CP012179	Pseudomonas syringae pv. actinidiae ICMP 18708 chromosome, complete genome	6555571	3533047	3579719	6555571	transposase,integrase,tail	uncultured_Caudovirales_phage(27.27%)	46	3576044:3576058	3582559:3582573
WP_085991147.1|3533047_3534626_+|transposase	IS3-like element ISPsy31 family transposase	transposase	NA	NA	NA	NA
WP_017685089.1|3535463_3535832_-	DUF2255 family protein	NA	NA	NA	NA	NA
WP_003382996.1|3536325_3536613_+	type II toxin-antitoxin system ParD family antitoxin	NA	NA	NA	NA	NA
WP_031310021.1|3536615_3536972_+	type II toxin-antitoxin system RelE/ParE family toxin	NA	NA	NA	NA	NA
WP_017699032.1|3537332_3538088_-	ATP-binding protein	NA	K4HZD4	Acidithiobacillus_phage	53.9	3.9e-71
WP_051120740.1|3538108_3539623_-|transposase	IS21 family transposase	transposase	K4I413	Acidithiobacillus_phage	52.6	4.0e-144
WP_017685128.1|3539797_3541120_-	type II toxin-antitoxin system HipA family toxin	NA	NA	NA	NA	NA
WP_017685129.1|3541112_3541430_-	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_099818608.1|3541720_3543300_-|transposase	IS3-like element ISPsy31 family transposase	transposase	NA	NA	NA	NA
WP_017684117.1|3543505_3544198_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017684119.1|3544294_3545482_-	MFS transporter	NA	NA	NA	NA	NA
WP_017684120.1|3545608_3546235_+	TetR/AcrR family transcriptional regulator	NA	NA	NA	NA	NA
WP_003383009.1|3546302_3546758_+	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_017684121.1|3546832_3548698_+	ABC transporter ATP-binding protein	NA	W8CYL7	Bacillus_phage	27.2	4.3e-39
WP_017684122.1|3548722_3549622_-	AraC family transcriptional regulator	NA	NA	NA	NA	NA
WP_020304781.1|3549781_3550540_+	SDR family oxidoreductase	NA	NA	NA	NA	NA
WP_017684124.1|3550562_3551543_-	AraC family transcriptional regulator	NA	NA	NA	NA	NA
WP_020313150.1|3551732_3552917_+	aldo/keto reductase	NA	NA	NA	NA	NA
WP_017699538.1|3553050_3553632_+	TetR/AcrR family transcriptional regulator	NA	NA	NA	NA	NA
WP_017684127.1|3553690_3554794_+	alkene reductase	NA	NA	NA	NA	NA
WP_017684128.1|3554851_3555238_+	nuclear transport factor 2 family protein	NA	NA	NA	NA	NA
WP_017684129.1|3555298_3555994_+	SDR family oxidoreductase	NA	NA	NA	NA	NA
WP_017684130.1|3555971_3557069_-	NADH:flavin oxidoreductase	NA	NA	NA	NA	NA
WP_017684131.1|3557208_3558132_+	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_003383024.1|3559042_3559804_-	amino acid ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	41.2	1.8e-31
WP_003383026.1|3559800_3560460_-	amino acid ABC transporter permease	NA	NA	NA	NA	NA
WP_003383028.1|3560440_3561106_-	amino acid ABC transporter permease	NA	NA	NA	NA	NA
WP_003383030.1|3561410_3561572_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003383035.1|3565564_3566515_+	ABC transporter permease	NA	NA	NA	NA	NA
WP_003383036.1|3566519_3567437_+	ABC transporter permease	NA	NA	NA	NA	NA
WP_017684064.1|3567433_3569080_+	ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	33.0	3.4e-19
WP_003380476.1|3569118_3569955_+	class I SAM-dependent methyltransferase	NA	NA	NA	NA	NA
WP_017684063.1|3570080_3570602_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003380474.1|3571002_3571464_+	DUF3574 domain-containing protein	NA	NA	NA	NA	NA
WP_017705349.1|3571520_3572189_-	lytic polysaccharide monooxygenase	NA	NA	NA	NA	NA
WP_017699678.1|3572347_3572734_-	glyoxalase/bleomycin resistance/dioxygenase family protein	NA	NA	NA	NA	NA
WP_017684060.1|3572735_3573749_-	2OG-Fe(II) oxygenase	NA	NA	NA	NA	NA
WP_017684059.1|3573974_3574613_-	cysteine hydrolase	NA	NA	NA	NA	NA
WP_017684058.1|3574806_3575184_+	YceK/YidQ family lipoprotein	NA	NA	NA	NA	NA
WP_017684057.1|3575176_3575788_-	C40 family peptidase	NA	A0A2H4J1J7	uncultured_Caudovirales_phage	80.8	3.7e-96
WP_074291387.1|3575790_3576444_-|tail	phage tail length tape measure family protein	tail	A0A0S2SY57	Pseudomonas_phage	73.3	6.0e-20
3576044:3576058	attL	CCTGCACCAGCTGCG	NA	NA	NA	NA
WP_017684055.1|3576440_3576947_-|tail	tail protein	tail	A0A2H4J6K6	uncultured_Caudovirales_phage	86.0	7.8e-60
WP_017684054.1|3577013_3577709_-	hypothetical protein	NA	NA	NA	NA	NA
WP_074291386.1|3577724_3578057_-	hypothetical protein	NA	A0A2H4J4N2	uncultured_Caudovirales_phage	51.9	3.8e-23
WP_003376744.1|3578499_3578745_+	hypothetical protein	NA	W6MVE5	Pseudomonas_phage	66.7	1.0e-25
WP_003376746.1|3578741_3579719_-|integrase	site-specific integrase	integrase	W6MYA3	Pseudomonas_phage	65.5	4.5e-112
3582559:3582573	attR	CCTGCACCAGCTGCG	NA	NA	NA	NA
>prophage 14
NZ_CP012179	Pseudomonas syringae pv. actinidiae ICMP 18708 chromosome, complete genome	6555571	3723536	3783911	6555571	transposase,integrase,tRNA	Planktothrix_phage(28.57%)	53	3715107:3715124	3753931:3753948
3715107:3715124	attL	GCAGGGATCGAAAACAGC	NA	NA	NA	NA
WP_003376713.1|3723536_3725036_-|tRNA	methionine--tRNA ligase	tRNA	NA	NA	NA	NA
WP_003376715.1|3725028_3725421_-	cupin domain-containing protein	NA	NA	NA	NA	NA
WP_003376717.1|3725772_3726738_-|integrase	tyrosine-type recombinase/integrase	integrase	NA	NA	NA	NA
WP_003376719.1|3726968_3727412_+	DUF2384 domain-containing protein	NA	NA	NA	NA	NA
WP_003376721.1|3727438_3728422_-	oxidoreductase	NA	NA	NA	NA	NA
WP_003376723.1|3728484_3729105_-	TetR family transcriptional regulator C-terminal domain-containing protein	NA	NA	NA	NA	NA
WP_017684077.1|3729257_3730337_+	nitronate monooxygenase	NA	NA	NA	NA	NA
WP_003376729.1|3730438_3731206_+	molybdate ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_003376731.1|3731206_3731887_+	molybdate ABC transporter permease subunit	NA	NA	NA	NA	NA
WP_003376732.1|3731890_3732979_+	molybdenum ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	33.2	1.4e-21
WP_003376735.1|3733067_3734123_+	DNA topoisomerase IB	NA	A0A0G2Y4T8	Acanthamoeba_polyphaga_mimivirus	33.3	1.6e-43
WP_017684078.1|3734953_3736789_+	hypothetical protein	NA	A0A0U4J920	Pseudomonas_phage	31.5	8.3e-27
WP_003376737.1|3737226_3737862_-	DUF2625 domain-containing protein	NA	NA	NA	NA	NA
WP_017684080.1|3738263_3738452_-	hypothetical protein	NA	NA	NA	NA	NA
WP_085991147.1|3739002_3740582_-|transposase	IS3-like element ISPsy31 family transposase	transposase	NA	NA	NA	NA
WP_017683897.1|3741566_3742748_+	urea ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_017683896.1|3742814_3743717_+	urea ABC transporter permease subunit UrtB	NA	NA	NA	NA	NA
WP_003376852.1|3743718_3744861_+	urea ABC transporter permease subunit UrtC	NA	NA	NA	NA	NA
WP_017683895.1|3745596_3746286_+	urea ABC transporter ATP-binding subunit UrtE	NA	G9BWD6	Planktothrix_phage	29.8	1.8e-19
WP_003376859.1|3746308_3746749_+	urease accessory protein UreE	NA	NA	NA	NA	NA
WP_017683894.1|3746745_3747477_+	urease accessory protein UreF	NA	NA	NA	NA	NA
WP_020365609.1|3747492_3748188_+	urease subunit beta	NA	NA	NA	NA	NA
WP_017683893.1|3748191_3749904_+	urease subunit alpha	NA	NA	NA	NA	NA
WP_017683892.1|3749930_3750593_+	urease accessory protein UreG	NA	NA	NA	NA	NA
WP_003376868.1|3750589_3751447_+	urease accessory protein UreD	NA	NA	NA	NA	NA
WP_017683891.1|3751511_3752603_-	NADH:flavin oxidoreductase/NADH oxidase	NA	NA	NA	NA	NA
WP_003376872.1|3752662_3752998_+	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_017703799.1|3753083_3754559_-	FGGY-family carbohydrate kinase	NA	NA	NA	NA	NA
3753931:3753948	attR	GCAGGGATCGAAAACAGC	NA	NA	NA	NA
WP_017683888.1|3754589_3755522_-	transketolase	NA	NA	NA	NA	NA
WP_017683887.1|3755511_3756348_-	transketolase	NA	NA	NA	NA	NA
WP_139301609.1|3756455_3756713_-	hypothetical protein	NA	NA	NA	NA	NA
WP_005738837.1|3756711_3757716_+	ABC transporter permease	NA	NA	NA	NA	NA
WP_005770278.1|3757782_3758715_+	sugar ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_017683886.1|3758730_3760260_+	sugar ABC transporter ATP-binding protein	NA	A0A285PWH2	Cedratvirus	27.2	5.3e-11
WP_017683885.1|3760291_3761056_+	SDR family oxidoreductase	NA	NA	NA	NA	NA
WP_017683884.1|3761086_3761887_+	glucose 1-dehydrogenase	NA	W8CYX9	Bacillus_phage	42.1	1.2e-09
WP_017683883.1|3761968_3762922_+	sugar-binding transcriptional regulator	NA	NA	NA	NA	NA
WP_017683882.1|3763106_3763586_-	hypothetical protein	NA	NA	NA	NA	NA
WP_164706461.1|3763662_3764840_-|transposase	IS3 family transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	39.0	6.3e-52
WP_017685059.1|3764972_3765494_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017685058.1|3766375_3767146_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017685057.1|3767157_3768090_-	hypothetical protein	NA	NA	NA	NA	NA
WP_153303624.1|3768181_3768706_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017685001.1|3769476_3769983_-	ProQ/FinO family protein	NA	NA	NA	NA	NA
WP_017685000.1|3770704_3772315_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017684999.1|3772314_3772866_-	hypothetical protein	NA	NA	NA	NA	NA
WP_139301615.1|3772954_3773218_-	hypothetical protein	NA	NA	NA	NA	NA
WP_078983183.1|3773283_3774132_-|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_051120742.1|3774166_3775234_-|transposase	IS630-like element ISPsy32 family transposase	transposase	NA	NA	NA	NA
WP_017699599.1|3776477_3778277_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017699600.1|3778785_3780054_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017684937.1|3780253_3781195_-	hypothetical protein	NA	NA	NA	NA	NA
WP_085991147.1|3782331_3783911_-|transposase	IS3-like element ISPsy31 family transposase	transposase	NA	NA	NA	NA
>prophage 15
NZ_CP012179	Pseudomonas syringae pv. actinidiae ICMP 18708 chromosome, complete genome	6555571	3889154	3944094	6555571	holin,transposase,integrase,tRNA	uncultured_Caudovirales_phage(28.57%)	60	3893773:3893832	3947638:3949304
WP_017684753.1|3889154_3891077_-|tRNA	threonine--tRNA ligase	tRNA	A0A2K9L297	Tupanvirus	37.8	2.8e-126
WP_003382401.1|3891440_3891746_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002553156.1|3892051_3892264_+	cold-shock protein	NA	A0A1W6JNX5	Morganella_phage	61.2	6.4e-16
WP_020356716.1|3892379_3893717_+|transposase	IS4-like element ISPsy33 family transposase	transposase	NA	NA	NA	NA
3893773:3893832	attL	CCCCCGGTGTCAGGATAGTTGTCGCCTCTCCGGTTTTTCCTAAAAAAGCATGACCGGGGG	NA	NA	NA	NA
WP_085991147.1|3893821_3895400_+|transposase	IS3-like element ISPsy31 family transposase	transposase	NA	NA	NA	NA
WP_003382406.1|3895441_3895777_-	hypothetical protein	NA	NA	NA	NA	NA
WP_074291368.1|3896095_3896290_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017684164.1|3896313_3897339_-	nucleoside hydrolase	NA	NA	NA	NA	NA
WP_017684165.1|3897378_3897783_-	D-ribose pyranase	NA	NA	NA	NA	NA
WP_017684166.1|3897779_3898700_-	ribokinase	NA	NA	NA	NA	NA
WP_003382414.1|3898730_3899747_-	substrate-binding domain-containing protein	NA	C6ZCU4	Enterobacteria_phage	33.3	8.4e-37
WP_003382415.1|3899748_3900741_-	ABC transporter permease	NA	NA	NA	NA	NA
WP_003382416.1|3900737_3902291_-	sugar ABC transporter ATP-binding protein	NA	A0A2H4PQG7	Staphylococcus_phage	28.1	2.9e-12
WP_003382417.1|3902344_3903304_-	sugar ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_017684167.1|3903487_3903712_-	YgdI/YgdR family lipoprotein	NA	NA	NA	NA	NA
WP_003382419.1|3903899_3904100_+	DUF1654 domain-containing protein	NA	A0A2H4J8G7	uncultured_Caudovirales_phage	58.1	1.5e-14
WP_003382421.1|3904104_3904806_+	endonuclease	NA	NA	NA	NA	NA
WP_005738818.1|3905011_3905251_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003382423.1|3905327_3906119_-	type I methionyl aminopeptidase	NA	NA	NA	NA	NA
WP_003382424.1|3906115_3906373_-	ParD-like family protein	NA	NA	NA	NA	NA
WP_003382425.1|3906458_3906656_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003382426.1|3906757_3907789_-	Ldh family oxidoreductase	NA	NA	NA	NA	NA
WP_003382427.1|3908020_3909049_+	FecR family protein	NA	NA	NA	NA	NA
WP_005617465.1|3909251_3909641_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003382429.1|3909672_3909861_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017684169.1|3910105_3911914_+	cation:proton antiporter	NA	NA	NA	NA	NA
WP_003382433.1|3911961_3912888_-	glycosyltransferase family 2 protein	NA	NA	NA	NA	NA
WP_003382434.1|3912977_3914189_-	molybdopterin molybdotransferase MoeA	NA	NA	NA	NA	NA
WP_003382436.1|3914195_3914735_-	molybdenum cofactor biosynthesis protein B	NA	NA	NA	NA	NA
WP_017683931.1|3914810_3915416_+	molybdenum cofactor guanylyltransferase MobA	NA	NA	NA	NA	NA
WP_003382439.1|3915489_3915714_+	YgdI/YgdR family lipoprotein	NA	NA	NA	NA	NA
WP_003382440.1|3915791_3916682_-	pseudouridine synthase	NA	NA	NA	NA	NA
WP_003382441.1|3916868_3917723_+	shikimate dehydrogenase	NA	NA	NA	NA	NA
WP_003382442.1|3917726_3918398_-	TetR family transcriptional regulator	NA	NA	NA	NA	NA
WP_017683930.1|3918502_3920410_-	TIM barrel protein	NA	NA	NA	NA	NA
WP_003382444.1|3921027_3922347_+	MFS transporter	NA	NA	NA	NA	NA
WP_003382445.1|3922413_3923301_-	DMT family transporter	NA	NA	NA	NA	NA
WP_017683929.1|3923523_3924780_+	OprD family porin	NA	NA	NA	NA	NA
WP_005737978.1|3924973_3925372_-	4-carboxymuconolactone decarboxylase	NA	NA	NA	NA	NA
WP_017683928.1|3925368_3926730_-	3-carboxy-cis,cis-muconate cycloisomerase	NA	NA	NA	NA	NA
WP_003373352.1|3926754_3928104_-	MFS transporter	NA	NA	NA	NA	NA
WP_003373350.1|3928171_3928774_-	protocatechuate 3,4-dioxygenase subunit alpha	NA	NA	NA	NA	NA
WP_003373348.1|3928785_3929505_-	protocatechuate 3,4-dioxygenase subunit beta	NA	NA	NA	NA	NA
WP_003373346.1|3929632_3930562_-	pca operon transcription factor PcaQ	NA	NA	NA	NA	NA
WP_003373344.1|3930601_3930850_-	glutaredoxin family protein	NA	NA	NA	NA	NA
WP_017683927.1|3930922_3931993_-	acyltransferase	NA	A0A2H4JA46	uncultured_Caudovirales_phage	28.0	4.6e-17
WP_003373339.1|3932255_3932570_+	DUF883 domain-containing protein	NA	NA	NA	NA	NA
WP_003373338.1|3932574_3932967_+|holin	phage holin family protein	holin	NA	NA	NA	NA
WP_003373336.1|3932963_3933320_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003373333.1|3933487_3934819_+	deoxyguanosinetriphosphate triphosphohydrolase	NA	NA	NA	NA	NA
WP_003373331.1|3935070_3935463_+	response regulator	NA	NA	NA	NA	NA
WP_017683926.1|3935868_3936543_+	response regulator transcription factor	NA	NA	NA	NA	NA
WP_074556928.1|3936565_3937633_+|transposase	IS630-like element ISPsy32 family transposase	transposase	NA	NA	NA	NA
WP_017685144.1|3937788_3938115_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017685145.1|3938287_3939793_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017685136.1|3939830_3940289_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017685137.1|3940288_3940816_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017685138.1|3940926_3941616_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017685139.1|3941767_3942319_+|integrase	tyrosine-type recombinase/integrase	integrase	NA	NA	NA	NA
WP_164706461.1|3942916_3944094_-|transposase	IS3 family transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	39.0	6.3e-52
3947638:3949304	attR	CCCCCGGTCATGCTTTTTTAGGAAAAACCGGAGAGGCGACAACTATCCTGACACCGGGGGTTTTATGCATCGTTCTCACGCACGTTCTGCACTCATGCAATACATAAATCTTACTGATTATCGTGCCGATGCTCCGCGTCGGCATGCAGTTCTGGACGCTCTGCGTCCTCTTTGTGGCGCTTCGCGTCACACAACAGTTTTGCGATGTCAGTGATGTTTGCTTACGGCTCAAGGCACCTTTTCGCCCCTCGGCGAGTGACTTTGAAGGATCAAAGTAACCAAAATCCTGGCTCCGTTTCCGGCCCGACTTCGTCGGGTTCCTTCGCCCTGTCACTGATCCGGGGGTCGCTGCAACGGGCCATCCTTGGCCCAGAGTGTGTAAAAACTCAAGGTAAACCTTTGCTATGATTTCCCAGGATTTCATCGCAAGGGTTGCCCATGAAACGCTTCATCCAAGGCGAACACCGAGGTCAAAGTACCTTGCTTCCAGAGAGTCTCGACGATTACGTCAGCGACACCAATCCGGTGCGCGTTGTAGATGTCTTTGTGGATGAACTCGACCTGATCACCTTGGGTTTTGAAAGCGCTGTCCCCGCTGAAACGGGCCGACCGGCTTACCATCCTGCAGTCATGCTGAAGATCTACATCTACGGCTATCTCAACCGGATCCAGTCAAGCCGACGCCTTGAGCGCGAGGCGCAGCGCAACGTCGAACTGATGTGGCTGACCGGTCGCCTGATGCCGGATTTCAAGACCATCGCCAACTTTCGCAAAGACAACGCAAAGGGCATTCGAGGAGTCTGTCGGCAGTTTGTCGTGCTGTGTCAACAATTGGGGCTTTTCTCGGAACATTTCGTTGCCATCGATGGCAGTAAATTCAAAGCGGTGAATCACCGTGACCGCAATTTCACCAGCGCCAAATTGAAGCGGCGAATGGAAGAAATCGAGTCGAGCATCGCTCGTTATCTAACGGCGCTGGATACCGAGGATCGGCAAGAGCCCAAGACCGCGGGCCCCAAGGTCGGCCTGGAGGAGAAAATCGCCAAATTGAAGGAGCAAATGAAGGCGTTGCAGGCCATTGAGGTACAGCTTGAAGAATCCCCGGACAAACAAATTTCGCTGACCGATCCGGACGCGCGCTCAATGATGAGCAGTGGCGGAAAAGGTATCGTGGGTTACAACGTACAGACCGCGGTGGATACCAAGCATCATTTGATCGTCGCGCACGAGGTGACCAATGTCGGTCACGACCGTGATCAACTTAGCTCGATGGCCCAGCAGGCCCGTGAGGCGATGCAAGTCGAATCGTTGTCGGTGGTGGCAGACCGTGGGTATTACAAAAGCGGAGAAATCCTGGCCTGTCATGAGGCAGGGATCACAGCTTATGTGCCGAAAACGCTGAGCTCGCGGGCCAAATTTGATGGCCGCTTCGGCAATGAAGAGTTTGTTTACGATGCGGACAACGATGAGTACGTCTGTCCCGCCAATCAAGTGCTGATCTGGCGCAACTCTTACGTCGACAAGGGCAAGAAGCTGGACGTTTACTGGCGCTCCAACTGCCAAGCCTGCTCGATAAAGGCGCAATGCACACCGGCCCGAGAGAGAAAGGTTCGGCGCTGGGAACATGAGACAGTGCTAGAAGAAATGCAGGTCCGCCTGGCCAACGC	NA	NA	NA	NA
>prophage 16
NZ_CP012179	Pseudomonas syringae pv. actinidiae ICMP 18708 chromosome, complete genome	6555571	4007600	4067956	6555571	transposase	Acidithiobacillus_phage(22.22%)	38	NA	NA
WP_017682616.1|4007600_4008860_-|transposase	IS256 family transposase	transposase	A0A218MNI5	uncultured_virus	41.7	5.7e-43
WP_074556883.1|4008949_4010017_+|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_032685482.1|4010613_4012128_+|transposase	IS21-like element ISPsy40 family transposase	transposase	K4I413	Acidithiobacillus_phage	52.8	4.8e-145
WP_017683955.1|4012148_4012904_+	ATP-binding protein	NA	K4HZD4	Acidithiobacillus_phage	53.9	6.6e-71
WP_017684081.1|4014494_4018259_-	RHS repeat protein	NA	B6SD27	Bacteriophage	30.8	2.2e-146
WP_003379801.1|4018339_4018828_-	hypothetical protein	NA	NA	NA	NA	NA
WP_020315812.1|4018851_4021758_-	hypothetical protein	NA	NA	NA	NA	NA
WP_020315811.1|4021757_4023788_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017684082.1|4024123_4026544_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017684083.1|4028791_4033480_+	hypothetical protein	NA	A0A1W5K0N1	Bacteriophage	28.6	3.0e-129
WP_031313474.1|4033536_4034604_+|transposase	IS630-like element ISPsy32 family transposase	transposase	NA	NA	NA	NA
WP_017684409.1|4035304_4035856_+	type 1 fimbrial protein	NA	NA	NA	NA	NA
WP_003379789.1|4035963_4036719_+	molecular chaperone	NA	NA	NA	NA	NA
WP_017684407.1|4036757_4039271_+	fimbrial biogenesis outer membrane usher protein	NA	NA	NA	NA	NA
WP_017684406.1|4039317_4040439_+	type 1 fimbrial protein	NA	NA	NA	NA	NA
WP_017684405.1|4040476_4041982_-	hypothetical protein	NA	NA	NA	NA	NA
WP_020359549.1|4042159_4044484_-	autotransporter outer membrane beta-barrel domain-containing protein	NA	NA	NA	NA	NA
WP_017684403.1|4044813_4045344_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017684402.1|4045350_4046805_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003379782.1|4047149_4047899_+	response regulator	NA	W8CYM9	Bacillus_phage	37.6	1.0e-31
WP_017684401.1|4047895_4048930_+	HAMP domain-containing histidine kinase	NA	W8CYF6	Bacillus_phage	20.4	2.4e-07
WP_017684400.1|4049045_4049684_+	EF-hand domain-containing protein	NA	NA	NA	NA	NA
WP_017684608.1|4050993_4052043_-	AI-2E family transporter	NA	NA	NA	NA	NA
WP_020315806.1|4052134_4052965_-	DUF4892 domain-containing protein	NA	NA	NA	NA	NA
WP_017684606.1|4053104_4053959_-	alpha/beta fold hydrolase	NA	NA	NA	NA	NA
WP_017684605.1|4053955_4054765_-	alpha/beta hydrolase	NA	NA	NA	NA	NA
WP_003379767.1|4054884_4055328_-	hotdog fold thioesterase	NA	NA	NA	NA	NA
WP_017684604.1|4055390_4055846_-	phosphohistidine phosphatase SixA	NA	NA	NA	NA	NA
WP_017684603.1|4055842_4056187_-	DUF4389 domain-containing protein	NA	NA	NA	NA	NA
WP_017684602.1|4056226_4057252_-	NAD(P)H-dependent glycerol-3-phosphate dehydrogenase	NA	NA	NA	NA	NA
WP_017684601.1|4057572_4059498_+	response regulator	NA	Q8QKV7	Ectocarpus_siliculosus_virus	31.2	1.2e-44
WP_003379759.1|4059718_4060234_+	3-hydroxyacyl-[acyl-carrier-protein] dehydratase FabA	NA	NA	NA	NA	NA
WP_003379758.1|4060244_4061468_+	beta-ketoacyl-ACP synthase I	NA	NA	NA	NA	NA
WP_003379757.1|4061729_4062458_-	dienelactone hydrolase family protein	NA	NA	NA	NA	NA
WP_003379756.1|4062548_4064456_-	molecular chaperone HtpG	NA	A0A1B1ISV4	uncultured_Mediterranean_phage	38.4	6.5e-115
WP_005738079.1|4064771_4065032_+	lipoprotein	NA	NA	NA	NA	NA
WP_020356716.1|4065082_4066420_-|transposase	IS4-like element ISPsy33 family transposase	transposase	NA	NA	NA	NA
WP_051120742.1|4066888_4067956_-|transposase	IS630-like element ISPsy32 family transposase	transposase	NA	NA	NA	NA
>prophage 17
NZ_CP012179	Pseudomonas syringae pv. actinidiae ICMP 18708 chromosome, complete genome	6555571	4494668	4527791	6555571	transposase	Pseudomonas_virus(25.0%)	25	NA	NA
WP_099818608.1|4494668_4496247_+|transposase	IS3-like element ISPsy31 family transposase	transposase	NA	NA	NA	NA
WP_017685084.1|4496877_4497798_+	recombination-associated protein RdgC	NA	L7TP07	Pseudomonas_virus	69.6	9.4e-120
WP_017685083.1|4497886_4498846_+	bile acid:sodium symporter family protein	NA	NA	NA	NA	NA
WP_032685472.1|4499351_4500719_+	group II intron reverse transcriptase/maturase	NA	A0A0U4J920	Pseudomonas_phage	30.9	6.4e-32
WP_003383327.1|4501102_4502977_-	MFS transporter	NA	NA	NA	NA	NA
WP_017684968.1|4503042_4505208_-	DEAD/DEAH box helicase	NA	A0A1B1IUI1	uncultured_Mediterranean_phage	25.7	4.9e-42
WP_085991147.1|4505233_4506813_-|transposase	IS3-like element ISPsy31 family transposase	transposase	NA	NA	NA	NA
WP_017685175.1|4507394_4507868_-	hypothetical protein	NA	NA	NA	NA	NA
WP_099818608.1|4507993_4509573_-|transposase	IS3-like element ISPsy31 family transposase	transposase	NA	NA	NA	NA
WP_173929751.1|4509569_4510421_-	hypothetical protein	NA	NA	NA	NA	NA
WP_085991147.1|4510585_4512164_+|transposase	IS3-like element ISPsy31 family transposase	transposase	NA	NA	NA	NA
WP_017685021.1|4512185_4512914_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017685022.1|4513802_4514360_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017685023.1|4514509_4514674_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017685024.1|4514768_4515431_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017685025.1|4515536_4515734_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017699032.1|4517211_4517967_-	ATP-binding protein	NA	K4HZD4	Acidithiobacillus_phage	53.9	3.9e-71
WP_017685052.1|4520266_4521031_+	WYL domain-containing protein	NA	NA	NA	NA	NA
WP_017685051.1|4521130_4522234_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017685050.1|4522233_4523262_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017703861.1|4523386_4523992_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017685152.1|4524155_4524461_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017705749.1|4524561_4524894_-	sel1 repeat family protein	NA	NA	NA	NA	NA
WP_074556923.1|4525076_4526144_+|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_085991147.1|4526211_4527791_-|transposase	IS3-like element ISPsy31 family transposase	transposase	NA	NA	NA	NA
>prophage 18
NZ_CP012179	Pseudomonas syringae pv. actinidiae ICMP 18708 chromosome, complete genome	6555571	4530844	4586788	6555571	transposase,protease,tRNA	uncultured_Caudovirales_phage(22.22%)	43	NA	NA
WP_074556923.1|4530844_4531912_+|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_032685473.1|4532016_4533084_+|transposase	IS630-like element ISPsy32 family transposase	transposase	NA	NA	NA	NA
WP_017684899.1|4533663_4533969_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017707003.1|4533965_4535141_-	EndoU domain-containing protein	NA	I3NLA2	Bifidobacterium_phage	38.2	4.0e-06
WP_017684903.1|4535662_4538668_-|protease	autotransporter serine protease	protease	NA	NA	NA	NA
WP_032685463.1|4539013_4540081_+|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_017684577.1|4540905_4542471_-	methyl-accepting chemotaxis protein	NA	A0A1B0V854	Salmonella_phage	49.7	2.3e-41
WP_017684576.1|4542734_4543079_+	topoisomerase DNA-binding C4 zinc finger domain-containing protein	NA	NA	NA	NA	NA
WP_017684575.1|4543123_4545319_-	peptidoglycan-binding protein LysM	NA	NA	NA	NA	NA
WP_003381003.1|4545415_4545850_-	MarR family transcriptional regulator	NA	NA	NA	NA	NA
WP_017684574.1|4545943_4548073_-	DNA helicase RecQ	NA	L7RCS0	Acanthamoeba_polyphaga_moumouvirus	34.1	5.6e-83
WP_003381005.1|4548249_4548837_+	YecA family protein	NA	NA	NA	NA	NA
WP_003381007.1|4548847_4549252_+	YbaN family protein	NA	NA	NA	NA	NA
WP_003381009.1|4549282_4550779_-	polyphosphate:AMP phosphotransferase	NA	NA	NA	NA	NA
WP_017699444.1|4550926_4552909_+|tRNA	bifunctional tRNA (5-methylaminomethyl-2-thiouridine)(34)-methyltransferase MnmD/FAD-dependent 5-carboxymethylaminomethyl-2-thiouridine(34) oxidoreductase MnmC	tRNA	NA	NA	NA	NA
WP_003381013.1|4553075_4553744_+	ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	36.6	1.7e-30
WP_017683710.1|4553743_4556227_+	ABC transporter permease	NA	NA	NA	NA	NA
WP_017683711.1|4556216_4557296_+	iron ABC transporter permease	NA	NA	NA	NA	NA
WP_003381016.1|4557341_4557818_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003381017.1|4558090_4559863_+	N-acetylglutaminylglutamine amidotransferase	NA	R4TIC1	Phaeocystis_globosa_virus	29.6	2.6e-33
WP_003381018.1|4559866_4561615_+	N-acetylglutaminylglutamine synthetase	NA	NA	NA	NA	NA
WP_005735209.1|4561697_4562894_+	osmoprotectant NAGGN system M42 family peptidase	NA	NA	NA	NA	NA
WP_004879420.1|4562965_4563193_+	YheU family protein	NA	A0A2H4J8A7	uncultured_Caudovirales_phage	89.3	4.0e-32
WP_003381023.1|4563195_4563390_-	carbon storage regulator CsrA	NA	A0A2I7RT00	Vibrio_phage	60.4	3.9e-12
WP_003381025.1|4563559_4563892_-	YnfA family protein	NA	A0A2H4JF35	uncultured_Caudovirales_phage	83.6	3.4e-48
WP_003381027.1|4564620_4565436_-	SDR family oxidoreductase	NA	NA	NA	NA	NA
WP_017683713.1|4565540_4565918_-	DUF2784 domain-containing protein	NA	NA	NA	NA	NA
WP_002552554.1|4566242_4566401_+	DUF3309 domain-containing protein	NA	NA	NA	NA	NA
WP_003381031.1|4566531_4568190_-	cation acetate symporter	NA	NA	NA	NA	NA
WP_002552552.1|4568186_4568498_-	DUF485 domain-containing protein	NA	NA	NA	NA	NA
WP_003381033.1|4568745_4569600_-	glycine betaine ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_017683715.1|4570876_4572175_+	serine protein kinase PrkA	NA	NA	NA	NA	NA
WP_017683716.1|4572167_4572980_+	VacJ family lipoprotein	NA	NA	NA	NA	NA
WP_003381036.1|4573114_4573714_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003381037.1|4573740_4574649_-	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_003381038.1|4574758_4575976_+	MFS transporter	NA	NA	NA	NA	NA
WP_017683717.1|4576273_4577356_+	diguanylate cyclase	NA	A0A127AWB9	Bacillus_phage	31.2	2.5e-15
WP_003381040.1|4577360_4578233_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003381041.1|4579181_4579901_-	hypothetical protein	NA	NA	NA	NA	NA
WP_085991147.1|4579995_4581575_-|transposase	IS3-like element ISPsy31 family transposase	transposase	NA	NA	NA	NA
WP_003381043.1|4581733_4582012_-	response regulator transcription factor	NA	NA	NA	NA	NA
WP_003381045.1|4582485_4583802_-	MFS transporter	NA	NA	NA	NA	NA
WP_019331326.1|4585357_4586788_-|transposase	IS1182-like element ISPsy36 family transposase	transposase	NA	NA	NA	NA
>prophage 19
NZ_CP012179	Pseudomonas syringae pv. actinidiae ICMP 18708 chromosome, complete genome	6555571	4723357	4788732	6555571	transposase,protease,tRNA	Pseudomonas_phage(28.57%)	51	NA	NA
WP_017683453.1|4723357_4723828_-|tRNA	Cys-tRNA(Pro) deacylase	tRNA	NA	NA	NA	NA
WP_004396504.1|4724179_4725037_+	aquaporin	NA	NA	NA	NA	NA
WP_004396510.1|4725066_4726572_+	glycerol kinase GlpK	NA	NA	NA	NA	NA
WP_004396514.1|4726682_4727438_+	DeoR/GlpR family transcriptional regulator	NA	A0A077SK06	Escherichia_phage	30.3	1.8e-23
WP_017683452.1|4727879_4729418_+	glycerol-3-phosphate dehydrogenase	NA	NA	NA	NA	NA
WP_004396519.1|4729773_4730688_+	glutamate/aspartate ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_017683451.1|4730902_4731649_+	amino acid ABC transporter permease	NA	NA	NA	NA	NA
WP_170870095.1|4731645_4732314_+	ABC transporter permease subunit	NA	NA	NA	NA	NA
WP_005620053.1|4732310_4733045_+	amino acid ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	38.5	1.7e-31
WP_017683450.1|4733103_4735020_+	sensor histidine kinase	NA	NA	NA	NA	NA
WP_017683449.1|4735030_4736359_+	sigma-54-dependent Fis family transcriptional regulator	NA	NA	NA	NA	NA
WP_003373498.1|4736867_4738235_+	group II intron reverse transcriptase/maturase	NA	A0A0U4J920	Pseudomonas_phage	30.9	8.4e-32
WP_019331326.1|4738497_4739928_+|transposase	IS1182-like element ISPsy36 family transposase	transposase	NA	NA	NA	NA
WP_017684572.1|4740278_4740926_-	DsbA family oxidoreductase	NA	NA	NA	NA	NA
WP_032610077.1|4740979_4741972_-	alpha/beta hydrolase	NA	NA	NA	NA	NA
WP_003378416.1|4742157_4744458_-	5-methyltetrahydropteroyltriglutamate-- homocysteine S-methyltransferase	NA	NA	NA	NA	NA
WP_003378418.1|4744564_4745482_+	transcriptional regulator MetR	NA	NA	NA	NA	NA
WP_003378420.1|4745551_4745962_-	NUDIX domain-containing protein	NA	NA	NA	NA	NA
WP_003378421.1|4745958_4747050_-	D-alanine--D-alanine ligase	NA	NA	NA	NA	NA
WP_003378422.1|4747201_4747483_-	type B 50S ribosomal protein L31	NA	NA	NA	NA	NA
WP_003378427.1|4749001_4749682_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003378429.1|4749728_4750478_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017684569.1|4750881_4751616_+	hypothetical protein	NA	NA	NA	NA	NA
WP_085991147.1|4751612_4753191_+|transposase	IS3-like element ISPsy31 family transposase	transposase	NA	NA	NA	NA
WP_074556883.1|4753460_4754528_-|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_017685228.1|4754995_4755361_+	hypothetical protein	NA	NA	NA	NA	NA
WP_051120742.1|4755417_4756485_+|transposase	IS630-like element ISPsy32 family transposase	transposase	NA	NA	NA	NA
WP_017684795.1|4756636_4757542_-	hypothetical protein	NA	NA	NA	NA	NA
WP_020365664.1|4757903_4761023_+	penicillin-binding protein	NA	NA	NA	NA	NA
WP_003378435.1|4761101_4761701_+	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_003378437.1|4761697_4762465_+	siderophore-interacting protein	NA	NA	NA	NA	NA
WP_003378439.1|4762486_4763146_-	Pr6Pr family membrane protein	NA	NA	NA	NA	NA
WP_003378441.1|4763216_4763444_-	DUF2132 domain-containing protein	NA	NA	NA	NA	NA
WP_020365665.1|4763888_4766282_+	glucose/quinate/shikimate family membrane-bound PQQ-dependent dehydrogenase	NA	NA	NA	NA	NA
WP_019331326.1|4767326_4768757_+|transposase	IS1182-like element ISPsy36 family transposase	transposase	NA	NA	NA	NA
WP_017684695.1|4769155_4770352_-	extracellular solute-binding protein	NA	NA	NA	NA	NA
WP_017684696.1|4770348_4771356_-	GTP-binding protein	NA	NA	NA	NA	NA
WP_003378449.1|4771352_4771652_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003378452.1|4771674_4772424_-	SDR family oxidoreductase	NA	W8CYX9	Bacillus_phage	41.8	5.5e-09
WP_017684697.1|4772455_4773217_-	SDR family oxidoreductase	NA	Q06VL0	Trichoplusia_ni_ascovirus	30.3	4.7e-16
WP_017684698.1|4773227_4774568_-	MFS transporter	NA	NA	NA	NA	NA
WP_003378455.1|4774595_4775477_-	polysaccharide deacetylase	NA	NA	NA	NA	NA
WP_017684699.1|4775558_4776932_-	amidase	NA	NA	NA	NA	NA
WP_003378457.1|4777279_4778272_+	GntR family transcriptional regulator	NA	NA	NA	NA	NA
WP_032685472.1|4779459_4780827_+	group II intron reverse transcriptase/maturase	NA	A0A0U4J920	Pseudomonas_phage	30.9	6.4e-32
WP_003378458.1|4781205_4781628_-	group 1 truncated hemoglobin	NA	NA	NA	NA	NA
WP_017683179.1|4781627_4782503_-	DUF3034 family protein	NA	NA	NA	NA	NA
WP_017683180.1|4782506_4784861_-	EAL domain-containing protein	NA	NA	NA	NA	NA
WP_017683181.1|4784857_4785532_-	methylamine utilization protein	NA	NA	NA	NA	NA
WP_017683182.1|4785713_4788131_+	endopeptidase La	NA	A0A0R6PGP8	Moraxella_phage	38.1	3.2e-135
WP_003378464.1|4788339_4788732_+|protease	protease inhibitor I42 family protein	protease	NA	NA	NA	NA
>prophage 20
NZ_CP012179	Pseudomonas syringae pv. actinidiae ICMP 18708 chromosome, complete genome	6555571	4900734	4956716	6555571	transposase	Acinetobacter_phage(33.33%)	54	NA	NA
WP_074556883.1|4900734_4901802_-|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_003380915.1|4902278_4902722_+	type VI secretion system amidase immunity protein Tai4	NA	NA	NA	NA	NA
WP_085991147.1|4902860_4904439_+|transposase	IS3-like element ISPsy31 family transposase	transposase	NA	NA	NA	NA
WP_017684377.1|4904505_4904850_+	type VI secretion system amidase immunity protein Tai4	NA	NA	NA	NA	NA
WP_003380918.1|4904878_4905319_+	type VI secretion system amidase immunity protein Tai4	NA	NA	NA	NA	NA
WP_017684376.1|4905396_4905882_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003380920.1|4906342_4906576_+	DUF3077 domain-containing protein	NA	NA	NA	NA	NA
WP_017684375.1|4906618_4907776_-	phosphatidylserine/phosphatidylglycerophosphate/ cardiolipin synthase family protein	NA	NA	NA	NA	NA
WP_003380922.1|4907777_4908359_-	YceI family protein	NA	NA	NA	NA	NA
WP_017684374.1|4908439_4908778_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017684373.1|4908774_4909881_-	serine hydrolase	NA	NA	NA	NA	NA
WP_003380926.1|4910376_4911132_+	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_003380928.1|4911131_4911938_+	1-acyl-sn-glycerol-3-phosphate acyltransferase	NA	NA	NA	NA	NA
WP_017684372.1|4911895_4912495_-	DUF479 domain-containing protein	NA	NA	NA	NA	NA
WP_003380932.1|4912659_4912974_+	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_003380935.1|4913006_4914173_+	MFS transporter	NA	NA	NA	NA	NA
WP_005739519.1|4914194_4915244_+	alkene reductase	NA	NA	NA	NA	NA
WP_017684371.1|4915334_4916186_-	ATPase	NA	NA	NA	NA	NA
WP_003380938.1|4916269_4917262_-	NAD(P)-dependent oxidoreductase	NA	NA	NA	NA	NA
WP_003380939.1|4917333_4918233_-	LysR family transcriptional regulator ArgP	NA	NA	NA	NA	NA
WP_017684370.1|4918328_4918931_+	amino acid transporter	NA	NA	NA	NA	NA
WP_017684369.1|4919123_4919705_+	superoxide dismutase	NA	NA	NA	NA	NA
WP_017684368.1|4920091_4922143_+	GGDEF and EAL domain-containing protein	NA	NA	NA	NA	NA
WP_017684367.1|4922318_4923683_+	peptidase	NA	NA	NA	NA	NA
WP_017684366.1|4923885_4924770_+	DUF4123 domain-containing protein	NA	NA	NA	NA	NA
WP_017684365.1|4924766_4926023_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017684363.1|4926172_4927231_+	hypothetical protein	NA	NA	NA	NA	NA
WP_164706461.1|4927227_4928404_+|transposase	IS3 family transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	39.0	6.3e-52
WP_017684745.1|4928555_4929053_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003380955.1|4929172_4930600_+	c-type cytochrome	NA	NA	NA	NA	NA
WP_017684744.1|4930661_4931726_+	imelysin family lipoprotein	NA	NA	NA	NA	NA
WP_017684743.1|4931742_4932840_+	DUF1513 domain-containing protein	NA	NA	NA	NA	NA
WP_003380959.1|4932864_4933092_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003380961.1|4933088_4933811_-	InaA protein	NA	NA	NA	NA	NA
WP_003380963.1|4933815_4934496_-	class I SAM-dependent methyltransferase	NA	NA	NA	NA	NA
WP_003380966.1|4934696_4935986_-	HAMP domain-containing histidine kinase	NA	B5LWA6	Feldmannia_species_virus	30.1	1.4e-07
WP_002555020.1|4935975_4936659_-	response regulator transcription factor	NA	W8CYM9	Bacillus_phage	34.5	5.1e-30
WP_017684742.1|4936835_4937576_+	phosphatase PAP2 family protein	NA	NA	NA	NA	NA
WP_085991147.1|4937790_4939370_-|transposase	IS3-like element ISPsy31 family transposase	transposase	NA	NA	NA	NA
WP_085991147.1|4940156_4941735_+|transposase	IS3-like element ISPsy31 family transposase	transposase	NA	NA	NA	NA
WP_017698963.1|4942443_4944087_-	chaperonin GroEL	NA	A0A2I7SAK5	Vibrio_phage	64.1	5.7e-176
WP_003304675.1|4944136_4944430_-	co-chaperone GroES	NA	A0A221S322	uncultured_virus	38.9	1.1e-13
WP_003380970.1|4944684_4945179_-	membrane protein FxsA	NA	NA	NA	NA	NA
WP_003380971.1|4945498_4946257_+	SDR family oxidoreductase	NA	NA	NA	NA	NA
WP_005620274.1|4946305_4947313_-	DUF481 domain-containing protein	NA	NA	NA	NA	NA
WP_024533364.1|4947477_4947834_+	MGMT family protein	NA	NA	NA	NA	NA
WP_003380974.1|4947888_4949439_+	AmpG family muropeptide MFS transporter	NA	NA	NA	NA	NA
WP_003380975.1|4949471_4949786_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003380976.1|4949846_4950677_-	mechanosensitive ion channel family protein	NA	NA	NA	NA	NA
WP_003380977.1|4950799_4951279_-	YajQ family cyclic di-GMP-binding protein	NA	NA	NA	NA	NA
WP_003380978.1|4951448_4952369_+	putative 2-dehydropantoate 2-reductase	NA	NA	NA	NA	NA
WP_017685041.1|4952413_4954450_+	PAS domain-containing protein	NA	NA	NA	NA	NA
WP_017685040.1|4954465_4955044_+	cob(I)yrinic acid a,c-diamide adenosyltransferase	NA	NA	NA	NA	NA
WP_164706461.1|4955539_4956716_+|transposase	IS3 family transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	39.0	6.3e-52
>prophage 21
NZ_CP012179	Pseudomonas syringae pv. actinidiae ICMP 18708 chromosome, complete genome	6555571	5023700	5161388	6555571	transposase,protease,integrase,tRNA	Pseudomonas_phage(20.0%)	114	5085942:5085956	5164283:5164297
WP_020315413.1|5023700_5025047_-|protease	metalloprotease PmbA	protease	NA	NA	NA	NA
WP_003377535.1|5025154_5025676_+	ribosome-associated protein	NA	NA	NA	NA	NA
WP_005739076.1|5025724_5027164_-|protease	metalloprotease TldD	protease	NA	NA	NA	NA
WP_003377533.1|5027166_5028012_-	carbon-nitrogen hydrolase family protein	NA	NA	NA	NA	NA
WP_017682741.1|5028060_5031876_-	TIGR02099 family protein	NA	NA	NA	NA	NA
WP_003377531.1|5032057_5033515_-	ribonuclease G	NA	NA	NA	NA	NA
WP_017682742.1|5033511_5034114_-	septum formation inhibitor Maf	NA	NA	NA	NA	NA
WP_003377527.1|5034181_5034673_-	rod shape-determining protein MreD	NA	NA	NA	NA	NA
WP_074291260.1|5034665_5035793_-	rod shape-determining protein MreC	NA	NA	NA	NA	NA
WP_002555108.1|5035975_5037013_-	rod shape-determining protein MreB	NA	NA	NA	NA	NA
WP_002555109.1|5037219_5037507_+|tRNA	Asp-tRNA(Asn)/Glu-tRNA(Gln) amidotransferase subunit GatC	tRNA	NA	NA	NA	NA
WP_017682744.1|5037521_5038973_+|tRNA	Asp-tRNA(Asn)/Glu-tRNA(Gln) amidotransferase subunit GatA	tRNA	NA	NA	NA	NA
WP_003377520.1|5038983_5040447_+|tRNA	Asp-tRNA(Asn)/Glu-tRNA(Gln) amidotransferase subunit GatB	tRNA	NA	NA	NA	NA
WP_003382616.1|5040864_5042196_+|transposase	IS110-like element ISPsy35 family transposase	transposase	Q9JMN8	Wolbachia_phage	43.6	1.8e-95
WP_003377519.1|5042408_5042777_+	septal ring lytic transglycosylase RlpA family protein	NA	F5B3X9	Synechococcus_phage	51.7	1.3e-24
WP_017683574.1|5042843_5043875_+	calcium/sodium antiporter	NA	NA	NA	NA	NA
WP_017683573.1|5043906_5044290_+	carboxymuconolactone decarboxylase family protein	NA	NA	NA	NA	NA
WP_017683572.1|5044276_5045227_-	AEC family transporter	NA	NA	NA	NA	NA
WP_017683571.1|5045331_5046924_-	alkaline phosphatase D family protein	NA	NA	NA	NA	NA
WP_017683570.1|5047072_5048089_+	class I SAM-dependent rRNA methyltransferase	NA	W6LLI2	Streptococcus_phage	29.2	1.0e-13
WP_020315391.1|5048213_5051177_+	DUF748 domain-containing protein	NA	NA	NA	NA	NA
WP_020315390.1|5051202_5051511_+	DUF2845 domain-containing protein	NA	NA	NA	NA	NA
WP_004656644.1|5051665_5052019_-	BON domain-containing protein	NA	NA	NA	NA	NA
WP_003377508.1|5052308_5054414_-	polyribonucleotide nucleotidyltransferase	NA	NA	NA	NA	NA
WP_002555121.1|5054589_5054859_-	30S ribosomal protein S15	NA	NA	NA	NA	NA
WP_003377507.1|5055017_5055935_-|tRNA	tRNA pseudouridine(55) synthase TruB	tRNA	NA	NA	NA	NA
WP_003377505.1|5055938_5056355_-	30S ribosome-binding factor RbfA	NA	NA	NA	NA	NA
WP_003377503.1|5056514_5059040_-	translation initiation factor IF-2	NA	A0A2H4UTS4	Bodo_saltans_virus	23.3	5.5e-21
WP_005620402.1|5059067_5060549_-	transcription termination/antitermination protein NusA	NA	NA	NA	NA	NA
WP_020315387.1|5060608_5061067_-	ribosome maturation factor RimP	NA	NA	NA	NA	NA
WP_005739096.1|5061501_5061882_-	preprotein translocase subunit SecG	NA	NA	NA	NA	NA
WP_005739097.1|5061886_5062642_-	triose-phosphate isomerase	NA	NA	NA	NA	NA
WP_003377494.1|5062708_5064052_-	phosphoglucosamine mutase	NA	NA	NA	NA	NA
WP_017683566.1|5064068_5064920_-	dihydropteroate synthase	NA	NA	NA	NA	NA
WP_017683565.1|5064928_5066833_-|protease	ATP-dependent zinc metalloprotease FtsH	protease	I3UL75	Ostreococcus_lucimarinus_virus	49.0	2.6e-116
WP_005888982.1|5067026_5067677_-	23S rRNA (uridine(2552)-2'-O)-methyltransferase RlmE	NA	NA	NA	NA	NA
WP_003377487.1|5067780_5068092_+	YhbY family RNA-binding protein	NA	NA	NA	NA	NA
WP_005620412.1|5068172_5068649_-	transcription elongation factor GreA	NA	NA	NA	NA	NA
WP_017683564.1|5068645_5071867_-	carbamoyl-phosphate synthase large subunit	NA	NA	NA	NA	NA
WP_007243710.1|5072002_5073139_-	glutamine-hydrolyzing carbamoyl-phosphate synthase small subunit	NA	NA	NA	NA	NA
WP_003377483.1|5073355_5074159_-	4-hydroxy-tetrahydrodipicolinate reductase	NA	NA	NA	NA	NA
WP_003377482.1|5074181_5075324_-	molecular chaperone DnaJ	NA	E3T4P7	Cafeteria_roenbergensis_virus	35.5	2.7e-23
WP_017683563.1|5075649_5077569_-	molecular chaperone DnaK	NA	G8DDB7	Micromonas_pusilla_virus	48.3	9.0e-149
WP_003377479.1|5077679_5078243_-	nucleotide exchange factor GrpE	NA	NA	NA	NA	NA
WP_017683562.1|5078512_5080186_+	DNA repair protein RecN	NA	NA	NA	NA	NA
WP_002555142.1|5080264_5080672_-	ferric iron uptake transcriptional regulator	NA	NA	NA	NA	NA
WP_003377475.1|5080770_5081292_+	outer membrane protein assembly factor BamE	NA	NA	NA	NA	NA
WP_085991147.1|5082687_5084266_+|transposase	IS3-like element ISPsy31 family transposase	transposase	NA	NA	NA	NA
WP_003377474.1|5084468_5084783_-	RnfH family protein	NA	NA	NA	NA	NA
WP_003377473.1|5084775_5085210_-	type II toxin-antitoxin system RatA family toxin	NA	NA	NA	NA	NA
WP_007243715.1|5085217_5086621_-	sodium-dependent transporter	NA	NA	NA	NA	NA
5085942:5085956	attL	ATCGCTGGCAGCAAA	NA	NA	NA	NA
WP_003377471.1|5086734_5087217_+	SsrA-binding protein SmpB	NA	W5RAM5	Staphylococcus_phage	42.1	1.2e-25
WP_003377470.1|5087509_5087794_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017699800.1|5088508_5088985_+	hypothetical protein	NA	NA	NA	NA	NA
WP_085991147.1|5089521_5091100_+|transposase	IS3-like element ISPsy31 family transposase	transposase	NA	NA	NA	NA
WP_017685082.1|5091121_5091646_-	LysE family translocator	NA	NA	NA	NA	NA
WP_017685081.1|5092106_5092610_+	type VI secretion system tube protein Hcp	NA	NA	NA	NA	NA
WP_017685080.1|5093030_5093480_+	DUF1493 family protein	NA	NA	NA	NA	NA
WP_078983197.1|5093627_5093951_-|transposase	IS66 family transposase zinc-finger binding domain-containing protein	transposase	NA	NA	NA	NA
WP_051120749.1|5093967_5095500_-|transposase	IS66-like element ISPsy34 family transposase	transposase	S5VTD3	Leptospira_phage	36.4	2.6e-82
WP_078983159.1|5095517_5095727_-	IS66 family insertion sequence element accessory protein TnpB	NA	NA	NA	NA	NA
WP_017683608.1|5095754_5097023_-	group II intron reverse transcriptase/maturase	NA	A0A0U4J920	Pseudomonas_phage	30.1	4.7e-29
WP_074291269.1|5097429_5097735_-	IS66 family insertion sequence element accessory protein TnpB	NA	NA	NA	NA	NA
WP_017683594.1|5097810_5098860_+	dTDP-glucose 4,6-dehydratase	NA	I7HTA3	Enterobacteria_phage	45.3	4.1e-79
WP_017683593.1|5098856_5099762_+	dTDP-4-dehydrorhamnose reductase	NA	A0A291LA50	Escherichia_phage	33.5	5.9e-26
WP_005615131.1|5099770_5100652_+	glucose-1-phosphate thymidylyltransferase RfbA	NA	K7QKA7	Escherichia_phage	60.1	3.3e-98
WP_017683592.1|5100917_5102825_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017683591.1|5102900_5104823_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003382207.1|5104851_5106153_-	NAD(P)/FAD-dependent oxidoreductase	NA	NA	NA	NA	NA
WP_005615114.1|5106183_5107218_-	flippase-like domain-containing protein	NA	NA	NA	NA	NA
WP_003382214.1|5107198_5107966_-	glucose-1-phosphate cytidylyltransferase	NA	NA	NA	NA	NA
WP_003382215.1|5107975_5108938_-	glycosyltransferase family 2 protein	NA	E7C9N8	Salmonella_phage	32.8	5.9e-40
WP_017683590.1|5108964_5109780_-	NAD(P)-dependent oxidoreductase	NA	NA	NA	NA	NA
WP_003382217.1|5109776_5110859_-	CDP-glucose 4,6-dehydratase	NA	A0A0P0YMS6	Yellowstone_lake_phycodnavirus	26.4	5.3e-21
WP_017683589.1|5111076_5113602_-	glycosyltransferase family 4 protein	NA	NA	NA	NA	NA
WP_017683588.1|5113601_5115149_-	class I SAM-dependent methyltransferase	NA	NA	NA	NA	NA
WP_005736595.1|5115145_5116363_-	ABC transporter ATP-binding protein	NA	A0A2H4PQG7	Staphylococcus_phage	27.2	6.3e-15
WP_005615100.1|5116359_5117154_-	ABC transporter permease	NA	NA	NA	NA	NA
WP_003382222.1|5117686_5118718_+	GDP-mannose 4,6-dehydratase	NA	M1IBC3	Acanthocystis_turfacea_Chlorella_virus	54.7	6.8e-103
WP_017683587.1|5118717_5119614_+	GDP-mannose 4,6-dehydratase	NA	M1IBC3	Acanthocystis_turfacea_Chlorella_virus	26.6	7.2e-16
WP_003382224.1|5119728_5120841_+	glycosyltransferase	NA	NA	NA	NA	NA
WP_020365677.1|5120906_5122964_-	methyl-accepting chemotaxis protein	NA	NA	NA	NA	NA
WP_017683585.1|5123306_5124428_+	J domain-containing protein	NA	NA	NA	NA	NA
WP_017683584.1|5124787_5126029_+|integrase	tyrosine-type recombinase/integrase	integrase	A0A2H4JAT5	uncultured_Caudovirales_phage	39.5	6.1e-74
WP_017683583.1|5126300_5127146_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017683582.1|5127236_5127518_+	AlpA family phage regulatory protein	NA	NA	NA	NA	NA
WP_017683581.1|5127514_5128123_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017683580.1|5128575_5128734_+	hypothetical protein	NA	A0A1B0VP73	Pseudomonas_phage	67.3	6.2e-08
WP_017683579.1|5128730_5129012_+	hypothetical protein	NA	NA	NA	NA	NA
WP_005771372.1|5129008_5129290_+	DUF3077 domain-containing protein	NA	NA	NA	NA	NA
WP_017683578.1|5129286_5132187_+	DUF927 domain-containing protein	NA	A0A1B0VP75	Pseudomonas_phage	31.8	8.5e-58
WP_017683577.1|5132280_5133225_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017683576.1|5133962_5134535_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017684741.1|5134914_5135748_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017684740.1|5135961_5136861_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017684739.1|5136857_5138543_+	hypothetical protein	NA	NA	NA	NA	NA
WP_019334102.1|5138646_5139612_+	DUF4238 domain-containing protein	NA	NA	NA	NA	NA
WP_017684737.1|5140072_5141170_+	DUF1524 domain-containing protein	NA	NA	NA	NA	NA
WP_017684736.1|5141506_5141737_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017684735.1|5141752_5142316_+|integrase	tyrosine-type recombinase/integrase	integrase	A0A1B0VMI6	Pseudomonas_phage	38.8	6.3e-18
WP_017684732.1|5142998_5143442_+	transcriptional regulator	NA	A0A1B0VMC9	Pseudomonas_phage	82.8	2.4e-65
WP_020360176.1|5143591_5143807_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017684729.1|5146576_5147515_-	FecR domain-containing protein	NA	NA	NA	NA	NA
WP_003382231.1|5147518_5148028_-	sigma-70 family RNA polymerase sigma factor	NA	NA	NA	NA	NA
WP_017684728.1|5148377_5149997_-	methyl-accepting chemotaxis protein	NA	A0A2H4J162	uncultured_Caudovirales_phage	46.8	1.2e-80
WP_074556939.1|5150453_5151521_-|transposase	IS630-like element ISPsy32 family transposase	transposase	NA	NA	NA	NA
WP_017685061.1|5152447_5153038_+	flavodoxin	NA	NA	NA	NA	NA
WP_017685060.1|5153062_5154055_+	aldo/keto reductase	NA	NA	NA	NA	NA
WP_020304130.1|5154114_5154582_+	cupin domain-containing protein	NA	NA	NA	NA	NA
WP_164706461.1|5154850_5156027_+|transposase	IS3 family transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	39.0	6.3e-52
WP_017684104.1|5156184_5157015_+	hypothetical protein	NA	NA	NA	NA	NA
WP_074556941.1|5157040_5158396_-|integrase	tyrosine-type recombinase/integrase	integrase	NA	NA	NA	NA
WP_032685463.1|5158636_5159704_+|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_024533178.1|5160377_5161388_-|integrase	tyrosine-type recombinase/integrase	integrase	NA	NA	NA	NA
5164283:5164297	attR	ATCGCTGGCAGCAAA	NA	NA	NA	NA
>prophage 22
NZ_CP012179	Pseudomonas syringae pv. actinidiae ICMP 18708 chromosome, complete genome	6555571	5205696	5215883	6555571		Burkholderia_virus(37.5%)	10	NA	NA
WP_017683348.1|5205696_5206773_-	DUF3396 domain-containing protein	NA	E5E3X8	Burkholderia_phage	37.8	2.7e-62
WP_017683347.1|5206819_5207896_-	DUF3396 domain-containing protein	NA	E5E3X8	Burkholderia_phage	37.5	8.0e-62
WP_017683346.1|5207942_5209019_-	DUF3396 domain-containing protein	NA	Q8W6S0	Burkholderia_virus	33.7	5.5e-55
WP_003380323.1|5209028_5209754_-	VRR-NUC domain-containing protein	NA	A4JX24	Burkholderia_virus	46.4	4.7e-50
WP_003380322.1|5209750_5210317_-	PAAR domain-containing protein	NA	A4JX23	Burkholderia_virus	39.2	5.3e-25
WP_017698597.1|5210316_5210718_-	PAAR domain-containing protein	NA	NA	NA	NA	NA
WP_017698598.1|5210936_5212250_-	PAS domain-containing methyl-accepting chemotaxis protein	NA	A0A2H4J162	uncultured_Caudovirales_phage	46.1	4.6e-19
WP_017683343.1|5212524_5213721_+	GGDEF domain-containing protein	NA	A0A127AWB9	Bacillus_phage	29.4	1.3e-12
WP_005736665.1|5213796_5214234_+	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_017683342.1|5214242_5215883_-	methyl-accepting chemotaxis protein	NA	A0A2H4J162	uncultured_Caudovirales_phage	41.6	1.9e-59
>prophage 23
NZ_CP012179	Pseudomonas syringae pv. actinidiae ICMP 18708 chromosome, complete genome	6555571	5992696	6056542	6555571	transposase,holin	Pseudomonas_phage(14.29%)	49	NA	NA
WP_003380014.1|5992696_5994691_-|holin	choline BCCT transporter BetT	holin	A0A2I7QNT1	Vibrio_phage	27.0	1.5e-21
WP_017684065.1|5997113_5998082_+	ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_003380009.1|5998155_5999007_+	proline/glycine betaine ABC transporter permease	NA	NA	NA	NA	NA
WP_017684066.1|5999003_5999834_+	glycine betaine/L-proline ABC transporter ATP-binding protein	NA	G3M9Y6	Bacillus_virus	36.2	1.7e-27
WP_017684067.1|5999846_6001388_+	histidine ammonia-lyase	NA	NA	NA	NA	NA
WP_003380006.1|6001443_6002991_+	histidine ammonia-lyase	NA	A0A1V0S940	Catovirus	37.4	1.1e-83
WP_017684068.1|6003096_6004473_+	amino acid permease	NA	NA	NA	NA	NA
WP_003380004.1|6004488_6005694_+	imidazolonepropionase	NA	NA	NA	NA	NA
WP_003380002.1|6005707_6006508_+	N-formylglutamate deformylase	NA	NA	NA	NA	NA
WP_017684069.1|6006687_6008952_-	heavy metal translocating P-type ATPase	NA	E4ZFI9	Streptococcus_phage	41.7	1.8e-140
WP_003379999.1|6009037_6009484_+	Cd(II)/Pb(II)-responsive transcriptional regulator	NA	NA	NA	NA	NA
WP_017684070.1|6009505_6010402_-	hypothetical protein	NA	I6PD67	Cronobacter_phage	28.5	2.7e-15
WP_017684071.1|6010405_6010603_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017684072.1|6010679_6011651_-	thymidylate synthase	NA	A0A1B2IB88	Erwinia_phage	32.8	5.2e-52
WP_003382072.1|6011703_6012516_-	prolipoprotein diacylglyceryl transferase	NA	NA	NA	NA	NA
WP_003382616.1|6013301_6014633_+|transposase	IS110-like element ISPsy35 family transposase	transposase	Q9JMN8	Wolbachia_phage	43.6	1.8e-95
WP_003382074.1|6014780_6017060_-	phosphoenolpyruvate--protein phosphotransferase	NA	A0A1V0SGR7	Hokovirus	27.3	1.4e-15
WP_002555745.1|6017081_6017561_-	RNA pyrophosphohydrolase	NA	NA	NA	NA	NA
WP_003382075.1|6017703_6018360_+	HAD family hydrolase	NA	NA	NA	NA	NA
WP_017684977.1|6018373_6018802_-	DUF2269 family protein	NA	NA	NA	NA	NA
WP_017682616.1|6019030_6020290_-|transposase	IS256 family transposase	transposase	A0A218MNI5	uncultured_virus	41.7	5.7e-43
WP_051120753.1|6020311_6021610_-	group II intron reverse transcriptase/maturase	NA	A0A0U4J920	Pseudomonas_phage	30.1	1.8e-23
WP_003373490.1|6022522_6023806_-	group II intron reverse transcriptase/maturase	NA	A0A0U4J920	Pseudomonas_phage	30.1	1.8e-23
WP_005737432.1|6024490_6025327_-	23S rRNA (adenine(2030)-N(6))-methyltransferase RlmJ	NA	NA	NA	NA	NA
WP_003382390.1|6025325_6025586_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003382388.1|6025709_6025976_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003382387.1|6026231_6027332_-	hybrid-cluster NAD(P)-dependent oxidoreductase	NA	NA	NA	NA	NA
WP_017684957.1|6027629_6028928_+	glycine-betaine demethylase subunit GbcA	NA	NA	NA	NA	NA
WP_085991147.1|6029049_6030629_-|transposase	IS3-like element ISPsy31 family transposase	transposase	NA	NA	NA	NA
WP_017684702.1|6030726_6031215_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017684703.1|6031275_6031425_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017684704.1|6032279_6036314_-	non-ribosomal peptide synthetase	NA	A0A2K9KZV5	Tupanvirus	30.3	3.9e-61
WP_017684705.1|6036562_6037054_-	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_017684706.1|6037114_6038413_-	M20 family metallopeptidase	NA	NA	NA	NA	NA
WP_017684707.1|6038659_6039790_+	Fic family protein	NA	A0A1V0E025	Clostridioides_phage	29.5	5.7e-10
WP_085991147.1|6040210_6041789_+|transposase	IS3-like element ISPsy31 family transposase	transposase	NA	NA	NA	NA
WP_003383374.1|6042060_6042384_-	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_005763809.1|6042693_6043770_+	FUSC family protein	NA	NA	NA	NA	NA
WP_003383369.1|6043781_6044243_+	Lrp/AsnC family transcriptional regulator	NA	NA	NA	NA	NA
WP_017684672.1|6044394_6046074_+	NAD(P)/FAD-dependent oxidoreductase	NA	NA	NA	NA	NA
WP_017684673.1|6046091_6046898_+	carbon-nitrogen hydrolase family protein	NA	NA	NA	NA	NA
WP_017684674.1|6047137_6049465_+	pyrroloquinoline quinone biosynthesis protein PqqF	NA	A0A2H4UVM3	Bodo_saltans_virus	24.9	3.6e-19
WP_003422658.1|6049600_6049675_+	pyrroloquinoline quinone precursor peptide PqqA	NA	NA	NA	NA	NA
WP_017684675.1|6049772_6050684_+	pyrroloquinoline quinone biosynthesis protein PqqB	NA	NA	NA	NA	NA
WP_003383364.1|6050692_6051448_+	pyrroloquinoline-quinone synthase PqqC	NA	NA	NA	NA	NA
WP_003383363.1|6051444_6051741_+	pyrroloquinoline quinone biosynthesis peptide chaperone PqqD	NA	NA	NA	NA	NA
WP_017684676.1|6051733_6052903_+	pyrroloquinoline quinone biosynthesis protein PqqE	NA	NA	NA	NA	NA
WP_002555565.1|6054738_6054900_-	YqaE/Pmp3 family membrane protein	NA	NA	NA	NA	NA
WP_032685517.1|6055204_6056542_+|transposase	IS4-like element ISPsy33 family transposase	transposase	NA	NA	NA	NA
>prophage 24
NZ_CP012179	Pseudomonas syringae pv. actinidiae ICMP 18708 chromosome, complete genome	6555571	6095708	6132669	6555571	transposase,protease,holin,tRNA	Bacillus_virus(16.67%)	28	NA	NA
WP_003379932.1|6095708_6096656_+|holin	choline ABC transporter substrate-binding protein	holin	NA	NA	NA	NA
WP_003379931.1|6096723_6097569_+|holin	choline ABC transporter permease subunit	holin	NA	NA	NA	NA
WP_003379929.1|6097565_6098744_+|holin	choline ABC transporter ATP-binding protein	holin	G3M9Y6	Bacillus_virus	36.6	6.5e-25
WP_017683202.1|6098999_6100253_+	serine hydroxymethyltransferase	NA	A0A240F3L3	Aeromonas_phage	54.3	1.2e-101
WP_002555602.1|6100270_6101521_+	sarcosine oxidase subunit beta family protein	NA	NA	NA	NA	NA
WP_003379926.1|6101536_6101833_+	sarcosine oxidase subunit delta	NA	NA	NA	NA	NA
WP_003379925.1|6101829_6104850_+	sarcosine oxidase subunit alpha	NA	NA	NA	NA	NA
WP_003379924.1|6104886_6105519_+	sarcosine oxidase subunit gamma family protein	NA	NA	NA	NA	NA
WP_003379923.1|6105749_6106607_+	formyltetrahydrofolate deformylase	NA	NA	NA	NA	NA
WP_003379921.1|6106656_6107856_+	formaldehyde dehydrogenase, glutathione-independent	NA	A0A2K9L7I1	Tupanvirus	27.7	2.2e-12
WP_051120742.1|6108130_6109198_-|transposase	IS630-like element ISPsy32 family transposase	transposase	NA	NA	NA	NA
WP_017682986.1|6110149_6115978_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003379914.1|6116215_6116779_+	DUF2780 domain-containing protein	NA	NA	NA	NA	NA
WP_017682985.1|6116758_6117658_-	acyltransferase	NA	NA	NA	NA	NA
WP_017682984.1|6117851_6118355_+|protease	ATP-dependent zinc protease	protease	NA	NA	NA	NA
WP_003379907.1|6118627_6119257_-	glutathione S-transferase family protein	NA	NA	NA	NA	NA
WP_003379901.1|6119326_6119509_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003379900.1|6119505_6120639_-	PepSY domain-containing protein	NA	NA	NA	NA	NA
WP_017682983.1|6120759_6121752_-	FecR family protein	NA	NA	NA	NA	NA
WP_005737468.1|6121748_6122267_-	RNA polymerase sigma factor	NA	NA	NA	NA	NA
WP_003379897.1|6122975_6124682_-|holin	choline dehydrogenase	holin	A0A1V0SI18	Klosneuvirus	30.4	2.1e-48
WP_017682982.1|6124822_6126295_-	betaine-aldehyde dehydrogenase	NA	NA	NA	NA	NA
WP_003379893.1|6126401_6126995_-	transcriptional regulator BetI	NA	NA	NA	NA	NA
WP_017682981.1|6127277_6128666_-	GTPase/DUF3482 domain-containing protein	NA	A0A0R6PFW5	Moraxella_phage	38.5	1.7e-56
WP_017682980.1|6128658_6130038_-	DUF2868 domain-containing protein	NA	NA	NA	NA	NA
WP_020313993.1|6130163_6130676_+	dihydrofolate reductase	NA	F8SJN4	Pseudomonas_phage	40.3	2.7e-28
WP_017682978.1|6130864_6131923_+	hypothetical protein	NA	NA	NA	NA	NA
WP_170870104.1|6131964_6132669_-|tRNA	tRNA (guanosine(46)-N7)-methyltransferase TrmB	tRNA	NA	NA	NA	NA
>prophage 25
NZ_CP012179	Pseudomonas syringae pv. actinidiae ICMP 18708 chromosome, complete genome	6555571	6400866	6531865	6555571	transposase,protease,integrase	Acidithiobacillus_phage(18.75%)	93	6466579:6466594	6530031:6530147
WP_003378317.1|6400866_6401937_-|protease	protease modulator HflK	protease	NA	NA	NA	NA
WP_017682560.1|6401933_6402971_-|protease	protease modulator HflC	protease	NA	NA	NA	NA
WP_017682559.1|6402982_6404929_-|protease	protease modulator HflK	protease	NA	NA	NA	NA
WP_003378312.1|6405271_6405889_+	CDP-alcohol phosphatidyltransferase family protein	NA	NA	NA	NA	NA
WP_017682558.1|6405921_6407679_+	bifunctional alpha/beta hydrolase/class I SAM-dependent methyltransferase	NA	NA	NA	NA	NA
WP_017682557.1|6407675_6409031_+	phosphatase PAP2/dual specificity phosphatase family protein	NA	NA	NA	NA	NA
WP_003378309.1|6409054_6409510_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003378308.1|6409518_6410139_+	1-acyl-sn-glycerol-3-phosphate acyltransferase	NA	NA	NA	NA	NA
WP_005621962.1|6410138_6411068_+	phosphatidate cytidylyltransferase	NA	NA	NA	NA	NA
WP_005768286.1|6411466_6413086_+	glucan biosynthesis protein D	NA	NA	NA	NA	NA
WP_003378304.1|6413389_6414688_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003378302.1|6414689_6415997_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017682555.1|6416056_6417943_+	acyltransferase	NA	A0A193GZ69	Enterobacter_phage	47.3	2.1e-73
WP_003378296.1|6418825_6419464_-	response regulator transcription factor	NA	NA	NA	NA	NA
WP_003378294.1|6419463_6420531_-	two-component sensor histidine kinase	NA	NA	NA	NA	NA
WP_003378292.1|6420580_6421885_-	nitrate/sulfonate/bicarbonate ABC transporter ATP-binding protein	NA	G3M9Y6	Bacillus_virus	33.6	3.5e-27
WP_017682552.1|6421916_6423671_-	ABC transporter permease subunit	NA	NA	NA	NA	NA
WP_074291195.1|6424075_6425881_-	methyl-accepting chemotaxis protein	NA	A0A2H4J162	uncultured_Caudovirales_phage	33.9	2.0e-20
WP_085991147.1|6425926_6427506_-|transposase	IS3-like element ISPsy31 family transposase	transposase	NA	NA	NA	NA
WP_153303631.1|6427589_6427808_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017683946.1|6427847_6429878_-	methyl-accepting chemotaxis protein	NA	A0A2H4J162	uncultured_Caudovirales_phage	32.7	3.4e-37
WP_003378280.1|6430297_6430522_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017683947.1|6430832_6431456_-	adenylyl-sulfate kinase	NA	NA	NA	NA	NA
WP_003378274.1|6431692_6433144_+	iron-containing redox enzyme family protein	NA	NA	NA	NA	NA
WP_017683948.1|6433140_6434115_+	class I SAM-dependent methyltransferase	NA	NA	NA	NA	NA
WP_074291441.1|6434419_6436372_+	TonB-dependent receptor	NA	NA	NA	NA	NA
WP_003378268.1|6436371_6437151_+	ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	32.1	4.1e-15
WP_017683949.1|6437151_6438102_+	ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_003378266.1|6438098_6439139_+	iron ABC transporter permease	NA	NA	NA	NA	NA
WP_003378263.1|6439172_6439736_-	TetR/AcrR family transcriptional regulator	NA	NA	NA	NA	NA
WP_003378261.1|6439887_6440589_+	glutathione S-transferase	NA	NA	NA	NA	NA
WP_003378259.1|6440938_6441406_+	type III secretion system chaperone	NA	NA	NA	NA	NA
WP_003378257.1|6441402_6442626_+	avirulence protein	NA	NA	NA	NA	NA
WP_153275132.1|6442897_6443182_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017683952.1|6443254_6444484_+	MFS transporter	NA	NA	NA	NA	NA
WP_003378249.1|6445924_6446107_+	hypothetical protein	NA	NA	NA	NA	NA
WP_020313868.1|6446875_6448312_-	Hsp70 family protein	NA	NA	NA	NA	NA
WP_017683954.1|6448861_6449107_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017683955.1|6449980_6450736_-	ATP-binding protein	NA	K4HZD4	Acidithiobacillus_phage	53.9	6.6e-71
WP_017704020.1|6450756_6452271_-|transposase	IS21-like element ISPsy40 family transposase	transposase	K4I413	Acidithiobacillus_phage	52.6	1.4e-144
WP_017699032.1|6452937_6453693_+	ATP-binding protein	NA	K4HZD4	Acidithiobacillus_phage	53.9	3.9e-71
WP_017684504.1|6454048_6454828_-	NAD-dependent protein deacylase	NA	H6W7Z8	Escherichia_phage	33.2	1.2e-14
WP_020313867.1|6454824_6455100_-	hypothetical protein	NA	NA	NA	NA	NA
WP_136624465.1|6455552_6457256_+	ShlB/FhaC/HecB family hemolysin secretion/activation protein	NA	NA	NA	NA	NA
WP_017684505.1|6457280_6466115_+	DUF637 domain-containing protein	NA	NA	NA	NA	NA
WP_133306363.1|6466124_6466535_+	hypothetical protein	NA	NA	NA	NA	NA
6466579:6466594	attL	CTTTTACGAGCAAGTA	NA	NA	NA	NA
WP_110455622.1|6466671_6466791_+	HNH endonuclease	NA	NA	NA	NA	NA
6466579:6466594	attL	CTTTTACGAGCAAGTA	NA	NA	NA	NA
WP_011168788.1|6467238_6468447_+|integrase	tyrosine-type recombinase/integrase	integrase	NA	NA	NA	NA
WP_017684506.1|6468471_6470004_+|integrase	site-specific integrase	integrase	NA	NA	NA	NA
WP_011168789.1|6469996_6472282_+	hypothetical protein	NA	NA	NA	NA	NA
WP_085991147.1|6472445_6474024_+|transposase	IS3-like element ISPsy31 family transposase	transposase	NA	NA	NA	NA
WP_017683874.1|6474078_6474465_+	hypothetical protein	NA	NA	NA	NA	NA
WP_020313862.1|6474569_6474845_-	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_020313861.1|6474927_6475419_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017683871.1|6475551_6475746_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017683869.1|6476442_6481764_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017683868.1|6482015_6484511_-	NERD domain-containing protein	NA	NA	NA	NA	NA
6482336:6482351	attR	TACTTGCTCGTAAAAG	NA	NA	NA	NA
WP_017710627.1|6484808_6485789_-|transposase	IS5 family transposase	transposase	Q38213	Escherichia_phage	54.9	2.3e-92
6482336:6482351	attR	TACTTGCTCGTAAAAG	NA	NA	NA	NA
WP_017683865.1|6486247_6488449_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017683864.1|6488448_6489612_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017699490.1|6489608_6490046_-	nucleoside triphosphate pyrophosphohydrolase family protein	NA	B2ZXX5	Ralstonia_phage	32.7	8.1e-13
WP_017683862.1|6490378_6492181_-	ATP-dependent helicase	NA	NA	NA	NA	NA
WP_017683861.1|6492224_6494129_-	AAA family ATPase	NA	NA	NA	NA	NA
WP_017699491.1|6494474_6495416_+	HNH endonuclease	NA	NA	NA	NA	NA
WP_017683859.1|6495435_6495768_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_017683858.1|6495764_6496100_+	IS66 family insertion sequence element accessory protein TnpB	NA	NA	NA	NA	NA
WP_017683857.1|6496161_6497688_+|transposase	IS66 family transposase	transposase	A0A218MNE7	uncultured_virus	48.3	4.2e-125
WP_017683856.1|6497729_6498293_+	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_099818608.1|6498313_6499893_-|transposase	IS3-like element ISPsy31 family transposase	transposase	NA	NA	NA	NA
WP_017684656.1|6500306_6501074_-	TatD family hydrolase	NA	NA	NA	NA	NA
WP_017684655.1|6501070_6502447_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017684654.1|6502443_6502989_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017684653.1|6503315_6505265_-	NTPase KAP	NA	NA	NA	NA	NA
WP_017684652.1|6506252_6507527_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017684651.1|6508181_6509291_-	hypothetical protein	NA	NA	NA	NA	NA
WP_074291269.1|6510544_6510850_-	IS66 family insertion sequence element accessory protein TnpB	NA	NA	NA	NA	NA
WP_085991147.1|6511578_6513157_+|transposase	IS3-like element ISPsy31 family transposase	transposase	NA	NA	NA	NA
WP_017684967.1|6513617_6514283_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017684966.1|6515633_6516029_-	CesT family type III secretion system chaperone	NA	NA	NA	NA	NA
WP_017684965.1|6516541_6518491_+	EAL domain-containing protein	NA	G3MA91	Bacillus_virus	30.1	1.1e-11
WP_003381760.1|6518980_6519172_+	Com family DNA-binding transcriptional regulator	NA	B5TK59	Pseudomonas_phage	82.9	2.7e-13
WP_017684964.1|6519183_6520479_+	glycoside hydrolase family 68 protein	NA	NA	NA	NA	NA
WP_003381762.1|6520563_6521745_+	glycoside hydrolase family 10 protein	NA	NA	NA	NA	NA
WP_032685467.1|6522261_6523329_+|transposase	IS630-like element ISPsy32 family transposase	transposase	NA	NA	NA	NA
WP_032685473.1|6523433_6524501_+|transposase	IS630-like element ISPsy32 family transposase	transposase	NA	NA	NA	NA
WP_017685103.1|6524999_6525233_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017685104.1|6525276_6526413_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017685105.1|6526409_6526820_+	hypothetical protein	NA	NA	NA	NA	NA
WP_032685468.1|6526839_6528372_-|transposase	IS66 family transposase	transposase	S5VTD3	Leptospira_phage	36.5	4.4e-82
WP_074556891.1|6528389_6528536_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_017683608.1|6528617_6529886_-	group II intron reverse transcriptase/maturase	NA	A0A0U4J920	Pseudomonas_phage	30.1	4.7e-29
WP_074291269.1|6530292_6530598_-	IS66 family insertion sequence element accessory protein TnpB	NA	NA	NA	NA	NA
WP_032685473.1|6530797_6531865_-|transposase	IS630-like element ISPsy32 family transposase	transposase	NA	NA	NA	NA
