The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
NC_020376	Bacillus thuringiensis serovar thuringiensis str. IS5056, complete sequence	5491935	308046	316422	5491935		Synechococcus_phage(50.0%)	8	NA	NA
WP_000625682.1|308046_309354_+	adenylosuccinate lyase	NA	A0A2H4UUU6	Bodo_saltans_virus	25.3	4.9e-21
WP_001170549.1|309442_310162_+	phosphoribosylaminoimidazolesuccinocarboxamide synthase	NA	G8EYA2	Synechococcus_phage	44.8	8.0e-50
WP_000278823.1|310154_310409_+	phosphoribosylformylglycinamidine synthase subunit PurS	NA	NA	NA	NA	NA
WP_000666785.1|310405_311089_+	phosphoribosylformylglycinamidine synthase subunit PurQ	NA	NA	NA	NA	NA
WP_000055559.1|311072_313292_+	phosphoribosylformylglycinamidine synthase II	NA	A6N228	Microbacterium_phage	41.2	2.0e-163
WP_000879026.1|313276_314692_+	amidophosphoribosyltransferase	NA	A0A0M3SGR2	Mollivirus	35.4	3.3e-55
WP_001262441.1|314797_315838_+	phosphoribosylformylglycinamidine cyclo-ligase	NA	A0A0E3F760	Synechococcus_phage	45.9	2.1e-67
WP_000088590.1|315834_316422_+	phosphoribosylglycinamide formyltransferase	NA	M4QRX9	Synechococcus_phage	37.4	9.1e-28
>prophage 2
NC_020376	Bacillus thuringiensis serovar thuringiensis str. IS5056, complete sequence	5491935	656456	664616	5491935		Bacillus_phage(66.67%)	8	NA	NA
WP_000030268.1|656456_657410_-	YafY family transcriptional regulator	NA	A0A1B0RXM1	Streptococcus_phage	29.9	4.1e-17
WP_003273797.1|657597_658038_+	dihydrofolate reductase	NA	NA	NA	NA	NA
WP_000822580.1|658203_659595_-	HAMP domain-containing histidine kinase	NA	W8CYF6	Bacillus_phage	30.5	3.1e-34
WP_000565468.1|659606_660284_-	response regulator transcription factor	NA	W8CYM9	Bacillus_phage	36.1	1.1e-32
WP_000738870.1|660459_661707_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000277054.1|661840_662371_+	DUF4352 domain-containing protein	NA	A0A0S2MVG4	Bacillus_phage	33.5	2.5e-16
WP_000831286.1|662383_662728_+	DUF4064 domain-containing protein	NA	A0A0S2MVJ2	Bacillus_phage	78.1	8.5e-42
WP_000487919.1|663164_664616_+	SulP family inorganic anion transporter	NA	A0A2H4J153	uncultured_Caudovirales_phage	54.4	5.8e-140
>prophage 3
NC_020376	Bacillus thuringiensis serovar thuringiensis str. IS5056, complete sequence	5491935	686482	716538	5491935	terminase,integrase,capsid	Bacillus_phage(64.29%)	44	685728:685743	709583:709598
685728:685743	attL	TTTGGTAAGAAGAATA	NA	NA	NA	NA
WP_000645827.1|686482_687535_+	(R,R)-butanediol dehydrogenase	NA	E3SJ82	Synechococcus_phage	27.6	3.9e-21
WP_000948241.1|687653_687998_+	two pore domain potassium channel family protein	NA	NA	NA	NA	NA
WP_000730997.1|688251_689103_+	phospholipase C	NA	NA	NA	NA	NA
WP_000676798.1|689179_690226_+	sphingomyelin phosphodiesterase	NA	A0A1P8L6H7	Staphylococcus_phage	59.3	8.2e-88
WP_000262043.1|690164_691265_-|integrase	site-specific integrase	integrase	A0A0S2GLI2	Bacillus_phage	96.7	1.4e-199
WP_000009558.1|692091_693294_+	hypothetical protein	NA	W8CYT9	Bacillus_phage	43.3	8.0e-87
WP_000511081.1|693636_693981_-	helix-turn-helix transcriptional regulator	NA	W8CZ48	Bacillus_phage	100.0	1.9e-57
WP_000813894.1|694129_694366_+	helix-turn-helix transcriptional regulator	NA	W8CYU0	Bacillus_phage	100.0	4.3e-37
WP_000277640.1|694398_694587_+	helix-turn-helix transcriptional regulator	NA	W8CYN7	Bacillus_phage	98.4	9.4e-27
WP_000187072.1|694607_695255_+	sigma-70 family RNA polymerase sigma factor	NA	W8CYN8	Bacillus_phage	86.0	1.9e-98
WP_000788396.1|695314_695470_+	hypothetical protein	NA	I7J4K2	Bacillus_phage	88.2	4.1e-20
WP_000167564.1|695532_695826_+	hypothetical protein	NA	A0A0S2GLB6	Bacillus_phage	63.0	1.5e-26
WP_000102854.1|695847_696108_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001061882.1|696179_696608_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000892407.1|696715_696910_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001148168.1|696988_697924_+	YqaJ viral recombinase family protein	NA	S6C475	Thermus_phage	59.5	5.8e-101
WP_000224586.1|697945_698752_+	recombination protein RecT	NA	S6AVW6	Thermus_phage	66.8	3.1e-95
WP_000040570.1|698923_699727_+	DnaD domain protein	NA	A0A0U4JX08	Bacillus_phage	42.8	2.7e-38
WP_003269479.1|699824_700568_+	ATP-binding protein	NA	A0A1B0T6C3	Bacillus_phage	49.8	1.5e-59
WP_001045406.1|700591_701101_+	YpiB family protein	NA	NA	NA	NA	NA
WP_000049838.1|701113_701539_+	DUF1064 domain-containing protein	NA	A0A2P1JTY5	Anoxybacillus_phage	51.9	4.1e-30
WP_000323349.1|701554_702223_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000762586.1|702212_702935_+	zinc-finger domain-containing protein	NA	NA	NA	NA	NA
WP_000778925.1|702944_703367_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000973815.1|703350_704085_+	sigma-70 family RNA polymerase sigma factor	NA	C7DTL2	Bacillus_phage	51.2	2.1e-58
WP_000433162.1|704317_704482_+	hypothetical protein	NA	W8CYP0	Bacillus_phage	66.7	1.1e-12
WP_000520931.1|704660_704843_+	hypothetical protein	NA	A0A1B1P7L7	Bacillus_phage	58.5	2.9e-09
WP_000164425.1|704877_705675_+	phage antirepressor KilAC domain-containing protein	NA	A0A1Q1PVZ8	Staphylococcus_phage	51.7	3.3e-73
WP_001072816.1|706344_706719_+	ArpU family transcriptional regulator	NA	Q9ZXB9	Bacillus_phage	40.7	6.0e-17
WP_000876114.1|707080_707296_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000248554.1|707580_707736_+	BC1881 family protein	NA	NA	NA	NA	NA
WP_003269487.1|707821_708004_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000576172.1|708156_708729_+	recombinase family protein	NA	A0A0A7NPV4	Enterobacteria_phage	48.1	2.2e-42
WP_000515245.1|708771_709308_+	hypothetical protein	NA	A5GYP7	Lactococcus_phage	56.3	9.5e-40
WP_003311458.1|709273_710737_+|terminase	phage terminase large subunit	terminase	U5PVG8	Bacillus_phage	68.9	7.5e-196
709583:709598	attR	TTTGGTAAGAAGAATA	NA	NA	NA	NA
WP_000222862.1|710733_710964_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000124815.1|710977_711178_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000467413.1|711235_713359_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000366284.1|713359_713635_+	DUF2829 domain-containing protein	NA	A0A0A7AQX0	Bacillus_phage	59.0	1.4e-23
WP_003269488.1|713634_713886_+	DUF2829 domain-containing protein	NA	A0A1B0VMG3	Pseudomonas_phage	54.2	3.3e-19
WP_000668389.1|713885_714146_+	DUF2829 domain-containing protein	NA	S5MAK7	Bacillus_phage	70.6	4.3e-30
WP_000791085.1|714145_714400_+	hypothetical protein	NA	A0A1B1P7N4	Bacillus_phage	85.4	1.4e-38
WP_000917220.1|714483_715332_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000501401.1|715347_716538_+|capsid	phage major capsid protein	capsid	A0A1B1IV93	uncultured_Mediterranean_phage	28.2	1.0e-33
>prophage 4
NC_020376	Bacillus thuringiensis serovar thuringiensis str. IS5056, complete sequence	5491935	720945	731203	5491935	bacteriocin	Bacillus_phage(100.0%)	10	NA	NA
WP_001137510.1|720945_725214_+	hypothetical protein	NA	A0A0A0RPU4	Bacillus_phage	36.3	3.2e-138
WP_000392441.1|725265_725496_+|bacteriocin	bacteriocin biosynthesis protein	bacteriocin	A0A1B1P7Q9	Bacillus_phage	87.8	1.6e-28
WP_003269494.1|725495_726200_+	N-acetylmuramoyl-L-alanine amidase	NA	W8CZ46	Bacillus_phage	84.0	3.8e-113
WP_000494384.1|726326_726725_-	DUF3221 domain-containing protein	NA	NA	NA	NA	NA
WP_000264500.1|727522_727747_-	hypothetical protein	NA	A0A1B1P883	Bacillus_phage	74.3	1.3e-27
WP_127057661.1|728070_728202_+	hypothetical protein	NA	W8CYT8	Bacillus_phage	100.0	6.9e-21
WP_000495115.1|728221_728542_+	hypothetical protein	NA	A0A0S2GLK1	Bacillus_phage	98.1	2.1e-50
WP_000511372.1|728552_729719_+	DNA translocase FtsK	NA	W8CYG2	Bacillus_phage	98.5	1.4e-221
WP_000842170.1|729708_730317_+	replication-relaxation family protein	NA	W8CZ47	Bacillus_phage	98.5	2.4e-111
WP_015406454.1|730321_731203_-	helix-turn-helix domain-containing protein	NA	I7ILW0	Bacillus_phage	96.9	3.3e-154
>prophage 5
NC_020376	Bacillus thuringiensis serovar thuringiensis str. IS5056, complete sequence	5491935	1843953	1901377	5491935	transposase,portal,integrase,terminase,tail,holin	Bacillus_phage(69.44%)	75	1839479:1839497	1906264:1906282
1839479:1839497	attL	AAGCAAATGCAAAAAAAGA	NA	NA	NA	NA
WP_000499525.1|1843953_1845150_-|transposase	IS110 family transposase	transposase	A0A0U3ULR1	Bacillus_phage	25.9	5.6e-24
WP_001190219.1|1845446_1845608_+	hypothetical protein	NA	NA	NA	NA	NA
WP_015055111.1|1845591_1847148_+	AAA family ATPase	NA	A7KV18	Bacillus_phage	31.8	2.4e-22
WP_000567354.1|1847161_1847464_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000421152.1|1847463_1847697_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000273133.1|1847710_1848346_+	hypothetical protein	NA	A7KV15	Bacillus_phage	34.8	3.2e-26
WP_000334956.1|1848362_1848728_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000546453.1|1848727_1849786_+	metallophosphoesterase	NA	NA	NA	NA	NA
WP_000636793.1|1849782_1850085_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000137796.1|1850077_1850629_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000371314.1|1850638_1851157_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003271401.1|1851240_1852818_+	DEAD/DEAH box helicase family protein	NA	A0A1B0Z0P8	Vibrio_phage	24.2	1.7e-15
WP_000523223.1|1852907_1853150_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000191310.1|1853149_1853893_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001074794.1|1853912_1856999_+	hypothetical protein	NA	A0A1L4BKL0	Thermus_phage	28.6	8.0e-14
WP_000147936.1|1857022_1859449_+	bifunctional 3'-5' exonuclease/DNA polymerase	NA	F8WQ35	Bacillus_phage	23.9	5.1e-32
WP_000532406.1|1859452_1859725_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000993003.1|1859687_1859945_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000509446.1|1859970_1860336_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001249533.1|1860478_1860802_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001021290.1|1860798_1861338_+	dUTP diphosphatase	NA	A0A288WGA4	Bacillus_phage	34.2	5.8e-21
WP_000521061.1|1861352_1862129_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000693593.1|1862298_1862670_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000391475.1|1862717_1863026_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000422433.1|1863063_1864044_+	site-specific DNA-methyltransferase	NA	A0A2H4JD00	uncultured_Caudovirales_phage	61.2	5.5e-118
WP_000404006.1|1864285_1864783_+	hypothetical protein	NA	A0A288WFR1	Bacillus_phage	67.4	1.7e-27
WP_000539655.1|1864834_1865002_+	hypothetical protein	NA	A0A0M4RER6	Bacillus_phage	87.3	2.0e-20
WP_000053745.1|1866129_1866540_+	hypothetical protein	NA	S5MUC4	Brevibacillus_phage	54.2	2.2e-12
WP_001043868.1|1866536_1867190_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000805617.1|1867311_1867629_+	hypothetical protein	NA	A0A0K2CZ01	Paenibacillus_phage	34.7	1.0e-04
WP_000154978.1|1867645_1868563_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000790088.1|1868565_1868712_+	BC1881 family protein	NA	NA	NA	NA	NA
WP_001202995.1|1868837_1869059_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000843025.1|1869055_1869337_+	AbrB/MazE/SpoVT family DNA-binding domain-containing protein	NA	A0A2I7SC16	Paenibacillus_phage	59.0	3.0e-13
WP_001294615.1|1869338_1869536_+	hypothetical protein	NA	A0A1L2JY50	Aeribacillus_phage	44.8	9.5e-06
WP_080546110.1|1869562_1869730_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000410292.1|1869732_1870257_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001106358.1|1870253_1870436_+	hypothetical protein	NA	A0A1B1P7M4	Bacillus_phage	68.0	3.3e-13
WP_000200015.1|1870425_1870752_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000196741.1|1871012_1871393_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000873650.1|1871799_1872363_+	recombinase family protein	NA	A0A0A8WIK3	Clostridium_phage	51.3	9.0e-41
WP_001086032.1|1872560_1872989_+	hypothetical protein	NA	A0A2H4J6Z8	uncultured_Caudovirales_phage	51.1	1.2e-32
WP_000323341.1|1873005_1874721_+|terminase	phage terminase large subunit	terminase	A0A142F1L6	Bacillus_phage	52.1	8.0e-149
WP_001265883.1|1874737_1876255_+|portal	phage portal protein	portal	A0A142F1L7	Bacillus_phage	30.5	1.1e-67
WP_003271428.1|1876313_1877093_+	phage scaffolding protein	NA	Q4ZC70	Staphylococcus_virus	40.0	9.7e-09
WP_001145075.1|1877153_1878278_+	DUF5309 family protein	NA	NA	NA	NA	NA
WP_000027969.1|1878327_1878552_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000868477.1|1878581_1878923_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001285263.1|1878927_1879734_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000954643.1|1879737_1880112_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001222696.1|1880111_1880471_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000930921.1|1880473_1880881_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000852562.1|1880894_1881401_+|tail	phage major tail protein, TP901-1 family	tail	NA	NA	NA	NA
WP_000443956.1|1881424_1881784_+	hypothetical protein	NA	A0A0A7AQ61	Bacillus_phage	82.9	5.4e-39
WP_000762691.1|1881770_1881986_+	hypothetical protein	NA	H0USV9	Bacillus_phage	97.1	2.3e-29
WP_000818630.1|1882053_1882431_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000931847.1|1882520_1882775_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003271441.1|1882811_1886708_+|tail	phage tail tape measure protein	tail	A6M961	Geobacillus_virus	48.8	4.2e-12
WP_000959919.1|1886722_1888219_+|tail	phage tail family protein	tail	A0A0A7AQV1	Bacillus_phage	80.4	4.0e-221
WP_001260209.1|1888215_1893195_+	hypothetical protein	NA	A0A0S2MVB4	Bacillus_phage	65.6	0.0e+00
WP_000342975.1|1893206_1893587_+	hypothetical protein	NA	A0A0S2MVE0	Bacillus_phage	79.2	2.3e-48
WP_000822841.1|1893686_1894646_+|integrase	site-specific integrase	integrase	A0A0S2GLC8	Bacillus_phage	95.3	2.1e-175
WP_000373895.1|1894661_1895087_+|holin	phage holin family protein	holin	A0A1B1P787	Bacillus_phage	95.0	7.0e-70
WP_001216050.1|1895086_1895920_+	N-acetylmuramoyl-L-alanine amidase	NA	A0A1B1P783	Bacillus_phage	88.1	1.9e-148
WP_000370580.1|1895974_1896241_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000727572.1|1896350_1896494_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001230989.1|1896520_1897123_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000578036.1|1897221_1897458_-	helix-turn-helix transcriptional regulator	NA	Q2I8D9	Bacillus_phage	57.9	9.0e-19
WP_000854597.1|1897614_1897737_+	DUF3961 domain-containing protein	NA	Q3HKZ4	Bacillus_phage	62.2	4.8e-08
WP_000669093.1|1898378_1898579_-	helix-turn-helix transcriptional regulator	NA	Q2I8E4	Bacillus_phage	54.5	1.1e-12
WP_001247349.1|1898764_1899031_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001267622.1|1899030_1899333_+	hypothetical protein	NA	A0A288WG08	Bacillus_phage	58.2	8.0e-28
WP_000176361.1|1899329_1899512_+	hypothetical protein	NA	Q2I8E2	Bacillus_phage	81.7	1.1e-19
WP_000891521.1|1899627_1900812_+	cell division protein FtsK	NA	A0A288WFS1	Bacillus_phage	62.9	2.1e-140
WP_001025807.1|1900753_1901377_+	replication-relaxation family protein	NA	H0USY2	Bacillus_phage	80.1	2.3e-93
1906264:1906282	attR	AAGCAAATGCAAAAAAAGA	NA	NA	NA	NA
>prophage 6
NC_020376	Bacillus thuringiensis serovar thuringiensis str. IS5056, complete sequence	5491935	1938257	1947556	5491935		Bacillus_phage(71.43%)	8	NA	NA
WP_000755523.1|1938257_1939550_+	C40 family peptidase	NA	A0A1V0DZX6	Clostridioides_phage	30.3	5.0e-10
WP_000453879.1|1940654_1942415_+	ABC transporter ATP-binding protein	NA	W8CYL7	Bacillus_phage	98.0	1.8e-273
WP_015055113.1|1942455_1943133_+	response regulator transcription factor	NA	W8CYM9	Bacillus_phage	99.1	1.5e-122
WP_001231619.1|1943129_1944203_+	HAMP domain-containing sensor histidine kinase	NA	W8CYF6	Bacillus_phage	97.8	8.8e-186
WP_003270270.1|1944227_1944821_-	DUF3139 domain-containing protein	NA	NA	NA	NA	NA
WP_000818985.1|1945011_1945731_+	3-ketoacyl-ACP reductase	NA	W8CYX9	Bacillus_phage	100.0	5.9e-61
WP_000014165.1|1945878_1946550_+	O-methyltransferase	NA	W8CYT3	Bacillus_phage	92.0	1.8e-64
WP_001258527.1|1946683_1947556_+	aminoglycoside 6-adenylyltransferase	NA	A0A1X9I6F2	Streptococcus_phage	44.4	4.0e-64
>prophage 7
NC_020376	Bacillus thuringiensis serovar thuringiensis str. IS5056, complete sequence	5491935	2368090	2375171	5491935		Bacillus_phage(50.0%)	9	NA	NA
WP_015055127.1|2368090_2368420_+	HNH endonuclease	NA	A0A1S7FZ53	Listeria_phage	45.7	2.6e-16
WP_003269337.1|2368479_2368725_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000015466.1|2369133_2369631_+	helix-turn-helix domain-containing protein	NA	A0A1B1P762	Bacillus_phage	34.0	6.2e-09
WP_000461733.1|2370336_2370576_+	hypothetical protein	NA	A0A0A7AR38	Bacillus_phage	92.4	1.0e-30
WP_000753400.1|2370572_2371622_+	N-acetylmuramoyl-L-alanine amidase	NA	A0A0A7AQV3	Bacillus_phage	91.0	2.4e-188
WP_000384715.1|2371680_2372022_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000249917.1|2372047_2373538_-	WXG100 family type VII secretion target	NA	A0A2H4J389	uncultured_Caudovirales_phage	46.7	5.0e-22
WP_001281134.1|2373765_2374002_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000598277.1|2374388_2375171_-	glycosyltransferase family 2 protein	NA	A0A1V0SJD8	Klosneuvirus	31.6	2.2e-21
>prophage 8
NC_020376	Bacillus thuringiensis serovar thuringiensis str. IS5056, complete sequence	5491935	2601964	2674013	5491935	bacteriocin,transposase,portal,integrase,capsid,terminase,tail,protease	Bacillus_phage(66.67%)	85	2620310:2620345	2679368:2679403
WP_001071355.1|2601964_2602294_+|bacteriocin	heterocycloanthracin/sonorensin family bacteriocin	bacteriocin	NA	NA	NA	NA
WP_003270601.1|2602777_2603263_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000736205.1|2603574_2604276_+	DUF3962 domain-containing protein	NA	NA	NA	NA	NA
WP_000675858.1|2604314_2605424_-|integrase	tyrosine-type recombinase/integrase	integrase	A0A0U3U8Y8	Bacillus_phage	79.4	1.1e-146
WP_000732892.1|2605655_2606129_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000734558.1|2606362_2606824_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001197708.1|2607485_2608694_+	hypothetical protein	NA	D2XQ10	Bacillus_virus	45.2	2.3e-81
WP_000791664.1|2608720_2608876_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000425257.1|2609136_2609487_-	helix-turn-helix transcriptional regulator	NA	A0A288WFW4	Bacillus_phage	39.7	9.6e-17
WP_001180927.1|2609670_2609967_+	helix-turn-helix transcriptional regulator	NA	A0A288WG89	Bacillus_phage	46.5	8.2e-09
WP_000522023.1|2610182_2610449_+	helix-turn-helix domain-containing protein	NA	A0A0U3ULL9	Bacillus_phage	90.6	2.0e-35
WP_000390298.1|2610448_2610613_+	hypothetical protein	NA	A0A0U3B230	Bacillus_phage	90.7	1.5e-20
WP_001241129.1|2610642_2610819_+	hypothetical protein	NA	A0A0U3SQC4	Bacillus_phage	93.1	6.3e-25
WP_000190250.1|2610823_2611558_+	DnaD domain protein	NA	A0A1B1P7T6	Bacillus_phage	83.9	1.1e-89
WP_014482038.1|2611526_2612330_+	ATP-binding protein	NA	A0A1B1P7U2	Bacillus_phage	98.5	7.3e-145
WP_000332458.1|2612344_2612539_+	hypothetical protein	NA	A0A1B1P7U7	Bacillus_phage	87.5	2.2e-26
WP_000792379.1|2612555_2612966_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000312979.1|2612998_2613253_-	hypothetical protein	NA	NA	NA	NA	NA
WP_014482039.1|2613340_2613484_+	AbrB/MazE/SpoVT family DNA-binding domain-containing protein	NA	A0A2I7SC16	Paenibacillus_phage	68.3	9.6e-08
WP_001053955.1|2613595_2615032_-|transposase	IS4-like element IS231A family transposase	transposase	NA	NA	NA	NA
WP_001125966.1|2615278_2615638_+	hypothetical protein	NA	A0A1B1P7A1	Bacillus_phage	52.5	1.6e-30
WP_000717823.1|2615655_2615823_+	DUF3954 domain-containing protein	NA	A0A1B0T6B8	Bacillus_phage	62.3	1.1e-13
WP_000109538.1|2615848_2616100_+	hypothetical protein	NA	A0A0K2CNP4	Brevibacillus_phage	36.1	6.5e-07
WP_140340092.1|2616212_2617001_-	glycosyltransferase family 2 protein	NA	A0A1V0SJD8	Klosneuvirus	32.1	9.4e-20
WP_000185202.1|2617216_2618005_-	sulfotransferase family 2 domain-containing protein	NA	A0A288WG17	Bacillus_phage	72.3	3.0e-106
WP_000527470.1|2618913_2619273_-	septum formation initiator family protein	NA	NA	NA	NA	NA
WP_000506751.1|2619420_2619624_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000133487.1|2619717_2619882_-	hypothetical protein	NA	A0A288WGN0	Bacillus_phage	51.9	2.2e-08
WP_000183173.1|2619984_2620107_+	DUF3983 domain-containing protein	NA	NA	NA	NA	NA
WP_001013579.1|2620127_2620316_+	hypothetical protein	NA	NA	NA	NA	NA
2620310:2620345	attL	AATATAGTCCGGCTAGAAAACTAGAGGACACCAATT	NA	NA	NA	NA
WP_000677277.1|2620414_2620585_+	hypothetical protein	NA	A0A1B1P735	Bacillus_phage	87.5	5.1e-08
WP_001041413.1|2620605_2621076_+	ArpU family transcriptional regulator	NA	A0A1B1P744	Bacillus_phage	91.0	7.2e-76
WP_001028517.1|2621072_2621615_+|integrase	tyrosine-type recombinase/integrase	integrase	A0A1B1P746	Bacillus_phage	97.2	1.0e-94
WP_000351128.1|2621739_2622396_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000538961.1|2622379_2623540_+	ImmA/IrrE family metallo-endopeptidase	NA	A0A0A7RTT7	Clostridium_phage	34.5	1.1e-56
WP_000440224.1|2623972_2624902_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000453364.1|2625282_2625504_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000615852.1|2625500_2625830_+	HNH endonuclease	NA	A0A1B1P757	Bacillus_phage	50.0	6.1e-21
WP_000377853.1|2625832_2626141_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000015467.1|2626449_2626947_+	helix-turn-helix domain-containing protein	NA	A0A1B1P762	Bacillus_phage	34.0	6.2e-09
WP_000988815.1|2626921_2628598_+|terminase	terminase large subunit	terminase	A0A1B1P766	Bacillus_phage	57.8	7.8e-181
WP_000512879.1|2628614_2629859_+|portal	phage portal protein	portal	A0A1B1P754	Bacillus_phage	37.5	6.8e-73
WP_003272656.1|2629875_2630508_+|protease	Clp protease ClpP	protease	D2XR17	Bacillus_phage	45.5	1.9e-34
WP_000588590.1|2630521_2631646_+|capsid	phage major capsid protein	capsid	A0A1B1P752	Bacillus_phage	50.0	7.2e-98
WP_001282872.1|2631659_2631983_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000963758.1|2631972_2632329_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000174092.1|2632315_2632696_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001111193.1|2632685_2633096_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001145608.1|2633097_2633667_+	hypothetical protein	NA	Q858W9	Listeria_phage	45.4	3.5e-40
WP_000159510.1|2633728_2634079_+	hypothetical protein	NA	A0A1S7FZ84	Listeria_phage	36.5	1.5e-09
WP_000235149.1|2634261_2638092_+|tail	phage tail tape measure protein	tail	A0A1S5SFC1	Streptococcus_phage	30.2	5.8e-46
WP_000227695.1|2638084_2638771_+	hypothetical protein	NA	A0A2H4J851	uncultured_Caudovirales_phage	63.7	2.4e-80
WP_000631955.1|2638767_2641497_+|tail	phage tail protein	tail	A0A1B1P770	Bacillus_phage	50.2	3.6e-236
WP_000387824.1|2641535_2641769_+	hemolysin XhlA family protein	NA	A0A2H4J382	uncultured_Caudovirales_phage	95.9	2.7e-15
WP_000499523.1|2641863_2643057_-|transposase	IS110-like element ISBth13 family transposase	transposase	A0A0U3ULR1	Bacillus_phage	26.1	1.1e-24
WP_000461714.1|2643354_2643594_+	hypothetical protein	NA	A0A0A7AR38	Bacillus_phage	93.7	1.5e-32
WP_000753418.1|2643590_2644655_+	N-acetylmuramoyl-L-alanine amidase	NA	A0A0A7AQV3	Bacillus_phage	94.1	4.2e-196
WP_000459800.1|2644696_2645605_+	collagen-like protein	NA	NA	NA	NA	NA
WP_000998176.1|2645869_2646169_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000249915.1|2646187_2647597_-	WXG100 family type VII secretion target	NA	A0A2H4J389	uncultured_Caudovirales_phage	45.8	6.2e-22
WP_000626125.1|2647902_2649585_+	DUF3893 domain-containing protein	NA	NA	NA	NA	NA
WP_000732186.1|2649791_2650556_+	DUF3959 family protein	NA	NA	NA	NA	NA
WP_000905570.1|2650700_2651117_+	DUF3995 domain-containing protein	NA	NA	NA	NA	NA
WP_000878371.1|2651237_2651441_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000362069.1|2651770_2651983_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000565693.1|2652192_2653200_+	DUF1835 domain-containing protein	NA	NA	NA	NA	NA
WP_000282689.1|2653342_2653747_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000062121.1|2653906_2655142_+	cytochrome P450	NA	NA	NA	NA	NA
WP_000426103.1|2655553_2656696_+	MFS transporter	NA	NA	NA	NA	NA
WP_001069254.1|2656685_2657318_+	Vat family streptogramin A O-acetyltransferase	NA	A0A2R8FE91	Brazilian_cedratvirus	43.1	1.6e-25
WP_000046095.1|2657388_2657544_+	DUF1540 domain-containing protein	NA	NA	NA	NA	NA
WP_000289124.1|2657646_2658144_-	PadR family transcriptional regulator	NA	NA	NA	NA	NA
WP_000168009.1|2658284_2659499_+	cytochrome P450	NA	NA	NA	NA	NA
WP_000954443.1|2659608_2660187_+	cysteine dioxygenase family protein	NA	NA	NA	NA	NA
WP_000766393.1|2660362_2661214_+	Cof-type HAD-IIB family hydrolase	NA	NA	NA	NA	NA
WP_001088549.1|2661636_2663424_+	PAS domain-containing protein	NA	NA	NA	NA	NA
WP_000743772.1|2663658_2665785_+	penicillin-binding protein 2	NA	NA	NA	NA	NA
WP_000932141.1|2666649_2667828_+	UDP-glucosyltransferase	NA	A0A2H4ZK81	Cryptophlebia_leucotreta_granulosis_virus	28.3	6.8e-06
WP_000864376.1|2667927_2668608_-	aspartate/glutamate racemase family protein	NA	NA	NA	NA	NA
WP_001038210.1|2669018_2669567_+	ECF-type riboflavin transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_001182519.1|2669577_2671278_+	energy-coupling factor ABC transporter ATP-binding protein	NA	A0A285PWH2	Cedratvirus	30.0	6.1e-16
WP_000556364.1|2671270_2672071_+	energy-coupling factor transporter transmembrane protein EcfT	NA	NA	NA	NA	NA
WP_000120182.1|2672207_2672315_+	YjcZ family sporulation protein	NA	NA	NA	NA	NA
WP_000348328.1|2672416_2673676_-	HAMP domain-containing histidine kinase	NA	W8CYF6	Bacillus_phage	29.1	1.2e-24
WP_003270646.1|2673800_2674013_-|transposase	transposase	transposase	A0A0U3U8Y8	Bacillus_phage	71.4	2.0e-17
2679368:2679403	attR	AATATAGTCCGGCTAGAAAACTAGAGGACACCAATT	NA	NA	NA	NA
>prophage 9
NC_020376	Bacillus thuringiensis serovar thuringiensis str. IS5056, complete sequence	5491935	3720431	3827922	5491935	bacteriocin,transposase,portal,integrase,capsid,head,terminase,tail,protease,tRNA,coat,holin	Bacillus_phage(56.6%)	108	3796456:3796473	3812509:3812526
WP_000878380.1|3720431_3720788_-|holin	CidA/LrgA family holin-like protein	holin	NA	NA	NA	NA
WP_000454956.1|3720821_3722255_-	PLP-dependent aminotransferase family protein	NA	NA	NA	NA	NA
WP_000006458.1|3722441_3722633_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001274919.1|3722853_3723561_-	GntR family transcriptional regulator	NA	NA	NA	NA	NA
WP_000671631.1|3723591_3725001_-	glycoside hydrolase family 1 protein	NA	A0A0B5JD41	Pandoravirus	30.0	7.8e-57
WP_000066296.1|3725192_3726182_-	phosphatidylinositol diacylglycerol-lyase	NA	NA	NA	NA	NA
WP_000689202.1|3726361_3728203_-	peptidase	NA	NA	NA	NA	NA
WP_000771003.1|3728495_3729293_+	LysM peptidoglycan-binding domain-containing protein	NA	A0A172JHR8	Bacillus_phage	38.6	2.8e-35
WP_000272398.1|3729558_3730896_+	NAD(P)-binding protein	NA	NA	NA	NA	NA
WP_000791042.1|3731397_3733317_+	LTA synthase family protein	NA	W6LM83	Streptococcus_phage	37.3	2.7e-97
WP_001235332.1|3733366_3736150_-	dynamin family protein	NA	NA	NA	NA	NA
WP_000461138.1|3736654_3736840_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000516464.1|3737118_3739062_-	DNA mismatch repair endonuclease MutL	NA	A0A1B2LRQ5	Wolbachia_phage	30.0	4.5e-63
WP_000195993.1|3739070_3741743_-	DNA mismatch repair protein MutS	NA	A0A1V0SGG8	Hokovirus	24.2	2.3e-33
WP_001288799.1|3741923_3742466_-|coat	outer spore coat protein CotE	coat	NA	NA	NA	NA
WP_000870460.1|3742593_3743025_-	RicAFT regulatory complex protein RicA family protein	NA	NA	NA	NA	NA
WP_001005391.1|3743028_3744558_-|tRNA	tRNA (N6-isopentenyl adenosine(37)-C2)-methylthiotransferase MiaB	tRNA	NA	NA	NA	NA
WP_000190159.1|3744986_3745853_-	2-oxoacid:ferredoxin oxidoreductase subunit beta	NA	NA	NA	NA	NA
WP_000625417.1|3745839_3747597_-	2-oxoacid:acceptor oxidoreductase subunit alpha	NA	NA	NA	NA	NA
WP_000688049.1|3747824_3748748_-	dipeptidase	NA	NA	NA	NA	NA
WP_000404341.1|3748807_3749068_-	stage V sporulation protein SpoVS	NA	J9PTX7	Bacillus_phage	43.8	8.4e-10
WP_001221095.1|3749217_3750012_-	TIGR00282 family metallophosphoesterase	NA	NA	NA	NA	NA
WP_000099769.1|3750174_3751740_-	ribonuclease Y	NA	NA	NA	NA	NA
WP_001283854.1|3752222_3753254_-	recombinase RecA	NA	A0A0S2MVG1	Bacillus_phage	71.8	1.9e-137
WP_000990687.1|3753398_3754637_-	competence/damage-inducible protein CinA	NA	NA	NA	NA	NA
WP_001052967.1|3754657_3755236_-	CDP-diacylglycerol--glycerol-3-phosphate 3-phosphatidyltransferase	NA	NA	NA	NA	NA
WP_000137473.1|3755300_3756212_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_000574107.1|3756233_3757019_-	DUF3388 domain-containing protein	NA	NA	NA	NA	NA
WP_000114444.1|3757157_3757406_-	DUF3243 domain-containing protein	NA	NA	NA	NA	NA
WP_000759628.1|3757481_3758195_-	SDR family oxidoreductase	NA	NA	NA	NA	NA
WP_000411974.1|3758295_3759582_-	insulinase family protein	NA	A0A2H4UVM3	Bodo_saltans_virus	28.9	1.0e-10
WP_000772415.1|3759582_3760857_-	insulinase family protein	NA	A0A1X9I714	Streptococcus_phage	30.0	3.5e-56
WP_000008857.1|3761065_3762025_-	ABC transporter permease	NA	NA	NA	NA	NA
WP_001085254.1|3762025_3763084_-	ABC transporter permease	NA	NA	NA	NA	NA
WP_000456926.1|3763076_3764609_-	ABC transporter ATP-binding protein	NA	W6JKT0	Anomala_cuprea_entomopoxvirus	26.3	6.3e-12
WP_000725769.1|3764727_3765813_-	BMP family ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_000114182.1|3765905_3766631_-	GntR family transcriptional regulator	NA	NA	NA	NA	NA
WP_001118792.1|3767169_3769551_-	DNA translocase FtsK	NA	A0A218M9A2	Mycobacterium_phage	51.4	2.0e-89
WP_000605020.1|3769763_3769967_-	YlzJ-like family protein	NA	NA	NA	NA	NA
WP_000139807.1|3769963_3770713_-	translocation-enhancing protein TepA	NA	NA	NA	NA	NA
WP_000823071.1|3770816_3772487_-	ribonuclease J	NA	NA	NA	NA	NA
WP_000564763.1|3773412_3774291_-	4-hydroxy-tetrahydrodipicolinate synthase	NA	NA	NA	NA	NA
WP_000692450.1|3774302_3775535_-	aspartate kinase	NA	NA	NA	NA	NA
WP_000414846.1|3775558_3776605_-	aspartate-semialdehyde dehydrogenase	NA	NA	NA	NA	NA
WP_001238645.1|3776755_3776932_-	dipicolinate synthase	NA	NA	NA	NA	NA
WP_015406503.1|3777046_3777901_-	flagellar hook-length control protein FliK	NA	NA	NA	NA	NA
WP_000249941.1|3778386_3779304_+	WXG100 family type VII secretion target	NA	A0A2H4J389	uncultured_Caudovirales_phage	36.2	7.1e-19
WP_000069067.1|3779326_3779827_+	hypothetical protein	NA	NA	NA	NA	NA
WP_014482108.1|3779805_3779958_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001022083.1|3780092_3780482_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000540624.1|3780609_3781419_-	N-acetylmuramoyl-L-alanine amidase	NA	D2XR33	Bacillus_phage	82.9	9.1e-135
WP_001261076.1|3781418_3781655_-|bacteriocin	bacteriocin biosynthesis protein	bacteriocin	A0A2H4JGN9	uncultured_Caudovirales_phage	100.0	1.7e-25
WP_000499523.1|3781942_3783136_+|transposase	IS110-like element ISBth13 family transposase	transposase	A0A0U3ULR1	Bacillus_phage	26.1	1.1e-24
WP_000342979.1|3783268_3783637_-	hypothetical protein	NA	A0A0S2MVE0	Bacillus_phage	61.5	1.7e-32
WP_001260192.1|3783648_3788034_-|tail	phage tail protein	tail	A0A0S2MVB4	Bacillus_phage	53.6	0.0e+00
WP_000094125.1|3788030_3789488_-|tail	phage tail family protein	tail	A0A0A7AQV1	Bacillus_phage	59.9	2.3e-173
WP_000897025.1|3789529_3793156_-	hypothetical protein	NA	A0A2H4JAI2	uncultured_Caudovirales_phage	86.5	1.9e-184
WP_000415912.1|3793388_3793751_-	hypothetical protein	NA	A0A2H4JAG8	uncultured_Caudovirales_phage	70.8	2.4e-42
WP_001004907.1|3793755_3794343_-|tail	phage tail protein	tail	A0A2H4JDV4	uncultured_Caudovirales_phage	82.1	5.1e-87
WP_000176452.1|3794343_3794679_-	hypothetical protein	NA	D2XR22	Bacillus_phage	89.9	7.5e-51
WP_001279008.1|3794675_3795020_-	HK97 gp10 family phage protein	NA	A0A2H4JAH8	uncultured_Caudovirales_phage	78.8	7.0e-44
WP_001247272.1|3795021_3795372_-|head	phage head closure protein	head	D2XR20	Bacillus_phage	87.9	1.3e-53
WP_001243203.1|3795373_3795670_-	hypothetical protein	NA	D2XR19	Bacillus_phage	87.5	9.5e-42
WP_000234856.1|3795682_3796846_-|capsid	phage major capsid protein	capsid	A0A2H4JH29	uncultured_Caudovirales_phage	95.9	5.5e-210
3796456:3796473	attL	AAATAAACTTCGTAACTG	NA	NA	NA	NA
WP_000216400.1|3796865_3797642_-|protease	Clp protease ClpP	protease	A0A0A7RWX3	Clostridium_phage	57.7	1.5e-57
WP_015406504.1|3797625_3798732_-|portal	phage portal protein	portal	A0A2H4JAJ1	uncultured_Caudovirales_phage	90.1	9.0e-186
WP_000615661.1|3798797_3800456_-|terminase	terminase large subunit	terminase	A0A2H4JHE9	uncultured_Caudovirales_phage	79.0	1.1e-256
WP_000124844.1|3800452_3800788_-	hypothetical protein	NA	A0A1B1P762	Bacillus_phage	31.2	1.7e-07
WP_001258474.1|3800940_3801282_-	HNH endonuclease	NA	D2XR61	Bacillus_phage	93.6	1.1e-54
WP_000049336.1|3801262_3801676_-	hypothetical protein	NA	Q2I8B8	Bacillus_phage	52.5	1.1e-30
WP_000196709.1|3801689_3801911_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000333210.1|3801903_3802071_-	hypothetical protein	NA	A0A1B1P8J7	Bacillus_phage	67.3	8.1e-14
WP_015055180.1|3802165_3802360_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003271368.1|3802527_3802719_-	hypothetical protein	NA	A0A1B1P857	Bacillus_phage	77.8	2.9e-23
WP_000930972.1|3803173_3803392_-	hypothetical protein	NA	H0USV5	Bacillus_phage	66.2	5.2e-21
WP_001170299.1|3803814_3804765_-	nucleoside hydrolase	NA	NA	NA	NA	NA
WP_001012136.1|3804978_3805521_-|integrase	site-specific integrase	integrase	W8CYP1	Bacillus_phage	90.6	2.1e-87
WP_000166167.1|3805520_3806003_-	ArpU family transcriptional regulator	NA	H0USV3	Bacillus_phage	80.6	2.1e-70
WP_000866139.1|3806030_3806201_-	hypothetical protein	NA	A0A1B0T6D0	Bacillus_phage	73.2	6.1e-09
WP_001061238.1|3806305_3806437_-	DUF3983 domain-containing protein	NA	A0A1B1P7V8	Bacillus_phage	83.7	4.5e-12
WP_001141572.1|3806673_3806889_+	spore germination protein	NA	A0A2H4J3A3	uncultured_Caudovirales_phage	80.3	7.7e-25
WP_015406505.1|3807150_3807948_+	hypothetical protein	NA	A0A285PWR0	Cedratvirus	62.6	2.7e-38
WP_001151791.1|3808704_3808926_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000512858.1|3808961_3809153_-	DUF3954 domain-containing protein	NA	D2XR48	Bacillus_phage	65.1	8.3e-15
WP_001126000.1|3809226_3809589_-	hypothetical protein	NA	D2XR47	Bacillus_phage	90.0	2.4e-55
WP_000926801.1|3809563_3809752_-	hypothetical protein	NA	D2XR45	Bacillus_phage	80.0	5.3e-14
WP_000063842.1|3809754_3811077_-	replicative DNA helicase	NA	D2XR44	Bacillus_phage	94.8	1.9e-235
WP_000312138.1|3811073_3812021_-	DnaD domain protein	NA	D2XR43	Bacillus_phage	59.9	1.2e-74
WP_000923256.1|3812022_3812199_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000998232.1|3812300_3812585_-	hypothetical protein	NA	D2XR42	Bacillus_phage	54.3	2.5e-23
3812509:3812526	attR	CAGTTACGAAGTTTATTT	NA	NA	NA	NA
WP_000215311.1|3812765_3812987_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000537278.1|3813000_3813588_-	hypothetical protein	NA	D2XR41	Bacillus_phage	69.2	8.4e-74
WP_001141264.1|3813678_3813927_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001036233.1|3813959_3814151_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_000900759.1|3814323_3814761_+	helix-turn-helix transcriptional regulator	NA	D2XR39	Bacillus_phage	59.9	7.0e-33
WP_000403118.1|3814773_3815202_+	ImmA/IrrE family metallo-endopeptidase	NA	D2XR38	Bacillus_phage	80.3	7.1e-62
WP_000202384.1|3815285_3816098_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000661246.1|3816155_3817151_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000949469.1|3817134_3817302_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000844785.1|3817472_3819020_+	recombinase family protein	NA	I3VYZ3	Thermoanaerobacterium_phage	53.4	1.0e-142
WP_000954735.1|3819474_3820377_-	dipicolinic acid synthetase subunit A	NA	NA	NA	NA	NA
WP_001239759.1|3820546_3820798_-	YlmC/YmxH family sporulation protein	NA	NA	NA	NA	NA
WP_000593001.1|3820933_3822175_-	insulinase family protein	NA	G3MBJ8	Bacillus_virus	34.5	4.4e-56
WP_000868222.1|3822262_3823162_-	polysaccharide deacetylase family protein	NA	NA	NA	NA	NA
WP_000076745.1|3823314_3825453_-	polyribonucleotide nucleotidyltransferase	NA	NA	NA	NA	NA
WP_001229392.1|3825613_3825883_-	30S ribosomal protein S15	NA	NA	NA	NA	NA
WP_000766703.1|3825983_3826955_-	bifunctional riboflavin kinase/FAD synthetase	NA	A0A1V0SD03	Indivirus	31.8	2.1e-05
WP_000399362.1|3826998_3827922_-|tRNA	tRNA pseudouridine(55) synthase TruB	tRNA	NA	NA	NA	NA
>prophage 10
NC_020376	Bacillus thuringiensis serovar thuringiensis str. IS5056, complete sequence	5491935	4526310	4533993	5491935		Staphylococcus_phage(16.67%)	10	NA	NA
WP_000221100.1|4526310_4527234_-	ABC transporter ATP-binding protein	NA	A0A2H4PQG7	Staphylococcus_phage	44.0	6.9e-46
WP_000247669.1|4527360_4528296_-	HAMP domain-containing histidine kinase	NA	W8CYF6	Bacillus_phage	26.3	4.9e-23
WP_000018060.1|4528297_4528990_-	response regulator transcription factor	NA	B5LWA6	Feldmannia_species_virus	28.8	1.0e-06
WP_001293585.1|4529158_4529332_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001014310.1|4529332_4529527_+	YwbE family protein	NA	NA	NA	NA	NA
WP_001255968.1|4529567_4530767_-	class I SAM-dependent rRNA methyltransferase	NA	W6LLI2	Streptococcus_phage	41.2	5.6e-72
WP_000587824.1|4531061_4531385_+	heme oxygenase	NA	NA	NA	NA	NA
WP_000095598.1|4531453_4532218_-	class B sortase	NA	NA	NA	NA	NA
WP_000403738.1|4532249_4533020_-	ABC transporter ATP-binding protein	NA	G3M9Y6	Bacillus_virus	26.6	1.3e-13
WP_001036824.1|4533009_4533993_-	iron ABC transporter permease	NA	A0A2H4IY97	uncultured_Caudovirales_phage	26.9	7.1e-17
>prophage 11
NC_020376	Bacillus thuringiensis serovar thuringiensis str. IS5056, complete sequence	5491935	4727816	4734860	5491935	transposase	Staphylococcus_phage(50.0%)	9	NA	NA
WP_000165837.1|4727816_4728578_-	ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	39.3	1.0e-34
WP_000527699.1|4728843_4729866_-	DUF418 domain-containing protein	NA	NA	NA	NA	NA
WP_000817275.1|4730022_4731180_-|transposase	IS200/IS605 family element transposase accessory protein TnpB	transposase	Q331V1	Clostridium_botulinum_C_phage	59.0	9.6e-122
WP_004412121.1|4731176_4731527_-|transposase	IS607 family transposase	transposase	Q331V0	Clostridium_botulinum_C_phage	66.7	9.2e-44
WP_001129340.1|4731741_4731891_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000840869.1|4731906_4732170_-	YtzC family protein	NA	NA	NA	NA	NA
WP_000868033.1|4732281_4733241_+	TIGR01212 family radical SAM protein	NA	A0A2H4PQV5	Staphylococcus_phage	72.0	1.7e-55
WP_000764492.1|4733237_4733810_+	class I SAM-dependent methyltransferase	NA	A0A2H4PQV0	Staphylococcus_phage	53.4	4.1e-49
WP_000959717.1|4734026_4734860_+	ABC transporter ATP-binding protein	NA	A0A2H4PQG7	Staphylococcus_phage	31.1	1.8e-16
>prophage 12
NC_020376	Bacillus thuringiensis serovar thuringiensis str. IS5056, complete sequence	5491935	4881806	4970353	5491935	transposase,plate,portal,integrase,capsid,head,terminase,tail,protease,tRNA,coat,holin	Bacillus_phage(67.86%)	98	4876366:4876389	4972367:4972390
4876366:4876389	attL	TTTTGTCGGTAAGTCGATATATTT	NA	NA	NA	NA
WP_000287154.1|4881806_4883183_+|tRNA	glycine--tRNA ligase	tRNA	A0A1V0SIF1	Klosneuvirus	28.1	3.4e-49
WP_001140612.1|4883222_4883606_-	hotdog fold thioesterase	NA	NA	NA	NA	NA
WP_000810334.1|4883701_4884445_+	DUF3298 and DUF4163 domain-containing protein	NA	NA	NA	NA	NA
WP_015406515.1|4884495_4885089_+	biotin transporter BioY	NA	NA	NA	NA	NA
WP_000757822.1|4885134_4886022_-	UTP--glucose-1-phosphate uridylyltransferase GalU	NA	A0A127AW70	Bacillus_phage	54.1	1.2e-79
WP_001104228.1|4886129_4887854_-	phospho-sugar mutase	NA	A0A1X9I671	Streptococcus_phage	53.5	3.5e-176
WP_000545250.1|4887997_4888603_+	DNA integrity scanning protein DisA nucleotide-binding domain protein	NA	NA	NA	NA	NA
WP_001028674.1|4889016_4890270_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000537660.1|4890285_4890708_-	divergent PAP2 family protein	NA	NA	NA	NA	NA
WP_001183889.1|4890719_4891064_-	EamA family transporter	NA	NA	NA	NA	NA
WP_001206693.1|4891166_4892054_-	decaprenyl-phosphate phosphoribosyltransferase	NA	NA	NA	NA	NA
WP_000487953.1|4892228_4893713_-	cytosol aminopeptidase	NA	Q6GYZ8	Mycoplasma_phage	36.6	1.9e-58
WP_002094181.1|4893858_4894485_-	3D domain-containing protein	NA	A0A0H3UZG2	Geobacillus_virus	43.0	2.1e-14
WP_000027016.1|4894570_4894888_-	YuiB family protein	NA	NA	NA	NA	NA
WP_000517993.1|4894884_4895391_-	NUDIX hydrolase	NA	NA	NA	NA	NA
WP_000856603.1|4895708_4896917_-	NAD(P)/FAD-dependent oxidoreductase	NA	NA	NA	NA	NA
WP_000829790.1|4897379_4898369_+	NAD(P)/FAD-dependent oxidoreductase	NA	Q9JRK7	Streptococcus_phage	52.4	3.0e-31
WP_000815781.1|4898482_4908670_-	DUF11 domain-containing protein	NA	NA	NA	NA	NA
WP_000606660.1|4909134_4909614_+	AraC family transcriptional regulator	NA	NA	NA	NA	NA
WP_000391931.1|4909832_4911080_+	MFS transporter	NA	NA	NA	NA	NA
WP_000535246.1|4911097_4911979_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_000635489.1|4912059_4912521_+	DUF523 domain-containing protein	NA	NA	NA	NA	NA
WP_000710531.1|4912843_4913671_+	hypothetical protein	NA	A0A2H4J6G7	uncultured_Caudovirales_phage	69.5	1.8e-101
WP_000551103.1|4913680_4914301_-	replication-relaxation family protein	NA	H0USY2	Bacillus_phage	93.2	6.5e-109
WP_000891536.1|4914242_4915424_-	cell division protein FtsK	NA	H0USY1	Bacillus_phage	94.7	6.9e-216
WP_000170777.1|4915539_4915722_-	hypothetical protein	NA	Q2I8E2	Bacillus_phage	90.0	1.4e-22
WP_001257569.1|4915718_4916036_-	hypothetical protein	NA	H0USY0	Bacillus_phage	98.1	6.4e-52
WP_000649833.1|4916218_4916416_+	helix-turn-helix transcriptional regulator	NA	A0A288WG80	Bacillus_phage	76.2	3.4e-19
WP_001137905.1|4916424_4916604_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000043397.1|4916609_4917188_+	type IV secretory system conjugative DNA transfer family protein	NA	H0USX9	Bacillus_phage	88.0	5.0e-95
WP_000119483.1|4917241_4917580_+	hypothetical protein	NA	A0A1B1P7R0	Bacillus_phage	94.6	2.1e-48
WP_000405778.1|4918125_4918827_-	N-acetylmuramoyl-L-alanine amidase	NA	W8CZ46	Bacillus_phage	90.3	1.7e-121
WP_000373913.1|4918826_4919252_-|holin	phage holin family protein	holin	H0USX7	Bacillus_phage	96.5	1.2e-69
WP_000390482.1|4919327_4919552_-	hemolysin XhlA family protein	NA	A0A1B1P780	Bacillus_phage	97.3	8.3e-30
WP_001243323.1|4919702_4920878_-|plate	BppU family phage baseplate upper protein	plate	A0A1B1P768	Bacillus_phage	80.4	4.6e-172
WP_000631942.1|4920892_4923235_-|tail	phage tail protein	tail	A0A1C8E983	Bacillus_phage	95.3	0.0e+00
WP_000884123.1|4923231_4923915_-|tail	phage tail family protein	tail	A0A1B0T6A0	Bacillus_phage	96.0	2.1e-124
WP_001119327.1|4923915_4927308_-|tail	phage tail tape measure protein	tail	A0A1B0T698	Bacillus_phage	92.1	0.0e+00
WP_000113340.1|4927551_4927938_-	hypothetical protein	NA	A0A1C8E984	Bacillus_phage	99.2	3.6e-65
WP_000151366.1|4927949_4928585_-	hypothetical protein	NA	A0A1C8E980	Bacillus_phage	99.1	1.6e-115
WP_000157921.1|4928596_4928974_-	HK97 gp10 family phage protein	NA	A0A1C8E995	Bacillus_phage	87.2	2.5e-55
WP_001166633.1|4928973_4929303_-	hypothetical protein	NA	A0A1B0T6B7	Bacillus_phage	96.3	2.2e-55
WP_001126092.1|4929292_4929625_-	hypothetical protein	NA	A0A1B2APX8	Phage_Wrath	96.4	1.6e-53
WP_000342229.1|4929602_4929863_-|head,tail	phage gp6-like head-tail connector protein	head,tail	A0A1B2APX3	Phage_Wrath	96.5	1.4e-41
WP_001049344.1|4929864_4931169_-|capsid	phage major capsid protein	capsid	A0A2H4JFZ3	uncultured_Caudovirales_phage	91.1	5.5e-198
WP_000687903.1|4931170_4931752_-|head,protease	HK97 family phage prohead protease	head,protease	A0A1C8EA63	Bacillus_phage	96.4	1.4e-97
WP_000603760.1|4931822_4932080_+	hypothetical protein	NA	A0A1C8E966	Bacillus_phage	70.6	2.2e-26
WP_000524246.1|4932248_4933421_-|portal	phage portal protein	portal	A0A1C8E972	Bacillus_phage	99.2	2.7e-220
WP_000587611.1|4933436_4935161_-|terminase	terminase large subunit	terminase	A0A1C8E985	Bacillus_phage	94.3	0.0e+00
WP_000113444.1|4935157_4935583_-|terminase	P27 family phage terminase small subunit	terminase	A0A1C8E969	Bacillus_phage	94.3	5.3e-70
WP_000872554.1|4935665_4936058_-	HNH endonuclease	NA	A0A1B1P7N1	Bacillus_phage	96.2	6.9e-72
WP_000627440.1|4936054_4936369_-	Rho termination factor N-terminal domain-containing protein	NA	A0A1B0T6C6	Bacillus_phage	89.4	1.4e-46
WP_000074276.1|4936365_4936584_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000052395.1|4936630_4936828_-	hypothetical protein	NA	A0A1C8E9B9	Bacillus_phage	83.1	2.3e-23
WP_000930965.1|4936885_4937110_-	hypothetical protein	NA	H0USV5	Bacillus_phage	91.9	2.3e-32
WP_000895343.1|4937394_4937784_-	hypothetical protein	NA	A0A1C8E9D1	Bacillus_phage	61.2	9.9e-39
WP_102981940.1|4937801_4937900_-	DUF3983 domain-containing protein	NA	NA	NA	NA	NA
WP_000847100.1|4938067_4938253_-	hypothetical protein	NA	Q3HKX5	Bacillus_phage	50.0	5.1e-09
WP_001092478.1|4938300_4938588_-	hypothetical protein	NA	A0A0S2MVI8	Bacillus_phage	92.6	8.9e-45
WP_000726820.1|4938813_4939212_-	hypothetical protein	NA	A0A1B0T6B6	Bacillus_phage	97.0	1.0e-67
WP_000159772.1|4939296_4940043_-	sigma-70 family RNA polymerase sigma factor	NA	Q2I8C6	Bacillus_phage	74.2	8.2e-98
WP_000002743.1|4940039_4940264_-	hypothetical protein	NA	C7DTL1	Bacillus_phage	72.6	4.0e-24
WP_000532218.1|4940263_4941145_-	ATP-binding protein	NA	A0A1B1P7U2	Bacillus_phage	32.6	5.2e-27
WP_000040038.1|4941156_4941930_-	conserved phage C-terminal domain-containing protein	NA	A0A1W6JNI1	Staphylococcus_phage	47.4	4.9e-53
WP_000525424.1|4942062_4942944_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000372558.1|4942967_4943642_-	Rha family transcriptional regulator	NA	A0A288WFT2	Bacillus_phage	66.5	4.6e-84
WP_000277642.1|4943855_4944044_-	helix-turn-helix domain-containing protein	NA	A0A1B2APY7	Phage_Wrath	80.6	3.4e-21
WP_000368215.1|4944188_4944434_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001236353.1|4944815_4946045_-|transposase	IS110 family transposase	transposase	M1NSC9	Streptococcus_phage	48.5	1.7e-84
WP_000004989.1|4946414_4946744_+	helix-turn-helix transcriptional regulator	NA	H0UST7	Bacillus_phage	96.3	9.6e-51
WP_001233256.1|4947018_4947168_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000466634.1|4947164_4948418_-	hypothetical protein	NA	H0UST6	Bacillus_phage	98.1	1.7e-212
WP_000237488.1|4949759_4950821_+|integrase	site-specific integrase	integrase	A0A1B2AQ00	Phage_Wrath	83.6	4.6e-171
WP_000833148.1|4950910_4951264_-	YxeA family protein	NA	A0A0K2CYS5	Paenibacillus_phage	40.2	1.3e-13
WP_003272374.1|4951370_4951556_-	methyltransferase	NA	NA	NA	NA	NA
WP_000834607.1|4951959_4952730_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001068189.1|4953642_4954206_+	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_000573830.1|4954311_4954665_-	iron-sulfur cluster assembly accessory protein	NA	A0A2H4N7M3	Lake_Baikal_phage	42.3	8.2e-16
WP_000077392.1|4954706_4955573_-	diaminopimelate epimerase	NA	NA	NA	NA	NA
WP_000595026.1|4955819_4956059_-	YuzB family protein	NA	NA	NA	NA	NA
WP_000682065.1|4956411_4957482_+	NAD(P)/FAD-dependent oxidoreductase	NA	NA	NA	NA	NA
WP_001054089.1|4957715_4957889_+	aspartyl-phosphate phosphatase Spo0E family protein	NA	NA	NA	NA	NA
WP_000470295.1|4957944_4958604_+	ABC transporter ATP-binding protein	NA	G3M9Y6	Bacillus_virus	35.7	2.9e-22
WP_000679257.1|4958587_4959385_+	iron export ABC transporter permease subunit FetB	NA	NA	NA	NA	NA
WP_000212735.1|4959626_4959968_-	alkylphosphonate utilization operon protein PhnA	NA	NA	NA	NA	NA
WP_024927875.1|4960127_4960409_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003272364.1|4960478_4961276_-	DUF2628 domain-containing protein	NA	NA	NA	NA	NA
WP_001019404.1|4961602_4962280_-|protease	CPBP family intramembrane metalloprotease	protease	NA	NA	NA	NA
WP_003272363.1|4962378_4963173_-	nucleotidyltransferase domain-containing protein	NA	NA	NA	NA	NA
WP_000248588.1|4963225_4963534_-	YuzD family protein	NA	NA	NA	NA	NA
WP_000431159.1|4963729_4963966_+	NifU family protein	NA	Q58MC7	Prochlorococcus_phage	46.6	2.0e-10
WP_001125507.1|4964285_4964501_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000614216.1|4964562_4965564_-|coat	spore coat protein CotS	coat	NA	NA	NA	NA
WP_000665103.1|4965684_4966176_+	phosphatidylglycerophosphatase A	NA	G3MBC5	Bacillus_virus	53.8	3.5e-41
WP_000351152.1|4966199_4966679_-	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_001106075.1|4966840_4967944_+	HpcH/HpaI aldolase/citrate lyase family protein	NA	NA	NA	NA	NA
WP_000856291.1|4967888_4969235_+	phosphoribosyltransferase family protein	NA	NA	NA	NA	NA
WP_000241506.1|4969240_4970353_+|protease	cysteine protease StiP family protein	protease	NA	NA	NA	NA
4972367:4972390	attR	AAATATATCGACTTACCGACAAAA	NA	NA	NA	NA
>prophage 1
NC_020393	Bacillus thuringiensis serovar thuringiensis str. IS5056 plasmid pIS56-107, complete sequence	107431	4122	35114	107431	integrase,transposase	Bacillus_phage(45.45%)	25	22631:22646	39872:39887
WP_000116413.1|4122_5544_+|transposase	IS4-like element ISBth4 family transposase	transposase	NA	NA	NA	NA
WP_000203376.1|5899_9586_-	pesticidal crystal protein cry1Ba	NA	NA	NA	NA	NA
WP_014481837.1|10155_10602_-	hypothetical protein	NA	A0A1B1P878	Bacillus_phage	42.2	1.6e-16
WP_000681129.1|10588_10969_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003272683.1|10965_12879_-|integrase	tyrosine-type recombinase/integrase	integrase	NA	NA	NA	NA
WP_000861877.1|12971_14090_-|integrase	tyrosine-type recombinase/integrase	integrase	A0A0S2MV79	Bacillus_phage	25.0	3.2e-05
WP_001043946.1|14572_14845_-	HU family DNA-binding protein	NA	A7KV42	Bacillus_phage	67.8	1.8e-23
WP_015413263.1|15295_15694_+|transposase	IS200/IS605 family transposase	transposase	A0A286QN76	Streptococcus_phage	69.7	3.1e-51
WP_000595411.1|15705_16812_+	helix-turn-helix domain-containing protein	NA	A0A288TXV8	Enterococcus_phage	47.5	1.3e-78
WP_001058764.1|17278_17488_+	hypothetical protein	NA	NA	NA	NA	NA
WP_167374445.1|17778_18132_+	ArsR family transcriptional regulator	NA	NA	NA	NA	NA
WP_000021282.1|18156_18387_+	hypothetical protein	NA	A0A217ERD4	Bacillus_phage	51.8	2.2e-06
WP_000700965.1|18713_19484_-	coenzyme F420-0:L-glutamate ligase	NA	NA	NA	NA	NA
WP_000644939.1|19480_20341_-	sugar phosphate isomerase/epimerase	NA	NA	NA	NA	NA
WP_000660942.1|20337_21204_-	shikimate dehydrogenase	NA	NA	NA	NA	NA
WP_000554005.1|21411_22434_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000028781.1|22417_23659_+	S-adenosylmethionine synthetase	NA	NA	NA	NA	NA
22631:22646	attL	AAATATGGTGGTGATA	NA	NA	NA	NA
WP_000412005.1|23639_24650_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000560325.1|24646_25774_+	glycosyltransferase	NA	NA	NA	NA	NA
WP_003275306.1|26101_27349_+	MFS transporter	NA	A0A1B0RXG2	Streptococcus_phage	25.1	9.4e-06
WP_014481840.1|27345_30363_+	non-ribosomal peptide synthetase	NA	A0A2K9L3I8	Tupanvirus	28.0	4.1e-39
WP_000704745.1|30645_31812_+	nucleotide sugar dehydrogenase	NA	A0A1J0FA55	Only_Syngen_Nebraska_virus	52.1	1.4e-107
WP_001021537.1|32194_33238_-|integrase	tyrosine-type recombinase/integrase	integrase	A0A0E3T6D9	Bacillus_phage	23.4	5.8e-09
WP_015413265.1|33469_33739_+	zinc-finger domain-containing protein	NA	NA	NA	NA	NA
WP_000275580.1|33818_35114_+|transposase	IS21-like element IS232 family transposase	transposase	A0A059NT83	Lactococcus_phage	31.0	1.0e-42
39872:39887	attR	TATCACCACCATATTT	NA	NA	NA	NA
>prophage 1
NC_020394	Bacillus thuringiensis serovar thuringiensis str. IS5056 plasmid pIS56-233, complete sequence	233730	87750	98825	233730	transposase	Bacillus_phage(91.67%)	13	NA	NA
WP_015413274.1|87750_88869_-|transposase	IS200/IS605 family element transposase accessory protein TnpB	transposase	S6AND0	Bacillus_phage	81.2	4.4e-172
WP_001127274.1|90018_90594_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000731447.1|90914_91970_-	N-acetylmuramoyl-L-alanine amidase	NA	A0A1B0T6C8	Bacillus_phage	71.2	2.0e-150
WP_000570185.1|91966_92206_-	hypothetical protein	NA	A0A0A7AR38	Bacillus_phage	75.9	2.7e-26
WP_000377827.1|92205_92442_-	hemolysin XhlA family protein	NA	A0A2H4J382	uncultured_Caudovirales_phage	84.6	3.0e-14
WP_000405795.1|92632_93517_-	N-acetylmuramoyl-L-alanine amidase family protein	NA	A0A0S2MVR5	Bacillus_phage	52.4	4.2e-77
WP_000159989.1|93790_94612_-	M23 family metallopeptidase	NA	A0A218KCJ1	Bacillus_phage	43.8	1.5e-28
WP_000025079.1|94753_95722_-	lysozyme family protein	NA	A0A223LKM8	Bacillus_phage	41.7	1.7e-31
WP_000460736.1|95959_96346_-	DUF1492 domain-containing protein	NA	A0A288WG73	Bacillus_phage	70.6	7.5e-47
WP_000510871.1|96449_97346_-	DnaD domain protein	NA	A0A1C8E9B4	Bacillus_phage	63.5	1.1e-77
WP_000527099.1|97572_97809_-	helix-turn-helix transcriptional regulator	NA	W8CYU0	Bacillus_phage	60.0	3.7e-12
WP_000579787.1|97945_98374_+	helix-turn-helix transcriptional regulator	NA	Q786F1	Bacillus_phage	50.7	2.1e-29
WP_000673773.1|98396_98825_+	ImmA/IrrE family metallo-endopeptidase	NA	Q9T201	Bacillus_phage	54.4	3.1e-33
>prophage 1
NC_020384	Bacillus thuringiensis serovar thuringiensis str. IS5056 plasmid pIS56-285, complete sequence	285459	384	56915	285459	transposase,bacteriocin,integrase,holin	Bacillus_phage(50.0%)	50	47130:47148	61754:61772
WP_000275580.1|384_1680_+|transposase	IS21-like element IS232 family transposase	transposase	A0A059NT83	Lactococcus_phage	31.0	1.0e-42
WP_000798699.1|1669_2422_+	ATP-binding protein	NA	A0A059NT77	Lactococcus_phage	47.3	7.0e-57
WP_033679389.1|4893_5145_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000892197.1|5505_5928_-|holin	phage holin family protein	holin	A0A0S2MVC4	Bacillus_phage	77.3	1.3e-52
WP_000495521.1|8421_8826_-	DUF3221 domain-containing protein	NA	NA	NA	NA	NA
WP_001243454.1|10021_11071_+	Fic family protein	NA	NA	NA	NA	NA
WP_001252813.1|11236_11584_-	hypothetical protein	NA	A0A0S2MVJ2	Bacillus_phage	49.5	3.2e-20
WP_015406602.1|12989_14108_-|transposase	IS200/IS605 family element transposase accessory protein TnpB	transposase	S6AND0	Bacillus_phage	80.6	3.7e-171
WP_000762719.1|14506_14905_+|transposase	IS200/IS605 family transposase	transposase	A0A286QN76	Streptococcus_phage	65.9	7.0e-48
WP_003319651.1|15631_15994_+|transposase	IS3 family transposase	transposase	A0A2I6AZV9	Macacine_betaherpesvirus	45.7	6.0e-14
WP_001255046.1|16186_16534_-	DUF4064 domain-containing protein	NA	A0A0S2MVJ2	Bacillus_phage	54.1	2.5e-25
WP_000954716.1|16823_17666_-	arylamine N-acetyltransferase	NA	NA	NA	NA	NA
WP_015406604.1|18420_18567_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000116413.1|18657_20079_-|transposase	IS4-like element ISBth4 family transposase	transposase	NA	NA	NA	NA
WP_000240401.1|20191_20410_-	hypothetical protein	NA	NA	NA	NA	NA
WP_014481859.1|21233_21770_+	ADP-ribosyltransferase	NA	NA	NA	NA	NA
WP_014481860.1|21729_22041_+	mono-ADP-ribosyltransferase C3 (Exoenzyme C3)	NA	NA	NA	NA	NA
WP_000116994.1|22416_23847_+|transposase	IS4 family transposase	transposase	NA	NA	NA	NA
WP_000520933.1|24310_25183_-	DMT family transporter	NA	NA	NA	NA	NA
WP_015406607.1|27332_28349_-	exosporium leader peptide-containing protein	NA	NA	NA	NA	NA
WP_001032039.1|28915_29215_-	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_000845491.1|29767_29977_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000844156.1|30113_30362_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001103226.1|30706_31801_+	tetratricopeptide repeat protein	NA	A0A2H4J8G3	uncultured_Caudovirales_phage	48.8	1.5e-92
WP_000737574.1|31797_31935_+	hypothetical protein	NA	NA	NA	NA	NA
WP_014481861.1|32058_32223_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000456645.1|32242_33136_-	SEC-C motif-containing protein	NA	NA	NA	NA	NA
WP_000065268.1|33315_33540_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000798699.1|34243_34996_-	ATP-binding protein	NA	A0A059NT77	Lactococcus_phage	47.3	7.0e-57
WP_000275580.1|34985_36281_-|transposase	IS21-like element IS232 family transposase	transposase	A0A059NT83	Lactococcus_phage	31.0	1.0e-42
WP_000790837.1|37361_37754_+	DUF4878 domain-containing protein	NA	NA	NA	NA	NA
WP_000128275.1|37827_38046_-|bacteriocin	bacteriocin immunity protein	bacteriocin	NA	NA	NA	NA
WP_000532004.1|38068_39373_-	WXG100 family type VII secretion target	NA	NA	NA	NA	NA
WP_000346798.1|39838_40003_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000121085.1|40581_41094_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_000149389.1|41115_41466_-	zinc-finger domain-containing protein	NA	NA	NA	NA	NA
WP_001021539.1|41697_42741_+|integrase	tyrosine-type recombinase/integrase	integrase	A0A0E3T6D9	Bacillus_phage	23.1	1.2e-09
WP_000019020.1|42954_43281_+	helix-turn-helix transcriptional regulator	NA	A0A0A7AQV8	Bacillus_phage	51.0	2.4e-22
WP_000734601.1|43613_43766_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001001083.1|43762_44986_-	hypothetical protein	NA	A0A1B1P895	Bacillus_phage	66.1	6.1e-151
WP_000475295.1|45192_46836_-	peptide ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
47130:47148	attL	AAAAAGAACCATAACCTTG	NA	NA	NA	NA
WP_000843046.1|47537_47816_-	AbrB/MazE/SpoVT family DNA-binding domain-containing protein	NA	A0A2I7SC16	Paenibacillus_phage	59.0	2.3e-13
WP_014481865.1|47882_48023_-	hypothetical protein	NA	NA	NA	NA	NA
WP_031303430.1|48297_48492_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001043935.1|48738_49011_+	HU family DNA-binding protein	NA	A7KV42	Bacillus_phage	68.9	3.3e-25
WP_000914524.1|49500_50016_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001053969.1|50120_51557_+|transposase	IS4-like element IS231C family transposase	transposase	NA	NA	NA	NA
WP_000272577.1|52365_53631_+	Y-family DNA polymerase	NA	O64031	Bacillus_phage	46.7	4.2e-102
WP_000477499.1|53811_54909_+|integrase	tyrosine-type recombinase/integrase	integrase	S5W9T9	Leptospira_phage	30.3	6.5e-11
WP_001028065.1|54905_56915_+|integrase	tyrosine-type recombinase/integrase	integrase	NA	NA	NA	NA
61754:61772	attR	CAAGGTTATGGTTCTTTTT	NA	NA	NA	NA
>prophage 2
NC_020384	Bacillus thuringiensis serovar thuringiensis str. IS5056 plasmid pIS56-285, complete sequence	285459	164104	236038	285459	transposase,integrase	Bacillus_phage(22.22%)	57	224030:224047	244849:244866
WP_000041871.1|164104_165052_-|integrase	site-specific integrase	integrase	NA	NA	NA	NA
WP_000217299.1|165192_165336_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000520262.1|166278_167988_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000372779.1|168674_170144_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000372481.1|170179_171904_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000459233.1|172285_173095_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000724860.1|174892_175285_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000610947.1|175377_176160_+	ImmA/IrrE family metallo-endopeptidase	NA	NA	NA	NA	NA
WP_000373088.1|176174_177092_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000335059.1|177501_179304_+	hypothetical protein	NA	NA	NA	NA	NA
WP_014481878.1|180397_182767_+	CRISPR-associated helicase/endonuclease Cas3	NA	NA	NA	NA	NA
WP_003319726.1|182972_183692_+	type I-C CRISPR-associated protein Cas5	NA	NA	NA	NA	NA
WP_000118651.1|183692_185612_+	type I-C CRISPR-associated protein Cas8c/Csd1	NA	NA	NA	NA	NA
WP_000853368.1|185614_186475_+	type I-C CRISPR-associated protein Cas7/Csd2	NA	NA	NA	NA	NA
WP_130055909.1|186765_186930_+	type I CRISPR-associated protein Cas7	NA	NA	NA	NA	NA
WP_071686409.1|186981_187215_+	type I CRISPR-associated protein Cas7	NA	NA	NA	NA	NA
WP_000710696.1|189674_190100_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000710813.1|190121_190259_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001219637.1|190363_191455_+	methyltransferase	NA	NA	NA	NA	NA
WP_000114815.1|191470_191698_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000654328.1|193424_195290_+	group II intron reverse transcriptase/maturase	NA	A0A0U4J920	Pseudomonas_phage	30.9	2.4e-37
WP_103653709.1|195567_197970_+	DEAD/DEAH box helicase	NA	NA	NA	NA	NA
WP_000494364.1|197986_198700_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001024816.1|199036_199666_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000817905.1|199665_200301_+	hypothetical protein	NA	NA	NA	NA	NA
WP_078405438.1|200351_200930_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000916413.1|200949_201534_-	hypothetical protein	NA	NA	NA	NA	NA
WP_015406623.1|201659_202043_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000866011.1|202059_202698_+	NERD domain-containing protein	NA	A0A2R2ZH57	Clostridioides_phage	35.6	3.3e-23
WP_000312314.1|203283_203484_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003319769.1|203829_204003_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000520732.1|204455_207119_+	type IA DNA topoisomerase	NA	A0A1V0SIB2	Klosneuvirus	20.9	4.5e-13
WP_000708139.1|207547_208192_+	thermonuclease family protein	NA	A0A2P1JU10	Anoxybacillus_phage	34.0	3.7e-06
WP_001014119.1|208224_208425_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000081052.1|208500_208788_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000887510.1|208811_209270_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000420420.1|209260_209698_+	disulfide bond formation protein B	NA	NA	NA	NA	NA
WP_000207869.1|209771_210065_+	winged helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_001017354.1|210254_211346_+	tetratricopeptide repeat protein	NA	A0A2H4J8G3	uncultured_Caudovirales_phage	45.6	9.2e-90
WP_024927926.1|211653_211971_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000682816.1|211967_212345_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000763085.1|212428_212944_+	hypothetical protein	NA	NA	NA	NA	NA
WP_033679394.1|214461_214764_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001206763.1|215481_215895_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000954720.1|216291_217107_+	arylamine N-acetyltransferase	NA	NA	NA	NA	NA
WP_071686411.1|217287_217416_+	RNA chaperone Hfq	NA	NA	NA	NA	NA
WP_087942375.1|217699_219261_-|transposase	IS3 family transposase	transposase	A0A0C5AEA5	Paenibacillus_phage	57.6	4.9e-68
WP_000762722.1|219673_220078_+|transposase	IS200/IS605 family transposase	transposase	A0A286QN76	Streptococcus_phage	67.6	6.5e-41
WP_000929144.1|221326_221623_+	hypothetical protein	NA	NA	NA	NA	NA
WP_015406625.1|222739_223858_-|transposase	IS200/IS605 family element transposase accessory protein TnpB	transposase	S6AND0	Bacillus_phage	81.5	3.0e-173
224030:224047	attL	TTGAGGAAGGAGTCTTCT	NA	NA	NA	NA
WP_000701098.1|225214_226288_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000369347.1|226399_227311_+	DMT family transporter	NA	NA	NA	NA	NA
WP_000981146.1|227991_229110_+|transposase	IS200/IS605 family element transposase accessory protein TnpB	transposase	S6AND0	Bacillus_phage	80.4	5.4e-170
WP_000790998.1|229867_231187_+	HBL/NHE enterotoxin family protein	NA	NA	NA	NA	NA
WP_000975321.1|231249_232479_+	alpha-helical pore-forming toxin family protein	NA	NA	NA	NA	NA
WP_001063469.1|232510_233644_+	alpha-helical pore-forming toxin family protein	NA	NA	NA	NA	NA
WP_003319867.1|235771_236038_+|integrase,transposase	DDE-type integrase/transposase/recombinase	integrase,transposase	NA	NA	NA	NA
244849:244866	attR	AGAAGACTCCTTCCTCAA	NA	NA	NA	NA
>prophage 1
NC_020385	Bacillus thuringiensis serovar thuringiensis str. IS5056 plasmid pIS56-328, complete sequence	328151	141977	193464	328151	integrase,transposase	Lactococcus_phage(30.77%)	43	174580:174639	194201:194301
WP_000538377.1|141977_144941_-|transposase	Tn3 family transposase	transposase	A0A1B0V7H9	Salmonella_phage	39.2	7.0e-201
WP_000382147.1|144959_145814_-	TnP I resolvase	NA	S5M9V8	Brevibacillus_phage	26.4	4.4e-23
WP_015406671.1|145883_146204_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000282533.1|147074_147263_-	RNA chaperone Hfq	NA	NA	NA	NA	NA
WP_000710775.1|147962_148622_+	GntR family transcriptional regulator	NA	NA	NA	NA	NA
WP_000793628.1|148623_149601_+	multidrug resistance efflux transporter family protein	NA	NA	NA	NA	NA
WP_001087712.1|149897_150173_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000122389.1|150240_150474_-	YuzF family protein	NA	NA	NA	NA	NA
WP_000340038.1|150713_150947_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000738546.1|151242_151389_-	BC1881 family protein	NA	NA	NA	NA	NA
WP_000486310.1|151936_152398_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000957105.1|152613_153522_-	acyl-ACP desaturase	NA	NA	NA	NA	NA
WP_001192000.1|154053_154353_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000410775.1|154891_155095_+	cold-shock protein	NA	Q9AZD3	Lactococcus_phage	63.6	1.5e-17
WP_001038995.1|155225_158108_-	collagenase ColA	NA	NA	NA	NA	NA
WP_000520478.1|158856_159462_-	TetR/AcrR family transcriptional regulator	NA	NA	NA	NA	NA
WP_000954712.1|159639_160446_-	arylamine N-acetyltransferase	NA	NA	NA	NA	NA
WP_000540759.1|160774_161335_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001058402.1|161730_162105_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000422018.1|162191_163919_-	methyl-accepting chemotaxis protein	NA	A0A2H4J162	uncultured_Caudovirales_phage	83.3	1.1e-07
WP_000196664.1|164296_164596_-	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_001014211.1|165175_166495_-	septum formation initiator	NA	NA	NA	NA	NA
WP_140157233.1|166576_166624_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000281790.1|166791_167679_-	L-serine ammonia-lyase, iron-sulfur-dependent, subunit alpha	NA	NA	NA	NA	NA
WP_001024892.1|167700_168399_-	serine dehydratase	NA	NA	NA	NA	NA
WP_000064502.1|170172_171363_-	MFS transporter	NA	NA	NA	NA	NA
WP_003275109.1|171721_172309_+	TetR/AcrR family transcriptional regulator	NA	NA	NA	NA	NA
WP_001222641.1|173138_174224_+	tyrosinase family protein	NA	NA	NA	NA	NA
174580:174639	attL	GTGTAAATGTCAAGATAAACATGTACATTTTCGCTTGTTTAAGCATGTACAAAATCAATC	NA	NA	NA	NA
WP_000798699.1|174680_175433_-	ATP-binding protein	NA	A0A059NT77	Lactococcus_phage	47.3	7.0e-57
WP_000275580.1|175422_176718_-|transposase	IS21-like element IS232 family transposase	transposase	A0A059NT83	Lactococcus_phage	31.0	1.0e-42
WP_000505353.1|177408_178251_-	SMP-30/gluconolactonase/LRE family protein	NA	NA	NA	NA	NA
WP_000233374.1|178524_178878_-	DUF4360 domain-containing protein	NA	NA	NA	NA	NA
WP_000089897.1|179359_180727_-	S8 family serine peptidase	NA	Q2A0D0	Sodalis_phage	26.0	4.8e-19
WP_000573035.1|180916_181150_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001099187.1|181283_181454_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000531388.1|181758_182724_-	S8 family peptidase	NA	A0A127AWU5	Bacillus_phage	57.8	3.1e-89
WP_015406677.1|183147_184227_-|transposase	IS200/IS605 family element transposase accessory protein TnpB	transposase	A0A0A8WI33	Clostridium_phage	31.3	4.2e-18
WP_015406678.1|184232_184634_-|transposase	IS200/IS605 family transposase	transposase	Q332K6	Clostridium_botulinum_C_phage	71.2	5.8e-50
WP_000358798.1|185024_185168_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003275498.1|185846_187589_-	S8 family serine peptidase	NA	A0A1V0S9L2	Catovirus	28.4	1.2e-11
WP_015406680.1|189237_190410_-|integrase	tyrosine-type recombinase/integrase	integrase	A0A142F1N9	Bacillus_phage	24.4	6.8e-06
WP_000189815.1|190813_191830_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_000275580.1|192168_193464_+|transposase	IS21-like element IS232 family transposase	transposase	A0A059NT83	Lactococcus_phage	31.0	1.0e-42
194201:194301	attR	GATTGATTTTGTACATGCTTAAACAAGCGAAAATGTACATGTTTATCTTGACATTTACACCACTATAATAGAAATAGAATTCCAGTATCCAAGAGTTCGTT	NA	NA	NA	NA
>prophage 1
NC_020381	Bacillus thuringiensis serovar thuringiensis str. IS5056 plasmid pIS56-39, complete sequence	39749	0	6773	39749		Bacillus_phage(85.71%)	8	NA	NA
WP_000382147.1|2239_3094_-	TnP I resolvase	NA	S5M9V8	Brevibacillus_phage	26.4	4.4e-23
WP_015406549.1|3209_3452_-	hypothetical protein	NA	NA	NA	NA	NA
WP_015406550.1|3481_4222_-	hypothetical protein	NA	A0A0S2MVI5	Bacillus_phage	67.0	3.2e-86
WP_001017952.1|4246_4675_-	hypothetical protein	NA	A0A0S2MVA8	Bacillus_phage	47.1	3.2e-30
WP_000016917.1|4697_5393_-	Rha family transcriptional regulator	NA	A0A0S2MVD8	Bacillus_phage	43.8	4.8e-44
WP_000786982.1|5397_5583_-	helix-turn-helix transcriptional regulator	NA	A0A0M3ULF9	Bacillus_phage	59.0	1.0e-09
WP_000028578.1|5856_6294_+	helix-turn-helix transcriptional regulator	NA	A0A1C8E9A4	Bacillus_phage	56.2	9.8e-35
WP_000542658.1|6314_6773_+	ImmA/IrrE family metallo-endopeptidase	NA	Q9T201	Bacillus_phage	47.8	5.8e-30
>prophage 2
NC_020381	Bacillus thuringiensis serovar thuringiensis str. IS5056 plasmid pIS56-39, complete sequence	39749	11772	38002	39749	transposase,tail,holin	Bacillus_phage(53.33%)	28	NA	NA
WP_001246650.1|11772_12051_+	hypothetical protein	NA	A0A0S2MVK9	Bacillus_phage	79.1	8.7e-37
WP_000477695.1|12193_12445_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000379283.1|13016_13631_+	DUF3967 domain-containing protein	NA	NA	NA	NA	NA
WP_000365196.1|13788_14772_+	ParM/StbA family protein	NA	A0A0S2MVG2	Bacillus_phage	38.0	1.8e-52
WP_000664560.1|14768_15134_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000072432.1|15228_15465_+	hypothetical protein	NA	A0A1B1P789	Bacillus_phage	50.6	2.2e-17
WP_000734385.1|15518_15764_-	hypothetical protein	NA	A0A2H4JBB8	uncultured_Caudovirales_phage	75.4	6.7e-17
WP_000558422.1|15763_16879_-	tetratricopeptide repeat protein	NA	A0A2H4J8G3	uncultured_Caudovirales_phage	54.1	1.2e-105
WP_003275239.1|17386_18109_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000276342.1|18124_18337_-	hypothetical protein	NA	A0A1Z1LZP5	Bacillus_phage	94.3	4.3e-28
WP_002175753.1|18329_18557_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000383999.1|18583_18736_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000742982.1|18884_19943_-	N-acetylmuramoyl-L-alanine amidase	NA	A0A1B1P7Q1	Bacillus_phage	75.4	2.0e-150
WP_000439587.1|20022_20520_-|holin	phage holin family protein	holin	A0A0M4R5G6	Bacillus_phage	42.8	1.2e-25
WP_000499525.1|20815_22012_+|transposase	IS110 family transposase	transposase	A0A0U3ULR1	Bacillus_phage	25.9	5.6e-24
WP_000152790.1|22265_22514_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000182359.1|22527_23478_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000537585.1|23493_23874_-	hypothetical protein	NA	G3MAB0	Bacillus_virus	33.3	5.9e-12
WP_000013278.1|23886_25887_-	hypothetical protein	NA	A0A2H4J270	uncultured_Caudovirales_phage	33.5	4.0e-14
WP_001291956.1|25902_28416_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000264171.1|28437_30174_-	hypothetical protein	NA	A0A0K2CNY7	Brevibacillus_phage	43.6	4.8e-125
WP_000332096.1|30188_31538_-	hypothetical protein	NA	A0A0K2CP42	Brevibacillus_phage	34.0	1.1e-73
WP_000006647.1|31551_31929_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000464284.1|31941_32316_-	hypothetical protein	NA	A0A0K2CPR2	Brevibacillus_phage	38.5	1.1e-15
WP_000605842.1|32360_32744_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001206677.1|32754_34302_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000025600.1|34298_34982_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000947773.1|34978_38002_-|tail	phage tail tape measure protein	tail	A0A1B1P7P9	Bacillus_phage	56.7	4.3e-89
>prophage 1
NC_020392	Bacillus thuringiensis serovar thuringiensis str. IS5056 plasmid pIS56-63, complete sequence	63864	0	3333	63864		Brevibacillus_phage(100.0%)	1	NA	NA
WP_000382147.1|2478_3333_-	TnP I resolvase	NA	S5M9V8	Brevibacillus_phage	26.4	4.4e-23
>prophage 2
NC_020392	Bacillus thuringiensis serovar thuringiensis str. IS5056 plasmid pIS56-63, complete sequence	63864	9182	10139	63864		Bacillus_phage(100.0%)	1	NA	NA
WP_000215667.1|9182_10139_-	N-acetylmuramoyl-L-alanine amidase	NA	A0A0S2MV84	Bacillus_phage	39.5	6.9e-49
>prophage 3
NC_020392	Bacillus thuringiensis serovar thuringiensis str. IS5056 plasmid pIS56-63, complete sequence	63864	13574	19567	63864	transposase	Lactococcus_phage(50.0%)	6	NA	NA
WP_000275580.1|13574_14870_+|transposase	IS21-like element IS232 family transposase	transposase	A0A059NT83	Lactococcus_phage	31.0	1.0e-42
WP_000798699.1|14859_15612_+	ATP-binding protein	NA	A0A059NT77	Lactococcus_phage	47.3	7.0e-57
WP_000714368.1|15928_16105_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000809635.1|16133_16715_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001236352.1|17079_18309_+|transposase	IS110 family transposase	transposase	M1NSC9	Streptococcus_phage	48.8	1.1e-83
WP_000362624.1|18457_19567_-	M23 family metallopeptidase	NA	A0A2D0ZM66	Rhodococcus_phage	45.2	4.3e-18
>prophage 4
NC_020392	Bacillus thuringiensis serovar thuringiensis str. IS5056 plasmid pIS56-63, complete sequence	63864	29278	32452	63864		Bacillus_phage(100.0%)	1	NA	NA
WP_015413262.1|29278_32452_-	ATP-binding protein	NA	A7KUX5	Bacillus_phage	23.2	2.2e-06
>prophage 5
NC_020392	Bacillus thuringiensis serovar thuringiensis str. IS5056 plasmid pIS56-63, complete sequence	63864	36722	37916	63864	transposase	Bacillus_phage(100.0%)	1	NA	NA
WP_000499523.1|36722_37916_+|transposase	IS110-like element ISBth13 family transposase	transposase	A0A0U3ULR1	Bacillus_phage	26.1	1.1e-24
>prophage 6
NC_020392	Bacillus thuringiensis serovar thuringiensis str. IS5056 plasmid pIS56-63, complete sequence	63864	55286	57324	63864	transposase	Lactococcus_phage(100.0%)	2	NA	NA
WP_000798699.1|55286_56039_-	ATP-binding protein	NA	A0A059NT77	Lactococcus_phage	47.3	7.0e-57
WP_000275580.1|56028_57324_-|transposase	IS21-like element IS232 family transposase	transposase	A0A059NT83	Lactococcus_phage	31.0	1.0e-42
>prophage 7
NC_020392	Bacillus thuringiensis serovar thuringiensis str. IS5056 plasmid pIS56-63, complete sequence	63864	60559	61495	63864	integrase	Bacillus_phage(100.0%)	1	NA	NA
WP_000873092.1|60559_61495_+|integrase	site-specific integrase	integrase	A0A1B1P793	Bacillus_phage	46.6	3.8e-76
