The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
NZ_CP007159	Bordetella holmesii F627 chromosome, complete genome	3701221	248490	296117	3701221	tRNA,transposase,protease	Bacillus_phage(25.0%)	47	NA	NA
WP_005015146.1|248490_249243_+|tRNA	leucyl/phenylalanyl-tRNA--protein transferase	tRNA	NA	NA	NA	NA
WP_005015148.1|249285_250005_+	arginyltransferase	NA	NA	NA	NA	NA
WP_005015150.1|250047_251103_+	quinone-dependent dihydroorotate dehydrogenase	NA	NA	NA	NA	NA
WP_101557770.1|252112_253232_+|transposase	IS3 family transposase	transposase	S5WIU1	Leptospira_phage	43.0	1.5e-55
WP_005015154.1|253792_254371_-	TIGR01841 family phasin	NA	NA	NA	NA	NA
WP_005012861.1|254513_255734_-|transposase	ISL3 family transposase	transposase	A4PE56	Ralstonia_virus	75.6	4.2e-184
WP_005015155.1|256038_257016_+	tripartite tricarboxylate transporter substrate binding protein BugD	NA	NA	NA	NA	NA
WP_005015156.1|257164_257995_-	IclR family transcriptional regulator	NA	NA	NA	NA	NA
WP_005015157.1|258108_258924_-	competence/damage-inducible protein A	NA	NA	NA	NA	NA
WP_005015162.1|258946_259801_-	EI24 domain-containing protein	NA	NA	NA	NA	NA
WP_005015163.1|259799_260183_+	thioredoxin family protein	NA	NA	NA	NA	NA
WP_005015164.1|260289_261663_-	DEAD/DEAH box helicase	NA	Q5GF26	Diachasmimorpha_longicaudata_entomopoxvirus	33.6	1.8e-50
WP_005015165.1|261734_262226_-	AzlD domain-containing protein	NA	NA	NA	NA	NA
WP_005015166.1|262225_262978_-	membrane protein	NA	NA	NA	NA	NA
WP_005015167.1|263325_263529_+	zinc-finger domain-containing protein	NA	NA	NA	NA	NA
WP_005015168.1|263558_263981_+	SnoaL-like domain-containing protein	NA	NA	NA	NA	NA
WP_005015169.1|263992_265090_+	alpha/beta fold hydrolase	NA	NA	NA	NA	NA
WP_005015170.1|265102_266572_-|protease	M48 family metalloprotease	protease	NA	NA	NA	NA
WP_005015171.1|266693_267533_+	UTP--glucose-1-phosphate uridylyltransferase GalU	NA	A0A127AW70	Bacillus_phage	46.2	1.6e-62
WP_005015172.1|267554_268412_-	cytochrome c oxidase assembly protein	NA	NA	NA	NA	NA
WP_005015173.1|268484_269603_-	porin	NA	NA	NA	NA	NA
WP_005015175.1|269589_270204_-	magnesium transporting ATPase P-type 1	NA	NA	NA	NA	NA
WP_101557744.1|270233_271354_-|transposase	IS3 family transposase	transposase	S5WIU1	Leptospira_phage	42.6	5.8e-55
WP_005015176.1|271397_272027_-	hypothetical protein	NA	NA	NA	NA	NA
WP_005015177.1|272184_273528_+	M24 family metallopeptidase	NA	NA	NA	NA	NA
WP_005015178.1|273536_273920_-	hypothetical protein	NA	NA	NA	NA	NA
WP_005015179.1|274079_275231_+	UbiH/UbiF/VisC/COQ6 family ubiquinone biosynthesis hydroxylase	NA	NA	NA	NA	NA
WP_005015180.1|275329_276280_+|transposase	IS481 family transposase	transposase	NA	NA	NA	NA
WP_005015181.1|276423_277449_+|tRNA	tRNA dihydrouridine synthase DusB	tRNA	NA	NA	NA	NA
WP_005015182.1|277489_277729_+	DNA-binding protein	NA	NA	NA	NA	NA
WP_005019849.1|277794_279384_+	bifunctional phosphoribosylaminoimidazolecarboxamide formyltransferase/IMP cyclohydrolase	NA	Q58MG4	Prochlorococcus_phage	46.9	4.3e-64
WP_005015184.1|279383_279929_+	crossover junction endodeoxyribonuclease RuvC	NA	A0A088FT24	Mycobacterium_phage	30.8	3.5e-05
WP_005015187.1|280012_280585_+	Holliday junction branch migration protein RuvA	NA	NA	NA	NA	NA
WP_005019851.1|280588_281356_-	hypothetical protein	NA	NA	NA	NA	NA
WP_005015190.1|281387_281723_-	hypothetical protein	NA	NA	NA	NA	NA
WP_005015191.1|281646_282714_+	Holliday junction branch migration DNA helicase RuvB	NA	A0A127AWE7	Bacillus_phage	24.5	2.1e-06
WP_005015192.1|282710_284531_-	DNA helicase RecQ	NA	A0A1V0SBK0	Catovirus	33.9	8.7e-77
WP_005015193.1|284646_285855_-	hypothetical protein	NA	NA	NA	NA	NA
WP_005015194.1|286088_286790_+	response regulator	NA	W8CYM9	Bacillus_phage	36.6	2.8e-31
WP_005015195.1|286802_288281_+	HAMP domain-containing histidine kinase	NA	NA	NA	NA	NA
WP_005015196.1|288296_289349_-	cytochrome d ubiquinol oxidase subunit II	NA	NA	NA	NA	NA
WP_025341192.1|289345_290683_-	cytochrome ubiquinol oxidase subunit I	NA	NA	NA	NA	NA
WP_005015199.1|290801_292562_+|tRNA	glutamine--tRNA ligase/YqeY domain fusion protein	tRNA	A0A222YZ70	Escherichia_phage	52.4	2.2e-170
WP_005015201.1|292747_293590_+	septum site-determining protein MinC	NA	NA	NA	NA	NA
WP_005015204.1|293683_294499_+	septum site-determining protein MinD	NA	NA	NA	NA	NA
WP_005015207.1|294502_294775_+	cell division topological specificity factor MinE	NA	NA	NA	NA	NA
WP_005012365.1|294896_296117_+|transposase	ISL3 family transposase	transposase	A4PE56	Ralstonia_virus	75.4	1.2e-183
>prophage 2
NZ_CP007159	Bordetella holmesii F627 chromosome, complete genome	3701221	558603	614450	3701221	tRNA,integrase,transposase	Ralstonia_virus(18.18%)	40	561458:561517	610045:610615
WP_005019978.1|558603_559383_+|tRNA	tRNA (guanosine(46)-N7)-methyltransferase TrmB	tRNA	NA	NA	NA	NA
WP_005015711.1|559405_560353_+	prolyl aminopeptidase	NA	NA	NA	NA	NA
WP_005015713.1|560354_560555_+	sulfur carrier protein ThiS	NA	NA	NA	NA	NA
WP_101557770.1|560889_562009_+|transposase	IS3 family transposase	transposase	S5WIU1	Leptospira_phage	43.0	1.5e-55
561458:561517	attL	GACCGAGCGCGTGGTTCGCCCAGCGGCAATCGCGCCGAATCAGAGTTGGTCAATGGACTT	NA	NA	NA	NA
WP_005015714.1|562330_563047_-	phosphoserine phosphatase SerB	NA	NA	NA	NA	NA
WP_005015715.1|563043_563937_-	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_005011985.1|564100_565321_-|transposase	ISL3 family transposase	transposase	A4PE56	Ralstonia_virus	75.4	1.6e-183
WP_005015716.1|565473_566556_+	ABC transporter ATP-binding protein	NA	G3M9Y6	Bacillus_virus	38.1	1.5e-31
WP_005015717.1|568235_569219_+	extracellular solute-binding protein	NA	NA	NA	NA	NA
WP_005015719.1|569281_570694_-	signal recognition particle protein	NA	NA	NA	NA	NA
WP_005015721.1|570811_571654_+	cytochrome c biogenesis protein CcsA	NA	NA	NA	NA	NA
WP_005015735.1|571932_572541_+	1,6-anhydro-N-acetylmuramyl-L-alanine amidase AmpD	NA	A0A1W6DX33	Sphingobium_phage	46.8	1.0e-05
WP_005015738.1|572556_573177_+	glutathione S-transferase	NA	NA	NA	NA	NA
WP_005015741.1|573242_573950_-	ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	28.3	1.2e-13
WP_005015743.1|573954_574677_-	ABC transporter ATP-binding protein	NA	A0A2R8FG22	Brazilian_cedratvirus	28.6	1.9e-11
WP_005015745.1|574663_574954_-	hypothetical protein	NA	NA	NA	NA	NA
WP_005015748.1|575029_576250_+|transposase	ISL3 family transposase	transposase	A4PE56	Ralstonia_virus	75.1	2.1e-183
WP_025341216.1|576974_577826_-	branched-chain amino acid ABC transporter permease	NA	NA	NA	NA	NA
WP_005015753.1|577877_579131_-	ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_005015755.1|579307_580096_-	putative hydro-lyase	NA	NA	NA	NA	NA
WP_005015757.1|580215_581130_-	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_005015758.1|581262_583155_-	molecular chaperone HtpG	NA	A0A1B1ISV4	uncultured_Mediterranean_phage	37.9	4.6e-121
WP_017685928.1|583340_584720_+	uracil-xanthine permease	NA	H9YQ34	environmental_Halophage	50.7	4.1e-26
WP_076879504.1|585164_585461_+|integrase	tyrosine-type recombinase/integrase	integrase	NA	NA	NA	NA
WP_005015774.1|589261_589864_-	DNA-3-methyladenine glycosylase I	NA	NA	NA	NA	NA
WP_005015778.1|589997_590456_+	YkgJ family cysteine cluster protein	NA	NA	NA	NA	NA
WP_005015780.1|590457_591057_-	iron transport sensor protein	NA	NA	NA	NA	NA
WP_005015783.1|591065_591875_-	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_005015786.1|591909_592764_+	sulfite exporter TauE/SafE family protein	NA	NA	NA	NA	NA
WP_005015790.1|592883_593471_+	HutD family protein	NA	NA	NA	NA	NA
WP_005015791.1|593467_594847_+	formimidoylglutamate deiminase	NA	NA	NA	NA	NA
WP_153566140.1|595351_595498_-	hypothetical protein	NA	NA	NA	NA	NA
WP_005015794.1|603169_604510_+	aminotransferase class I/II-fold pyridoxal phosphate-dependent enzyme	NA	G9E4Q1	Emiliania_huxleyi_virus	32.3	2.9e-45
WP_005015796.1|604523_605375_+	3-deoxy-8-phosphooctulonate synthase	NA	E3T537	Cafeteria_roenbergensis_virus	40.4	4.4e-47
WP_005015799.1|605386_606652_-	capsular biosynthesis protein	NA	NA	NA	NA	NA
WP_005015801.1|606713_608618_-	capsular polysaccharide biosynthesis protein	NA	NA	NA	NA	NA
WP_005015804.1|610593_611448_-	hypothetical protein	NA	NA	NA	NA	NA
610045:610615	attR	GACCGAGCGCGTGGTTCGCCCAGCGGCAATCGCGCCGAATCAGAGTTGGTCAATGGACTTTGTGGCCGACGGCCTAGCCTATGGCCGCCGATTCCGCTGTTTGACTATCGTCGATGACTACACTCGCGAATGCCTGGCCATCGAGGTCGATACGTCGTTGCCGGGACTGCGTGTTGCCATGGTGCTGCAACGGCTGGCGGAGATGCGTGGCCTGCCGCGATCTATTACCGTGGACAACGGGCCAGAGTTCGCCGGAAGAGCCTTGGACGCCTGGGCCTACCAAGCAGGCGTAAAGCTGTCGTTTATTCGGCCGGGTAAGCCGGTGGAGAACGCTTATATCGAAAGTTTCAACGGCAAGTTCCGCGACGAATGCCTTAACGAGCACTGGTTCTTGTCCCTGCGACAGGCTAAAAGCTTGATCGAAAACTGGCGAGTCGAGTACAACACCGATCGGCCTCACAGCGCGCTCGGATATTTAACGCCGGCGCAATTCGTGCAGGCTCATCAGAAAGAAGGTCTTTTACCCCTGGGCTCTATGTCGGTGCCGTACTAAATCTGGGGGCAGGTCAGC	NA	NA	NA	NA
WP_005015806.1|611440_612235_-	SDR family NAD(P)-dependent oxidoreductase	NA	NA	NA	NA	NA
WP_005015810.1|612450_613401_-|transposase	IS481-like element IS481 family transposase	transposase	NA	NA	NA	NA
WP_005015811.1|613499_614450_-|transposase	IS481-like element IS481 family transposase	transposase	NA	NA	NA	NA
>prophage 3
NZ_CP007159	Bordetella holmesii F627 chromosome, complete genome	3701221	999669	1065156	3701221	tRNA,transposase	Leptospira_phage(20.0%)	51	NA	NA
WP_005016594.1|999669_1000620_+|transposase	IS481-like element IS481 family transposase	transposase	NA	NA	NA	NA
WP_005016595.1|1000658_1001366_+	hypothetical protein	NA	NA	NA	NA	NA
WP_101557770.1|1001333_1002454_-|transposase	IS3 family transposase	transposase	S5WIU1	Leptospira_phage	43.0	1.5e-55
WP_005016598.1|1002511_1004020_-	nitrite/sulfite reductase	NA	NA	NA	NA	NA
WP_005016599.1|1004176_1005700_-	phospholipase D family protein	NA	NA	NA	NA	NA
WP_005016600.1|1005754_1006402_-	carbonic anhydrase	NA	NA	NA	NA	NA
WP_005016601.1|1006544_1006886_-	hypothetical protein	NA	NA	NA	NA	NA
WP_005016603.1|1007043_1007376_+	phosphate starvation-inducible protein	NA	NA	NA	NA	NA
WP_005016604.1|1007424_1008465_-	hypothetical protein	NA	NA	NA	NA	NA
WP_005016609.1|1008468_1009248_-	3-oxoadipate enol-lactonase	NA	NA	NA	NA	NA
WP_005016612.1|1009283_1009580_-	YciI family protein	NA	NA	NA	NA	NA
WP_005016613.1|1009594_1009870_-	muconolactone Delta-isomerase	NA	NA	NA	NA	NA
WP_005016616.1|1009937_1010582_-	CoA transferase subunit B	NA	NA	NA	NA	NA
WP_005016619.1|1010864_1011650_+	IclR family transcriptional regulator	NA	NA	NA	NA	NA
WP_005016620.1|1011687_1012413_-	SDR family oxidoreductase	NA	NA	NA	NA	NA
WP_005016622.1|1012426_1013767_-	short-chain fatty acid transporter	NA	NA	NA	NA	NA
WP_005016624.1|1013861_1014794_-	3-hydroxyacyl-CoA dehydrogenase family protein	NA	NA	NA	NA	NA
WP_005016626.1|1015022_1017794_-	S8 family serine peptidase	NA	NA	NA	NA	NA
WP_005016629.1|1018233_1021080_-	phosphoenolpyruvate carboxylase	NA	NA	NA	NA	NA
WP_005016630.1|1021226_1021940_+	7-cyano-7-deazaguanine synthase QueC	NA	A0A0A0RPC6	Escherichia_phage	41.4	1.6e-47
WP_005016651.1|1021952_1022495_-	N-acetyltransferase	NA	A0A2H4J136	uncultured_Caudovirales_phage	45.8	1.1e-27
WP_005016652.1|1022600_1023509_+	LysR family transcriptional regulator	NA	A0A2P0ZL89	Lactobacillus_phage	25.7	4.4e-05
WP_005016653.1|1023600_1025457_+	dihydroxy-acid dehydratase	NA	NA	NA	NA	NA
WP_076879512.1|1025640_1026681_-	LacI family DNA-binding transcriptional regulator	NA	C6ZCU4	Enterobacteria_phage	28.2	4.3e-20
WP_005016655.1|1026823_1027729_+	dihydrodipicolinate synthase family protein	NA	NA	NA	NA	NA
WP_005012067.1|1029416_1030367_+|transposase	IS481-like element IS481 family transposase	transposase	NA	NA	NA	NA
WP_005016656.1|1030423_1031191_-	trans-aconitate 2-methyltransferase	NA	NA	NA	NA	NA
WP_005016658.1|1031308_1031953_+	hypothetical protein	NA	NA	NA	NA	NA
WP_005016662.1|1032216_1032513_+	hypothetical protein	NA	NA	NA	NA	NA
WP_005016664.1|1032659_1033730_+	RNA methyltransferase	NA	NA	NA	NA	NA
WP_005016666.1|1034426_1035281_+	hypothetical protein	NA	NA	NA	NA	NA
WP_005016668.1|1035306_1036527_+|transposase	ISL3 family transposase	transposase	A4PE56	Ralstonia_virus	75.1	1.0e-182
WP_032826408.1|1036844_1038776_+	autotransporter outer membrane beta-barrel domain-containing protein	NA	NA	NA	NA	NA
WP_101557770.1|1039248_1040368_+|transposase	IS3 family transposase	transposase	S5WIU1	Leptospira_phage	43.0	1.5e-55
WP_076879513.1|1040371_1040620_+	DUF934 domain-containing protein	NA	NA	NA	NA	NA
WP_005016690.1|1040637_1041204_-	UbiX family flavin prenyltransferase	NA	NA	NA	NA	NA
WP_005016691.1|1041206_1041533_-	Grx4 family monothiol glutaredoxin	NA	NA	NA	NA	NA
WP_005016692.1|1041573_1042383_-	peptide chain release factor N(5)-glutamine methyltransferase	NA	NA	NA	NA	NA
WP_005016693.1|1042388_1043471_-	peptide chain release factor 1	NA	A0A0S4KWG0	Pseudomonas_phage	40.7	3.3e-07
WP_005016694.1|1043552_1044827_-|tRNA	glutamyl-tRNA reductase	tRNA	NA	NA	NA	NA
WP_005016695.1|1045472_1045952_+	sigma-70 family RNA polymerase sigma factor	NA	NA	NA	NA	NA
WP_005016696.1|1045935_1046970_+	DUF4880 domain-containing protein	NA	NA	NA	NA	NA
WP_005016697.1|1047074_1049594_+	TonB-dependent siderophore receptor	NA	NA	NA	NA	NA
WP_005016698.1|1050853_1053922_+	multidrug efflux RND transporter permease subunit	NA	NA	NA	NA	NA
WP_005016699.1|1056997_1057831_+	metallophosphoesterase	NA	A0A067XQN2	Caulobacter_phage	28.3	4.8e-22
WP_005016700.1|1057827_1059306_-	SulP family inorganic anion transporter	NA	A0A2H4J153	uncultured_Caudovirales_phage	63.8	1.1e-159
WP_025341254.1|1059752_1060898_+	muconate cycloisomerase	NA	NA	NA	NA	NA
WP_005016702.1|1060947_1061883_+	catechol 1,2-dioxygenase	NA	NA	NA	NA	NA
WP_005016703.1|1062013_1063312_+	MFS transporter	NA	NA	NA	NA	NA
WP_005016704.1|1063327_1064107_+	1,6-dihydroxycyclohexa-2,4-diene-1-carboxylate dehydrogenase	NA	NA	NA	NA	NA
WP_005016705.1|1064205_1065156_+|transposase	IS481 family transposase	transposase	NA	NA	NA	NA
>prophage 5
NZ_CP007159	Bordetella holmesii F627 chromosome, complete genome	3701221	1499074	1558677	3701221	transposase	Ralstonia_virus(27.27%)	53	NA	NA
WP_005011985.1|1499074_1500295_+|transposase	ISL3 family transposase	transposase	A4PE56	Ralstonia_virus	75.4	1.6e-183
WP_005017628.1|1500410_1501154_-	hypothetical protein	NA	NA	NA	NA	NA
WP_005017629.1|1501323_1502430_+	S-(hydroxymethyl)glutathione dehydrogenase/class III alcohol dehydrogenase	NA	A0A0K0KVL7	Prochlorococcus_phage	28.1	1.4e-32
WP_005017630.1|1502440_1503280_+	S-formylglutathione hydrolase	NA	NA	NA	NA	NA
WP_005017631.1|1503337_1504027_+	hypothetical protein	NA	NA	NA	NA	NA
WP_005017632.1|1504123_1504576_+	DUF302 domain-containing protein	NA	NA	NA	NA	NA
WP_005011985.1|1504579_1505800_-|transposase	ISL3 family transposase	transposase	A4PE56	Ralstonia_virus	75.4	1.6e-183
WP_005017633.1|1506023_1506911_+	RNA polymerase sigma factor RpoH	NA	A0A248SJA5	Salicola_phage	38.5	2.1e-39
WP_005017636.1|1507225_1508011_-	cAMP phosphodiesterase	NA	NA	NA	NA	NA
WP_005017639.1|1510853_1511630_-	DUF4743 domain-containing protein	NA	NA	NA	NA	NA
WP_101557770.1|1512122_1513242_+|transposase	IS3 family transposase	transposase	S5WIU1	Leptospira_phage	43.0	1.5e-55
WP_076879479.1|1513277_1513547_+	cytochrome c oxidase subunit II	NA	NA	NA	NA	NA
WP_005017649.1|1513518_1513869_+	cytochrome c	NA	NA	NA	NA	NA
WP_005017650.1|1513967_1514918_+|transposase	IS481 family transposase	transposase	NA	NA	NA	NA
WP_005017651.1|1515019_1516636_+	cytochrome c oxidase subunit I	NA	R9VX24	Flavobacterium_phage	38.2	1.5e-08
WP_005017652.1|1516701_1516926_+	DUF2970 domain-containing protein	NA	NA	NA	NA	NA
WP_005017653.1|1516959_1517835_+	cytochrome c oxidase subunit 3	NA	NA	NA	NA	NA
WP_005017654.1|1517887_1518088_-	twin transmembrane helix small protein	NA	NA	NA	NA	NA
WP_005017655.1|1518122_1518881_+	SURF1 family protein	NA	NA	NA	NA	NA
WP_005017656.1|1518793_1519480_+	hypothetical protein	NA	NA	NA	NA	NA
WP_025341295.1|1519484_1520498_+	heme A synthase	NA	NA	NA	NA	NA
WP_005017660.1|1520525_1521422_+	protoheme IX farnesyltransferase	NA	NA	NA	NA	NA
WP_005017663.1|1521445_1522054_+	SCO family protein	NA	NA	NA	NA	NA
WP_005017666.1|1522066_1522294_-	DUF3717 domain-containing protein	NA	NA	NA	NA	NA
WP_005017669.1|1523005_1523770_+	hypothetical protein	NA	NA	NA	NA	NA
WP_005017671.1|1523835_1525209_+	UDP-N-acetylglucosamine diphosphorylase/glucosamine-1-phosphate N-acetyltransferase	NA	A0A0N7G7I9	Chrysochromulina_ericina_virus	35.1	6.7e-29
WP_080601017.1|1525307_1526600_+	MFS transporter	NA	NA	NA	NA	NA
WP_005017677.1|1526691_1528014_+	UDP-glucose/GDP-mannose dehydrogenase family protein	NA	A0A127AXI2	Bacillus_phage	37.8	1.3e-74
WP_005017679.1|1528010_1529066_+	glycosyltransferase family 4 protein	NA	NA	NA	NA	NA
WP_005017681.1|1529066_1529588_-	Lrp/AsnC family transcriptional regulator	NA	NA	NA	NA	NA
WP_005017701.1|1529735_1531568_+	glutamine--fructose-6-phosphate transaminase (isomerizing)	NA	A7IW18	Paramecium_bursaria_Chlorella_virus	48.4	5.0e-157
WP_005017703.1|1531734_1531932_+	serum resistance protein BrkB	NA	NA	NA	NA	NA
WP_005017706.1|1534507_1534798_-	hypothetical protein	NA	NA	NA	NA	NA
WP_005017709.1|1534794_1536276_-	PepSY domain-containing protein	NA	NA	NA	NA	NA
WP_005017711.1|1536403_1537435_-	DUF4880 domain-containing protein	NA	NA	NA	NA	NA
WP_005017713.1|1537508_1538099_-	sigma-70 family RNA polymerase sigma factor	NA	NA	NA	NA	NA
WP_005017721.1|1538651_1539569_-	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_005017725.1|1539712_1540747_+	4-hydroxythreonine-4-phosphate dehydrogenase PdxA	NA	NA	NA	NA	NA
WP_005017728.1|1540776_1541949_+	L-rhamnonate dehydratase	NA	Q6A202	Oenococcus_phage	29.6	1.5e-34
WP_005017731.1|1541954_1542884_+	dihydrodipicolinate synthase family protein	NA	NA	NA	NA	NA
WP_005017735.1|1543108_1543948_+	tripartite tricarboxylate transporter substrate binding protein	NA	NA	NA	NA	NA
WP_005017737.1|1543944_1545408_+	sulfatase-like hydrolase/transferase	NA	NA	NA	NA	NA
WP_005017740.1|1545421_1546192_+	cytochrome b561 / ferric reductase transmembrane	NA	NA	NA	NA	NA
WP_005017743.1|1546205_1546685_+	SMP-30/gluconolactonase/LRE family protein	NA	NA	NA	NA	NA
WP_005011985.1|1547935_1549156_-|transposase	ISL3 family transposase	transposase	A4PE56	Ralstonia_virus	75.4	1.6e-183
WP_005017765.1|1549810_1551088_+	amidohydrolase family protein	NA	NA	NA	NA	NA
WP_005017766.1|1551142_1551709_-	cysteine dioxygenase type I	NA	NA	NA	NA	NA
WP_005017769.1|1551794_1552958_-	alpha-hydroxy-acid oxidizing protein	NA	NA	NA	NA	NA
WP_005017772.1|1553126_1553411_+	acylphosphatase	NA	NA	NA	NA	NA
WP_005017775.1|1553434_1554073_-	TetR/AcrR family transcriptional regulator	NA	NA	NA	NA	NA
WP_005017777.1|1554194_1555166_-	tripartite tricarboxylate transporter substrate binding protein	NA	NA	NA	NA	NA
WP_005017780.1|1556744_1557515_+	IclR family transcriptional regulator	NA	NA	NA	NA	NA
WP_005013747.1|1557726_1558677_+|transposase	IS481-like element IS481 family transposase	transposase	NA	NA	NA	NA
>prophage 6
NZ_CP007159	Bordetella holmesii F627 chromosome, complete genome	3701221	2414897	2522741	3701221	tRNA,transposase,protease	Ralstonia_virus(16.67%)	95	NA	NA
WP_005011985.1|2414897_2416118_-|transposase	ISL3 family transposase	transposase	A4PE56	Ralstonia_virus	75.4	1.6e-183
WP_005012602.1|2416205_2416796_+	DMT family transporter	NA	NA	NA	NA	NA
WP_161635719.1|2416792_2417095_+	DMT family transporter	NA	NA	NA	NA	NA
WP_005012606.1|2417146_2418136_+	quinone oxidoreductase	NA	NA	NA	NA	NA
WP_005012607.1|2418256_2419138_-|protease	protease HtpX	protease	NA	NA	NA	NA
WP_005019028.1|2419311_2420166_+	DMT family transporter	NA	NA	NA	NA	NA
WP_005012610.1|2420197_2421046_+	sulfurtransferase	NA	NA	NA	NA	NA
WP_005012613.1|2421173_2422394_+|transposase	ISL3 family transposase	transposase	A4PE56	Ralstonia_virus	74.9	1.1e-181
WP_005012619.1|2422412_2422979_-	HD domain-containing protein	NA	NA	NA	NA	NA
WP_005012620.1|2423176_2424328_-	aromatic ring-hydroxylating dioxygenase subunit alpha	NA	NA	NA	NA	NA
WP_005012623.1|2424466_2425471_-	acyltransferase family protein	NA	A0A0F6TJ51	Escherichia_coli_O157_typing_phage	25.9	3.9e-18
WP_005012624.1|2425627_2426599_-	tripartite tricarboxylate transporter substrate binding protein	NA	NA	NA	NA	NA
WP_005012626.1|2426677_2427466_+	IclR family transcriptional regulator	NA	NA	NA	NA	NA
WP_005012627.1|2427537_2427774_+	exodeoxyribonuclease VII small subunit	NA	NA	NA	NA	NA
WP_005012631.1|2427782_2428694_+	polyprenyl synthetase family protein	NA	NA	NA	NA	NA
WP_005012634.1|2428737_2430609_+	1-deoxy-D-xylulose-5-phosphate synthase	NA	NA	NA	NA	NA
WP_005012636.1|2430769_2431567_+	GTP cyclohydrolase I FolE2	NA	NA	NA	NA	NA
WP_005012637.1|2431798_2432173_+	30S ribosomal protein S6	NA	NA	NA	NA	NA
WP_005012639.1|2432249_2432573_+	primosomal replication protein N	NA	NA	NA	NA	NA
WP_005012641.1|2432656_2432929_+	30S ribosomal protein S18	NA	NA	NA	NA	NA
WP_005012642.1|2432943_2433399_+	50S ribosomal protein L9	NA	NA	NA	NA	NA
WP_005012643.1|2433520_2434357_+	hypothetical protein	NA	NA	NA	NA	NA
WP_005012644.1|2434353_2435727_+	replicative DNA helicase	NA	C7BGG1	Burkholderia_phage	57.7	1.1e-132
WP_005012650.1|2436041_2436992_+|transposase	IS481-like element IS481 family transposase	transposase	NA	NA	NA	NA
WP_005012655.1|2437896_2438874_-	4-hydroxythreonine-4-phosphate dehydrogenase PdxA	NA	NA	NA	NA	NA
WP_005012656.1|2438998_2440654_-	PhoH family protein	NA	A0A1L2CUJ9	Pectobacterium_phage	33.7	1.2e-69
WP_005012657.1|2440702_2441167_-	peroxiredoxin	NA	NA	NA	NA	NA
WP_005012658.1|2441163_2441625_-	Xcc1710-like domain-containing protein	NA	NA	NA	NA	NA
WP_005012659.1|2441850_2443038_+	alanine transaminase	NA	NA	NA	NA	NA
WP_005012660.1|2443034_2444339_+	homoserine dehydrogenase	NA	NA	NA	NA	NA
WP_005012661.1|2444335_2445745_+	threonine synthase	NA	NA	NA	NA	NA
WP_101557744.1|2445938_2447058_+|transposase	IS3 family transposase	transposase	S5WIU1	Leptospira_phage	42.6	5.8e-55
WP_005012662.1|2447193_2448213_-	class 1 fructose-bisphosphatase	NA	A0A1V0SKX4	Klosneuvirus	34.8	3.0e-50
WP_005012663.1|2448221_2450927_-	aminopeptidase N	NA	A0A0P0IY26	Acinetobacter_phage	25.1	6.8e-17
WP_005012664.1|2451066_2451720_+	DUF4136 domain-containing protein	NA	NA	NA	NA	NA
WP_005012666.1|2451782_2452145_-	H-NS histone family protein	NA	NA	NA	NA	NA
WP_005012668.1|2452711_2454172_+|protease	metalloprotease TldD	protease	NA	NA	NA	NA
WP_005012669.1|2454434_2455508_+	3-deoxy-7-phosphoheptulonate synthase AroG	NA	A0A2I6UFP9	Klebsiella_phage	46.4	7.9e-78
WP_005012670.1|2455592_2456813_+|transposase	ISL3 family transposase	transposase	A4PE56	Ralstonia_virus	75.1	3.5e-183
WP_101557770.1|2458570_2459691_-|transposase	IS3 family transposase	transposase	S5WIU1	Leptospira_phage	43.0	1.5e-55
WP_005012671.1|2459664_2461164_+	FAD-binding protein	NA	NA	NA	NA	NA
WP_005012673.1|2461177_2462281_+	glycolate oxidase subunit GlcE	NA	NA	NA	NA	NA
WP_005012675.1|2462285_2463536_+	glycolate oxidase subunit GlcF	NA	NA	NA	NA	NA
WP_005012676.1|2463532_2464978_-	NAD(P)(+) transhydrogenase (Re/Si-specific) subunit beta	NA	NA	NA	NA	NA
WP_005012678.1|2464974_2465289_-	NAD(P) transhydrogenase subunit alpha	NA	NA	NA	NA	NA
WP_101558026.1|2465290_2466331_-	NAD(P) transhydrogenase subunit alpha	NA	NA	NA	NA	NA
WP_005012682.1|2466590_2467811_+|transposase	ISL3 family transposase	transposase	A4PE56	Ralstonia_virus	75.6	5.5e-184
WP_005012685.1|2467910_2468777_-	N-formylglutamate amidohydrolase	NA	NA	NA	NA	NA
WP_005012688.1|2468837_2469818_-	tripartite tricarboxylate transporter substrate binding protein BugE	NA	NA	NA	NA	NA
WP_005012689.1|2469964_2470885_+	transcriptional regulator GcvA	NA	Q6JIH3	Burkholderia_virus	30.8	2.1e-26
WP_005012692.1|2470893_2472006_+|tRNA	tRNA 2-thiouridine(34) synthase MnmA	tRNA	NA	NA	NA	NA
WP_005012695.1|2472087_2472909_+	sulfite exporter TauE/SafE family protein	NA	NA	NA	NA	NA
WP_005012698.1|2472984_2473593_-	glutathione S-transferase	NA	NA	NA	NA	NA
WP_005012700.1|2473730_2475107_+	adenylosuccinate lyase	NA	A0A2H4UUU6	Bodo_saltans_virus	46.1	7.2e-108
WP_005012704.1|2475168_2475612_+	cytochrome c	NA	NA	NA	NA	NA
WP_080688213.1|2475678_2476335_-	cytochrome B	NA	NA	NA	NA	NA
WP_101557770.1|2476377_2477497_+|transposase	IS3 family transposase	transposase	S5WIU1	Leptospira_phage	43.0	1.5e-55
WP_005012709.1|2477666_2477948_-	hypothetical protein	NA	NA	NA	NA	NA
WP_005012711.1|2478658_2479447_+	DUF3053 family protein	NA	NA	NA	NA	NA
WP_005012713.1|2479443_2480550_+	AI-2E family transporter	NA	NA	NA	NA	NA
WP_005012715.1|2481224_2482583_-	diguanylate cyclase	NA	A0A127AWB9	Bacillus_phage	38.3	2.1e-19
WP_005012717.1|2482697_2482895_-	hypothetical protein	NA	NA	NA	NA	NA
WP_101557770.1|2482912_2484033_-|transposase	IS3 family transposase	transposase	S5WIU1	Leptospira_phage	43.0	1.5e-55
WP_076879487.1|2484126_2484681_+|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	43.7	1.3e-31
WP_005012730.1|2485268_2486585_-	ergothioneine biosynthesis protein EgtB	NA	NA	NA	NA	NA
WP_005019086.1|2486597_2487611_-	L-histidine N(alpha)-methyltransferase	NA	NA	NA	NA	NA
WP_005012745.1|2489188_2489488_+	hypothetical protein	NA	NA	NA	NA	NA
WP_005012747.1|2490848_2492507_-	FMN-binding glutamate synthase family protein	NA	NA	NA	NA	NA
WP_005012749.1|2492655_2493876_-	YeeE/YedE family protein	NA	NA	NA	NA	NA
WP_005012751.1|2493993_2495277_-	arsenic transporter	NA	A0A2H4J144	uncultured_Caudovirales_phage	68.4	4.6e-157
WP_005012753.1|2495280_2496222_-	AEC family transporter	NA	NA	NA	NA	NA
WP_005012755.1|2496331_2496790_+	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_026087875.1|2497170_2497791_+	DTW domain-containing protein	NA	NA	NA	NA	NA
WP_005012761.1|2498198_2500619_+	ribonuclease R	NA	Q0GXV6	Lactococcus_phage	32.1	3.9e-64
WP_005012762.1|2500726_2501464_+	23S rRNA (guanosine(2251)-2'-O)-methyltransferase RlmB	NA	NA	NA	NA	NA
WP_005019089.1|2501510_2502755_+	cystathionine gamma-synthase family protein	NA	A0A0B5JD48	Pandoravirus	27.1	1.3e-10
WP_005012769.1|2503077_2503350_+	HU family DNA-binding protein	NA	A4JWM7	Burkholderia_virus	56.2	4.2e-20
WP_005012771.1|2503933_2504662_+	energy transducer TonB	NA	NA	NA	NA	NA
WP_005012772.1|2504683_2505601_+	MotA/TolQ/ExbB proton channel family protein	NA	NA	NA	NA	NA
WP_005012775.1|2505600_2506110_+	biopolymer transporter ExbD	NA	NA	NA	NA	NA
WP_005012777.1|2506226_2506898_+	response regulator transcription factor	NA	NA	NA	NA	NA
WP_005012779.1|2507007_2508075_+	two-component sensor histidine kinase	NA	W8CYF6	Bacillus_phage	27.7	2.8e-14
WP_005012781.1|2508094_2509939_+	potassium transporter Kup	NA	A7K9V6	Acanthocystis_turfacea_chlorella_virus	30.0	5.9e-65
WP_005012784.1|2510075_2511263_+	hypothetical protein	NA	NA	NA	NA	NA
WP_005012786.1|2511563_2512349_+	acyltransferase	NA	NA	NA	NA	NA
WP_101557770.1|2512372_2513492_+|transposase	IS3 family transposase	transposase	S5WIU1	Leptospira_phage	43.0	1.5e-55
WP_005012789.1|2513596_2514934_-	argininosuccinate synthase	NA	A0A140XAJ5	Dickeya_phage	83.3	4.3e-57
WP_005012790.1|2515043_2515985_-	ornithine carbamoyltransferase	NA	M1HWF9	Paramecium_bursaria_Chlorella_virus	26.0	5.8e-16
WP_005012795.1|2516040_2517222_-	aspartate aminotransferase family protein	NA	A0A1V0SKB7	Klosneuvirus	28.4	2.1e-23
WP_005012796.1|2517380_2517671_+	DUF3579 domain-containing protein	NA	NA	NA	NA	NA
WP_005012797.1|2517717_2518386_-	2-hydroxyacid dehydrogenase	NA	A0A1J0F959	Only_Syngen_Nebraska_virus	26.8	8.9e-11
WP_005012798.1|2518382_2518670_-	D-isomer specific 2-hydroxyacid dehydrogenase	NA	NA	NA	NA	NA
WP_038543190.1|2519052_2519838_+	dihydrodipicolinate synthase family protein	NA	NA	NA	NA	NA
WP_005012801.1|2519870_2520605_+	FadR family transcriptional regulator	NA	NA	NA	NA	NA
WP_005011985.1|2521520_2522741_-|transposase	ISL3 family transposase	transposase	A4PE56	Ralstonia_virus	75.4	1.6e-183
>prophage 7
NZ_CP007159	Bordetella holmesii F627 chromosome, complete genome	3701221	2527528	2583934	3701221	tRNA,transposase,protease	Ralstonia_virus(23.08%)	45	NA	NA
WP_005012808.1|2527528_2528479_-|transposase	IS481-like element IS481 family transposase	transposase	NA	NA	NA	NA
WP_005012810.1|2528560_2529040_-	sensor protein	NA	NA	NA	NA	NA
WP_005012811.1|2530251_2531451_-|transposase	ISL3 family transposase	transposase	A4PE56	Ralstonia_virus	74.9	1.2e-178
WP_005012812.1|2531596_2531974_-	c-type cytochrome	NA	NA	NA	NA	NA
WP_005012813.1|2531997_2533779_-	GMC family oxidoreductase	NA	NA	NA	NA	NA
WP_005012814.1|2533787_2534525_-	gluconate 2-dehydrogenase subunit 3 family protein	NA	NA	NA	NA	NA
WP_005012815.1|2534809_2536369_-	murein biosynthesis integral membrane protein MurJ	NA	NA	NA	NA	NA
WP_005012817.1|2536428_2537187_-	3-hydroxyacyl-CoA dehydrogenase	NA	NA	NA	NA	NA
WP_005019095.1|2537283_2537940_-	adenylate kinase	NA	NA	NA	NA	NA
WP_005012820.1|2538093_2538858_-	3-deoxy-manno-octulosonate cytidylyltransferase	NA	NA	NA	NA	NA
WP_005012822.1|2538872_2539052_-	Trm112 family protein	NA	NA	NA	NA	NA
WP_005012823.1|2539077_2540112_-	tetraacyldisaccharide 4'-kinase	NA	NA	NA	NA	NA
WP_005012826.1|2540108_2540522_-	biopolymer transporter ExbD	NA	NA	NA	NA	NA
WP_005012827.1|2540518_2541103_-	MotA/TolQ/ExbB proton channel family protein	NA	NA	NA	NA	NA
WP_005012828.1|2541455_2542814_+	exodeoxyribonuclease VII large subunit	NA	A0A1V0SD82	Indivirus	33.6	1.0e-29
WP_005012829.1|2542907_2543486_+	superoxide dismutase	NA	NA	NA	NA	NA
WP_101557770.1|2543610_2544731_-|transposase	IS3 family transposase	transposase	S5WIU1	Leptospira_phage	43.0	1.5e-55
WP_080601032.1|2544803_2546060_+	chloride channel protein	NA	NA	NA	NA	NA
WP_005019101.1|2546163_2547369_+	3-oxoadipyl-CoA thiolase	NA	NA	NA	NA	NA
WP_005012833.1|2547432_2547882_-	DUF192 domain-containing protein	NA	A0A1B1IUW8	uncultured_Mediterranean_phage	42.2	6.8e-15
WP_005012834.1|2548014_2548260_-	cold-shock protein	NA	A0A2H4N7Y6	Lake_Baikal_phage	75.0	6.5e-20
WP_005012835.1|2548484_2548799_+|protease	ATP-dependent Clp protease adapter ClpS	protease	A0A1B1IT64	uncultured_Mediterranean_phage	43.9	8.4e-12
WP_005012838.1|2554052_2556158_+	penicillin-binding protein 1C	NA	NA	NA	NA	NA
WP_005012839.1|2556211_2558521_+|protease	ATP-dependent Clp protease ATP-binding subunit ClpA	protease	A0A223W0B1	Agrobacterium_phage	42.3	9.1e-164
WP_005012840.1|2559874_2561542_+	MCE family protein	NA	NA	NA	NA	NA
WP_005012841.1|2561544_2562210_+	membrane integrity-associated transporter subunit PqiC	NA	NA	NA	NA	NA
WP_005012843.1|2562342_2566149_+	trifunctional transcriptional regulator/proline dehydrogenase/L-glutamate gamma-semialdehyde dehydrogenase	NA	NA	NA	NA	NA
WP_005012844.1|2566374_2567520_+	branched-chain amino acid ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_005012847.1|2567638_2568568_+	branched-chain amino acid ABC transporter permease	NA	NA	NA	NA	NA
WP_005012848.1|2568564_2569641_+	inner-membrane translocator	NA	NA	NA	NA	NA
WP_005012850.1|2569637_2570444_+	ABC transporter ATP-binding protein	NA	A0A2H4PQG7	Staphylococcus_phage	23.9	7.2e-15
WP_005012851.1|2570440_2571172_+	ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	32.3	2.6e-16
WP_005012853.1|2571548_2572787_-	ammonium transporter	NA	H8ZJB2	Ostreococcus_tauri_virus	28.3	6.2e-26
WP_005012854.1|2572834_2573173_-	nitrogen regulatory protein P-II 1	NA	NA	NA	NA	NA
WP_005012067.1|2573420_2574371_-|transposase	IS481-like element IS481 family transposase	transposase	NA	NA	NA	NA
WP_005012855.1|2574689_2574872_+	hypothetical protein	NA	NA	NA	NA	NA
WP_005011985.1|2574937_2576158_+|transposase	ISL3 family transposase	transposase	A4PE56	Ralstonia_virus	75.4	1.6e-183
WP_005012861.1|2576251_2577472_+|transposase	ISL3 family transposase	transposase	A4PE56	Ralstonia_virus	75.6	4.2e-184
WP_005012863.1|2577531_2577795_+	accessory factor UbiK family protein	NA	NA	NA	NA	NA
WP_005012866.1|2577916_2579416_+	YifB family Mg chelatase-like AAA ATPase	NA	NA	NA	NA	NA
WP_131285595.1|2579463_2579739_-	hypothetical protein	NA	NA	NA	NA	NA
WP_005012868.1|2579836_2580034_+	50S ribosomal protein L35	NA	NA	NA	NA	NA
WP_005012869.1|2580049_2580409_+	50S ribosomal protein L20	NA	NA	NA	NA	NA
WP_005012870.1|2580481_2581504_+|tRNA	phenylalanine--tRNA ligase subunit alpha	tRNA	A0A2H4UW22	Bodo_saltans_virus	38.8	6.1e-27
WP_005012871.1|2581516_2583934_+|tRNA	phenylalanine--tRNA ligase subunit beta	tRNA	NA	NA	NA	NA
>prophage 9
NZ_CP007159	Bordetella holmesii F627 chromosome, complete genome	3701221	2972305	3012671	3701221	tRNA,integrase,transposase	Leptospira_phage(28.57%)	39	2964747:2964763	3009363:3009379
2964747:2964763	attL	CAGGCAGCCATCGGCCA	NA	NA	NA	NA
WP_101557770.1|2972305_2973425_+|transposase	IS3 family transposase	transposase	S5WIU1	Leptospira_phage	43.0	1.5e-55
WP_005013595.1|2974077_2974833_+	pilus assembly protein	NA	NA	NA	NA	NA
WP_005013596.1|2975009_2975804_+	type II secretion system F family protein	NA	NA	NA	NA	NA
WP_005013597.1|2975800_2976238_+	hypothetical protein	NA	NA	NA	NA	NA
WP_153566127.1|2976349_2976502_+	hypothetical protein	NA	NA	NA	NA	NA
WP_005013598.1|2976922_2977891_-	homoserine kinase	NA	NA	NA	NA	NA
WP_025341429.1|2978047_2979055_+|tRNA	tRNA dihydrouridine(20/20a) synthase DusA	tRNA	NA	NA	NA	NA
WP_017685693.1|2979112_2979571_-	CBS domain-containing protein	NA	NA	NA	NA	NA
WP_005013601.1|2979644_2980991_-	YihY family inner membrane protein	NA	NA	NA	NA	NA
WP_005013602.1|2981008_2981380_+	DUF2069 domain-containing protein	NA	NA	NA	NA	NA
WP_005013604.1|2981379_2982849_+	YdiU family protein	NA	A0A075BSJ0	Microcystis_phage	36.1	5.8e-47
WP_005013607.1|2983004_2983730_+	response regulator transcription factor	NA	NA	NA	NA	NA
WP_005013608.1|2983743_2986458_-	EAL domain-containing protein	NA	NA	NA	NA	NA
WP_005013609.1|2986709_2988074_+	EAL domain-containing protein	NA	NA	NA	NA	NA
WP_005013610.1|2988113_2989172_+	chorismate synthase	NA	A0A291AU41	Pandoravirus	43.7	4.9e-80
WP_005013611.1|2989199_2990018_+	M48 family metallopeptidase	NA	NA	NA	NA	NA
WP_005013612.1|2990055_2990334_-	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_005013614.1|2991597_2991897_-	hypothetical protein	NA	NA	NA	NA	NA
WP_005013615.1|2992466_2993870_+	3-isopropylmalate dehydratase large subunit	NA	NA	NA	NA	NA
WP_005013616.1|2993882_2994533_+	3-isopropylmalate dehydratase small subunit	NA	NA	NA	NA	NA
WP_005011985.1|2994674_2995895_+|transposase	ISL3 family transposase	transposase	A4PE56	Ralstonia_virus	75.4	1.6e-183
WP_005013617.1|2995925_2997002_+	3-isopropylmalate dehydrogenase	NA	NA	NA	NA	NA
WP_005013618.1|2997148_2998279_+	aspartate-semialdehyde dehydrogenase	NA	NA	NA	NA	NA
WP_005013619.1|2998465_3000091_+	membrane protein	NA	NA	NA	NA	NA
WP_005019353.1|3000097_3000913_+|tRNA	tRNA pseudouridine(38-40) synthase TruA	tRNA	NA	NA	NA	NA
WP_110097765.1|3000927_3001998_+	twin-arginine translocation signal domain-containing protein	NA	NA	NA	NA	NA
WP_005013621.1|3002049_3002709_+	phosphoribosylanthranilate isomerase	NA	NA	NA	NA	NA
WP_101557807.1|3003348_3004511_-|transposase	IS3 family transposase	transposase	U5P429	Shigella_phage	61.3	8.3e-97
WP_157933264.1|3004552_3004867_-|integrase,transposase	DDE-type integrase/transposase/recombinase	integrase,transposase	S5WIU1	Leptospira_phage	50.5	1.5e-24
WP_080687433.1|3004850_3005237_-|transposase	IS3 family transposase	transposase	NA	NA	NA	NA
WP_101557809.1|3005275_3005542_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_005013625.1|3005934_3006624_+	sulfite exporter TauE/SafE family protein	NA	NA	NA	NA	NA
WP_005013626.1|3006723_3006885_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017685992.1|3007035_3007200_-	hypothetical protein	NA	NA	NA	NA	NA
WP_005013627.1|3007326_3007563_-	hypothetical protein	NA	NA	NA	NA	NA
WP_005013628.1|3007752_3008001_-	hypothetical protein	NA	NA	NA	NA	NA
WP_005013629.1|3008113_3009484_+	oxygen-independent coproporphyrinogen III oxidase	NA	NA	NA	NA	NA
3009363:3009379	attR	TGGCCGATGGCTGCCTG	NA	NA	NA	NA
WP_005013631.1|3009484_3010225_-	response regulator transcription factor	NA	NA	NA	NA	NA
WP_005013632.1|3010718_3012671_+|tRNA	threonine--tRNA ligase	tRNA	A0A2K9L297	Tupanvirus	35.9	7.1e-125
>prophage 10
NZ_CP007159	Bordetella holmesii F627 chromosome, complete genome	3701221	3030913	3074840	3701221	tRNA,holin,transposase,integrase	Leptospira_phage(33.33%)	37	3073408:3073422	3079884:3079898
WP_005013656.1|3030913_3033775_-|tRNA	isoleucine--tRNA ligase	tRNA	A0A1V0SJ93	Klosneuvirus	25.4	1.0e-71
WP_005013657.1|3033764_3034730_-	bifunctional riboflavin kinase/FAD synthetase	NA	NA	NA	NA	NA
WP_005013658.1|3035486_3036962_+	S-adenosyl-l-methionine transferase	NA	NA	NA	NA	NA
WP_005013659.1|3036966_3037242_-	hypothetical protein	NA	NA	NA	NA	NA
WP_101557831.1|3037578_3038698_+|transposase	IS3 family transposase	transposase	S5WIU1	Leptospira_phage	43.0	1.2e-55
WP_161992024.1|3038572_3038821_+|transposase	transposase	transposase	A4PE56	Ralstonia_virus	94.1	1.9e-11
WP_005013660.1|3038999_3040208_+	stearoyl-CoA desaturase	NA	NA	NA	NA	NA
WP_005013661.1|3040204_3042487_+	UvrD-helicase domain-containing protein	NA	A7KV33	Bacillus_phage	36.2	2.5e-105
WP_005013662.1|3042497_3044879_-	TonB-dependent receptor plug domain-containing protein	NA	NA	NA	NA	NA
WP_005013663.1|3045142_3047050_-	ATP-binding cassette domain-containing protein	NA	A0A2K9L0W2	Tupanvirus	31.9	4.3e-66
WP_005013664.1|3047064_3047955_-	50S ribosomal protein L3 N(5)-glutamine methyltransferase	NA	NA	NA	NA	NA
WP_005013665.1|3047961_3049095_-	succinyl-diaminopimelate desuccinylase	NA	NA	NA	NA	NA
WP_005013666.1|3049094_3049916_-	2,3,4,5-tetrahydropyridine-2,6-dicarboxylate N-succinyltransferase	NA	NA	NA	NA	NA
WP_005013667.1|3049940_3051131_-	succinyldiaminopimelate transaminase	NA	NA	NA	NA	NA
WP_005013668.1|3051432_3051714_+	hypothetical protein	NA	NA	NA	NA	NA
WP_005013669.1|3051879_3052200_+	hypothetical protein	NA	NA	NA	NA	NA
WP_101557814.1|3052239_3053326_+|transposase	IS3 family transposase	transposase	S5WIU1	Leptospira_phage	37.5	2.0e-44
WP_005013671.1|3053522_3053783_+	hypothetical protein	NA	NA	NA	NA	NA
WP_005013542.1|3054275_3055046_-	AAA family ATPase	NA	A0A2L1IVB6	Escherichia_phage	56.6	2.8e-77
WP_025341421.1|3055042_3056053_-|transposase	IS21 family transposase	transposase	A0A2L1IVA1	Escherichia_phage	45.9	4.4e-78
WP_005013672.1|3056087_3056930_+|transposase	IS3 family transposase	transposase	S5WIU1	Leptospira_phage	46.0	1.3e-54
WP_005013673.1|3057392_3058178_-	exodeoxyribonuclease III	NA	NA	NA	NA	NA
WP_101557815.1|3059037_3060157_+|transposase	IS3 family transposase	transposase	S5WIU1	Leptospira_phage	42.6	7.5e-55
WP_005012353.1|3061223_3062228_-|transposase	ISL3 family transposase	transposase	A4PE56	Ralstonia_virus	60.8	4.4e-139
WP_005013675.1|3062303_3063116_+	type I phosphodiesterase/nucleotide pyrophosphatase 1	NA	NA	NA	NA	NA
WP_005013676.1|3063343_3065515_+|holin	phospholipase C, phosphocholine-specific	holin	NA	NA	NA	NA
WP_005013677.1|3065568_3066888_-	DHA2 family efflux MFS transporter permease subunit	NA	NA	NA	NA	NA
WP_005011985.1|3066976_3068197_+|transposase	ISL3 family transposase	transposase	A4PE56	Ralstonia_virus	75.4	1.6e-183
WP_005013678.1|3068415_3069276_+	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_005013679.1|3069272_3070496_-	MFS transporter	NA	NA	NA	NA	NA
WP_005013680.1|3070794_3071292_+	BON domain-containing protein	NA	NA	NA	NA	NA
WP_005013681.1|3071330_3072113_-	deaminated glutathione amidase	NA	NA	NA	NA	NA
WP_005013682.1|3072138_3072357_-	SlyX family protein	NA	NA	NA	NA	NA
WP_005019379.1|3072431_3072701_+	YunC family protein	NA	NA	NA	NA	NA
WP_005013684.1|3072920_3073385_+	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
3073408:3073422	attL	GCCGATGGCATCGGC	NA	NA	NA	NA
WP_005013685.1|3073458_3073740_-	peptidyl-prolyl cis-trans isomerase	NA	NA	NA	NA	NA
WP_005013686.1|3073856_3074840_-|integrase	site-specific integrase	integrase	NA	NA	NA	NA
3079884:3079898	attR	GCCGATGCCATCGGC	NA	NA	NA	NA
>prophage 11
NZ_CP007159	Bordetella holmesii F627 chromosome, complete genome	3701221	3100116	3141506	3701221	transposase	Ralstonia_virus(50.0%)	39	NA	NA
WP_005012067.1|3100116_3101067_+|transposase	IS481-like element IS481 family transposase	transposase	NA	NA	NA	NA
WP_005013708.1|3101063_3101579_-	hypothetical protein	NA	NA	NA	NA	NA
WP_005013710.1|3101936_3102557_+	SCO family protein	NA	NA	NA	NA	NA
WP_005013711.1|3102656_3102908_+	GlsB/YeaQ/YmgE family stress response membrane protein	NA	NA	NA	NA	NA
WP_005013712.1|3102995_3104474_-	AdeC/AdeK/OprM family multidrug efflux complex outer membrane factor	NA	NA	NA	NA	NA
WP_005013714.1|3104470_3107641_-	efflux RND transporter permease subunit	NA	NA	NA	NA	NA
WP_005013715.1|3107653_3108850_-	efflux RND transporter periplasmic adaptor subunit	NA	NA	NA	NA	NA
WP_005013717.1|3109038_3109971_+	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_005013718.1|3110038_3110770_-	rRNA pseudouridine synthase	NA	NA	NA	NA	NA
WP_005013719.1|3110835_3111471_+	chorismate lyase	NA	NA	NA	NA	NA
WP_005013720.1|3111456_3112635_-	MFS transporter	NA	NA	NA	NA	NA
WP_005013721.1|3112795_3113344_-	YaeQ family protein	NA	NA	NA	NA	NA
WP_005013722.1|3113424_3113784_+	LysE family transporter	NA	NA	NA	NA	NA
WP_005011985.1|3113831_3115052_+|transposase	ISL3 family transposase	transposase	A4PE56	Ralstonia_virus	75.4	1.6e-183
WP_005013723.1|3115127_3116249_-	ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_005013724.1|3116286_3117000_-	ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	30.1	1.7e-12
WP_005013725.1|3117010_3118231_-|transposase	ISL3 family transposase	transposase	A4PE56	Ralstonia_virus	75.1	4.6e-183
WP_005013726.1|3118313_3118868_-	ABC transporter ATP-binding protein	NA	NA	NA	NA	NA
WP_005013727.1|3119013_3119964_+|transposase	IS481-like element IS481 family transposase	transposase	NA	NA	NA	NA
WP_005013729.1|3119923_3120085_-	ATP-binding cassette domain-containing protein	NA	NA	NA	NA	NA
WP_005013730.1|3120125_3121052_-	branched-chain amino acid ABC transporter permease	NA	NA	NA	NA	NA
WP_005013731.1|3121065_3121938_-	branched-chain amino acid ABC transporter permease	NA	NA	NA	NA	NA
WP_005013732.1|3122100_3123048_+	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_026087954.1|3123386_3123968_+	PIN domain-containing protein	NA	NA	NA	NA	NA
WP_005012808.1|3124545_3125496_+|transposase	IS481-like element IS481 family transposase	transposase	NA	NA	NA	NA
WP_005013735.1|3125475_3126228_-	pyridoxal-phosphate dependent enzyme	NA	NA	NA	NA	NA
WP_005019399.1|3126240_3126972_-	hypothetical protein	NA	NA	NA	NA	NA
WP_005013736.1|3127128_3129294_-	polyribonucleotide nucleotidyltransferase	NA	NA	NA	NA	NA
WP_005013738.1|3129383_3129653_-	30S ribosomal protein S15	NA	NA	NA	NA	NA
WP_005019401.1|3129741_3129948_-	hypothetical protein	NA	NA	NA	NA	NA
WP_005013740.1|3129946_3130465_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003814004.1|3130483_3131263_-	CDP-diacylglycerol--serine O-phosphatidyltransferase	NA	NA	NA	NA	NA
WP_005013742.1|3131430_3132447_-	ketol-acid reductoisomerase	NA	NA	NA	NA	NA
WP_005013744.1|3132519_3133011_-	acetolactate synthase small subunit	NA	NA	NA	NA	NA
WP_003814007.1|3133021_3134737_-	acetolactate synthase 3 catalytic subunit	NA	A0A0P0CDR3	Ostreococcus_lucimarinus_virus	30.3	3.1e-60
WP_005012808.1|3135900_3136851_+|transposase	IS481-like element IS481 family transposase	transposase	NA	NA	NA	NA
WP_003814009.1|3138502_3139744_-	MFS transporter	NA	NA	NA	NA	NA
WP_003814010.1|3139755_3140529_-	peroxide stress protein YaaA	NA	NA	NA	NA	NA
WP_005013747.1|3140555_3141506_-|transposase	IS481-like element IS481 family transposase	transposase	NA	NA	NA	NA
>prophage 12
NZ_CP007159	Bordetella holmesii F627 chromosome, complete genome	3701221	3469680	3529803	3701221	tRNA,transposase,protease	Ralstonia_virus(23.08%)	59	NA	NA
WP_005014173.1|3469680_3470169_-|tRNA	tRNA adenosine(34) deaminase TadA	tRNA	S4VYT2	Pandoravirus	39.1	1.3e-06
WP_005014175.1|3470161_3471010_-	haloacid dehalogenase-like hydrolase	NA	NA	NA	NA	NA
WP_005014177.1|3471101_3471599_-	hypothetical protein	NA	NA	NA	NA	NA
WP_005014180.1|3471736_3472096_-	cation:proton antiporter	NA	NA	NA	NA	NA
WP_005014182.1|3472092_3472374_-	K+/H+ antiporter subunit F	NA	NA	NA	NA	NA
WP_005014183.1|3472373_3472856_-	Na+/H+ antiporter subunit E	NA	NA	NA	NA	NA
WP_005014185.1|3472857_3474486_-	monovalent cation/H+ antiporter subunit D	NA	NA	NA	NA	NA
WP_005014186.1|3474482_3474827_-	Na+/H+ antiporter subunit C	NA	NA	NA	NA	NA
WP_005019567.1|3474828_3477771_-	monovalent cation/H+ antiporter subunit A	NA	NA	NA	NA	NA
WP_005014197.1|3478216_3479188_+	tripartite tricarboxylate transporter substrate binding protein BugE	NA	NA	NA	NA	NA
WP_005014198.1|3479177_3480560_-	hypothetical protein	NA	NA	NA	NA	NA
WP_005012650.1|3480702_3481653_+|transposase	IS481-like element IS481 family transposase	transposase	NA	NA	NA	NA
WP_005014200.1|3481612_3482854_-	AAA family ATPase	NA	NA	NA	NA	NA
WP_005014202.1|3482850_3483972_-	DNA repair exonuclease	NA	NA	NA	NA	NA
WP_005014203.1|3485463_3485931_+	winged helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_005014210.1|3486001_3486652_+	DUF502 domain-containing protein	NA	NA	NA	NA	NA
WP_005014211.1|3486738_3487878_+	hypothetical protein	NA	NA	NA	NA	NA
WP_005012353.1|3488046_3489051_+|transposase	ISL3 family transposase	transposase	A4PE56	Ralstonia_virus	60.8	4.4e-139
WP_005014212.1|3489047_3490295_+	UDP-N-acetylglucosamine 1-carboxyvinyltransferase	NA	NA	NA	NA	NA
WP_005014213.1|3490647_3491514_+	DeoR/GlpR transcriptional regulator	NA	A0A077SK06	Escherichia_phage	30.0	5.9e-23
WP_005014215.1|3491473_3493078_+	glycerol-3-phosphate dehydrogenase/oxidase	NA	NA	NA	NA	NA
WP_005014221.1|3493089_3493776_-	type 1 glutamine amidotransferase domain-containing protein	NA	NA	NA	NA	NA
WP_005014223.1|3493772_3494813_-	NADP-dependent oxidoreductase	NA	NA	NA	NA	NA
WP_005014226.1|3494928_3495600_+	TetR/AcrR family transcriptional regulator	NA	NA	NA	NA	NA
WP_005014227.1|3495596_3496589_+	HlyD family efflux transporter periplasmic adaptor subunit	NA	NA	NA	NA	NA
WP_005014228.1|3496585_3497524_+	ABC transporter ATP-binding protein	NA	A0A2H4PQG7	Staphylococcus_phage	29.4	8.6e-20
WP_005014229.1|3497520_3498675_+	ABC transporter permease	NA	NA	NA	NA	NA
WP_005014231.1|3498683_3500135_+	efflux transporter outer membrane subunit	NA	NA	NA	NA	NA
WP_005014235.1|3500165_3500648_+|tRNA	YbaK/prolyl-tRNA synthetase associated domain-containing protein	tRNA	NA	NA	NA	NA
WP_005014237.1|3500649_3501543_+	NRDE family protein	NA	Q9J5E1	Fowlpox_virus	34.8	6.5e-25
WP_005014239.1|3501539_3501983_+	carboxypeptidase regulatory-like domain-containing protein	NA	NA	NA	NA	NA
WP_005014241.1|3501995_3502370_-	hypothetical protein	NA	NA	NA	NA	NA
WP_005014242.1|3502512_3502911_+	hypothetical protein	NA	NA	NA	NA	NA
WP_076879494.1|3503037_3503325_+|protease	CPBP family intramembrane metalloprotease	protease	NA	NA	NA	NA
WP_005014247.1|3503321_3503738_-|tRNA	aminoacyl-tRNA hydrolase	tRNA	NA	NA	NA	NA
WP_005014248.1|3503913_3504546_+	7-carboxy-7-deazaguanine synthase	NA	NA	NA	NA	NA
WP_005014250.1|3504574_3505021_+	6-carboxytetrahydropterin synthase QueD	NA	NA	NA	NA	NA
WP_005014253.1|3505307_3506459_+	alpha-hydroxy-acid oxidizing protein	NA	NA	NA	NA	NA
WP_005012353.1|3506572_3507577_+|transposase	ISL3 family transposase	transposase	A4PE56	Ralstonia_virus	60.8	4.4e-139
WP_005014256.1|3508560_3509268_+	translesion DNA synthesis-associated protein ImuA	NA	NA	NA	NA	NA
WP_032954285.1|3509200_3510652_+	DNA polymerase Y family protein	NA	NA	NA	NA	NA
WP_005014260.1|3510657_3513816_+	error-prone DNA polymerase	NA	M9MUV5	Rhodococcus_phage	29.0	1.2e-52
WP_005014263.1|3513828_3514350_-	DNA-deoxyinosine glycosylase	NA	NA	NA	NA	NA
WP_005014265.1|3514339_3515164_-	iron export ABC transporter permease subunit FetB	NA	NA	NA	NA	NA
WP_005014267.1|3515160_3515760_-	ATP-binding cassette domain-containing protein	NA	G9BWD6	Planktothrix_phage	30.9	7.0e-07
WP_005014269.1|3515868_3517725_-	phosphoenolpyruvate carboxykinase (GTP)	NA	NA	NA	NA	NA
WP_005012353.1|3517873_3518878_+|transposase	ISL3 family transposase	transposase	A4PE56	Ralstonia_virus	60.8	4.4e-139
WP_005014271.1|3519086_3520349_+	Zn-dependent hydrolase	NA	NA	NA	NA	NA
WP_005014274.1|3520353_3520689_+	thioredoxin family protein	NA	NA	NA	NA	NA
WP_005014275.1|3520685_3521615_+	DMT family transporter	NA	NA	NA	NA	NA
WP_005014277.1|3521619_3522333_-	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_005014278.1|3522436_3523894_+	PLP-dependent aminotransferase family protein	NA	A0A1X9I5H2	Streptococcus_phage	24.6	1.0e-11
WP_005014281.1|3523890_3524187_-	hypothetical protein	NA	NA	NA	NA	NA
WP_005014283.1|3524311_3525670_+	glutathione-disulfide reductase	NA	A0A2K5B2C5	Erysipelothrix_phage	26.5	1.4e-42
WP_005014285.1|3525770_3526571_-	DUF72 domain-containing protein	NA	NA	NA	NA	NA
WP_005014286.1|3526750_3527869_+	3-deoxy-7-phosphoheptulonate synthase	NA	A0A0B6VT43	Edwardsiella_phage	46.5	3.4e-79
WP_005014289.1|3527941_3528313_+	lipoprotein	NA	NA	NA	NA	NA
WP_005014290.1|3528319_3529171_-	hypothetical protein	NA	A0A1B1INV8	uncultured_Mediterranean_phage	28.9	4.0e-16
WP_005014292.1|3529191_3529803_-|protease	ATP-dependent protease La (LON) domain-containing protein	protease	NA	NA	NA	NA
>prophage 13
NZ_CP007159	Bordetella holmesii F627 chromosome, complete genome	3701221	3624926	3694756	3701221	tRNA,integrase,transposase,protease	Escherichia_phage(16.0%)	67	3656456:3656515	3677763:3678037
WP_101557807.1|3624926_3626089_-|transposase	IS3 family transposase	transposase	U5P429	Shigella_phage	61.3	8.3e-97
WP_005019669.1|3626201_3627170_+	hypothetical protein	NA	NA	NA	NA	NA
WP_005014478.1|3627166_3628087_+	amidohydrolase family protein	NA	NA	NA	NA	NA
WP_025341469.1|3628183_3632662_-	inverse autotransporter beta-barrel domain-containing protein	NA	NA	NA	NA	NA
WP_005014480.1|3633040_3637375_-	inverse autotransporter beta-barrel domain-containing protein	NA	NA	NA	NA	NA
WP_005014481.1|3638013_3638577_-	restriction endonuclease	NA	NA	NA	NA	NA
WP_005014483.1|3638588_3638834_-	RNA-binding S4 domain-containing protein	NA	NA	NA	NA	NA
WP_005014492.1|3638989_3639499_+	sigma-70 family RNA polymerase sigma factor	NA	NA	NA	NA	NA
WP_005014495.1|3639544_3640525_+	DUF4880 domain-containing protein	NA	NA	NA	NA	NA
WP_005014496.1|3640736_3643088_+	TonB-dependent siderophore receptor	NA	NA	NA	NA	NA
WP_005014497.1|3643134_3643965_-	TatD family hydrolase	NA	NA	NA	NA	NA
WP_005014500.1|3643961_3644651_-	ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	40.8	3.1e-35
WP_005014501.1|3644643_3645924_-	lipoprotein-releasing ABC transporter permease subunit	NA	NA	NA	NA	NA
WP_005014502.1|3646021_3646960_+	hypothetical protein	NA	NA	NA	NA	NA
WP_005014504.1|3646941_3648648_+	single-stranded-DNA-specific exonuclease RecJ	NA	A7KV88	Bacillus_phage	28.1	2.2e-50
WP_100225795.1|3648725_3649829_+	peptide chain release factor 2	NA	A0A0S4KWG0	Pseudomonas_phage	38.7	1.3e-06
WP_005014509.1|3649881_3650631_+	SDR family oxidoreductase	NA	NA	NA	NA	NA
WP_005014511.1|3650637_3652152_+|tRNA	lysine--tRNA ligase	tRNA	A0A1V0SAC0	Catovirus	36.9	8.8e-83
WP_005014513.1|3652164_3652452_+	hypothetical protein	NA	NA	NA	NA	NA
WP_005014514.1|3652472_3653360_-	methylglyoxal synthase	NA	NA	NA	NA	NA
WP_005014516.1|3653510_3654017_+	sigma-70 family RNA polymerase sigma factor	NA	NA	NA	NA	NA
WP_005014518.1|3654013_3654970_+	FecR family protein	NA	NA	NA	NA	NA
WP_005019683.1|3655157_3656504_+	TonB-dependent receptor	NA	NA	NA	NA	NA
3656456:3656515	attL	TGACCTGCCCCCAGATTTAGTACGGCACCGACATAGAGCCCAGGGGTAAAAGACCTTCTT	NA	NA	NA	NA
WP_025341181.1|3656471_3656702_-|transposase	transposase	transposase	S5WIU1	Leptospira_phage	56.9	2.2e-14
WP_101558036.1|3656731_3657295_-|integrase,transposase	DDE-type integrase/transposase/recombinase	integrase,transposase	NA	NA	NA	NA
WP_005013542.1|3657449_3658220_-	AAA family ATPase	NA	A0A2L1IVB6	Escherichia_phage	56.6	2.8e-77
WP_025341421.1|3658216_3659227_-|transposase	IS21 family transposase	transposase	A0A2L1IVA1	Escherichia_phage	45.9	4.4e-78
WP_076879495.1|3659541_3659988_+	TonB-dependent receptor	NA	NA	NA	NA	NA
WP_005014534.1|3660043_3660238_-	Fe-S cluster assembly protein IscX	NA	NA	NA	NA	NA
WP_005014536.1|3660239_3660581_-	ISC system 2Fe-2S type ferredoxin	NA	NA	NA	NA	NA
WP_005014539.1|3660590_3662453_-	Fe-S protein assembly chaperone HscA	NA	A0A0N9QXN8	Chrysochromulina_ericina_virus	38.7	1.4e-98
WP_005014543.1|3662492_3662999_-	Fe-S protein assembly co-chaperone HscB	NA	NA	NA	NA	NA
WP_005014544.1|3663002_3663326_-	iron-sulfur cluster assembly protein IscA	NA	A0A2H4N7N5	Lake_Baikal_phage	54.2	6.8e-25
WP_005014545.1|3663327_3663732_-	Fe-S cluster assembly scaffold IscU	NA	A0A218MKD1	uncultured_virus	79.8	1.9e-53
WP_005014546.1|3663768_3664980_-	IscS subfamily cysteine desulfurase	NA	NA	NA	NA	NA
WP_005014547.1|3665001_3665550_-	Fe-S cluster assembly transcriptional regulator IscR	NA	NA	NA	NA	NA
WP_005014551.1|3665774_3666266_-	low molecular weight phosphotyrosine protein phosphatase	NA	NA	NA	NA	NA
WP_017685984.1|3666480_3668511_-	excinuclease ABC subunit UvrB	NA	NA	NA	NA	NA
WP_005014553.1|3668585_3669788_+	aspartate/tyrosine/aromatic aminotransferase	NA	NA	NA	NA	NA
WP_005014555.1|3670291_3671266_-	transcriptional regulator GcvA	NA	NA	NA	NA	NA
WP_005014556.1|3672299_3672581_+	hypothetical protein	NA	NA	NA	NA	NA
WP_005014560.1|3672667_3672841_+	OsmC family protein	NA	NA	NA	NA	NA
WP_005014564.1|3672952_3673297_+	carboxymuconolactone decarboxylase family protein	NA	NA	NA	NA	NA
WP_005014566.1|3673368_3674037_+	anti-ECF sigma factor ChrR	NA	NA	NA	NA	NA
WP_005014572.1|3675452_3676496_+	alcohol dehydrogenase catalytic domain-containing protein	NA	A0A2K9L339	Tupanvirus	29.2	1.4e-31
WP_076879527.1|3676492_3676594_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_101557770.1|3676685_3677805_+|transposase	IS3 family transposase	transposase	S5WIU1	Leptospira_phage	43.0	1.5e-55
WP_005014574.1|3678055_3678709_+	transcriptional repressor LexA	NA	A0A2H4JG58	uncultured_Caudovirales_phage	50.7	1.9e-10
3677763:3678037	attR	AAGAAGGTCTTTTACCCCTGGGCTCTATGTCGGTGCCGTACTAAATCTGGGGGCAGGTCAACCACACCTTGGATGTGCCAATCCTGAGTATCTGACGATGGCTTTGCGCGAATCGACCGCAAACCAGGGGCCAGCCATGACCGCGTAGCGTCCCCTGCTTGCGGTAGTCGCTAGAAACGGGAGTATCGCCCTGGCATCGCTTGCATTTTTCAGCTGTGTCCCCCAGAATCACGCTGTATATACATACAGTCCGTGGTTCACACAAGCCCCGGGCC	NA	NA	NA	NA
WP_005011985.1|3678824_3680045_+|transposase	ISL3 family transposase	transposase	A4PE56	Ralstonia_virus	75.4	1.6e-183
WP_005014581.1|3680095_3682525_-	endopeptidase La	NA	A0A0R6PGP8	Moraxella_phage	51.4	3.6e-219
WP_005014587.1|3682690_3683989_-|protease	ATP-dependent Clp protease ATP-binding subunit ClpX	protease	G3M9Z9	Bacillus_virus	54.3	3.1e-129
WP_005014589.1|3684093_3684747_-	ATP-dependent Clp endopeptidase proteolytic subunit ClpP	NA	A0A223W000	Agrobacterium_phage	55.9	2.0e-55
WP_005014590.1|3684749_3686060_-	trigger factor	NA	NA	NA	NA	NA
WP_005014595.1|3686287_3686827_+	TIGR00645 family protein	NA	K4K6D8	Caulobacter_phage	35.8	4.3e-24
WP_101557809.1|3687305_3687572_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_135238891.1|3687610_3687976_+	hypothetical protein	NA	NA	NA	NA	NA
WP_025341473.1|3687857_3688868_+|transposase	IS21 family transposase	transposase	A0A2L1IVA1	Escherichia_phage	45.9	4.4e-78
WP_005013542.1|3688864_3689635_+	AAA family ATPase	NA	A0A2L1IVB6	Escherichia_phage	56.6	2.8e-77
WP_050427733.1|3689720_3690380_+|transposase	IS3 family transposase	transposase	S5WIU1	Leptospira_phage	46.5	6.2e-49
WP_005014598.1|3690347_3690839_-	DUF924 family protein	NA	NA	NA	NA	NA
WP_005014599.1|3690948_3691152_-	cold-shock protein	NA	A0A2H4N7Y6	Lake_Baikal_phage	66.7	6.6e-18
WP_005014600.1|3691469_3691790_-	hypothetical protein	NA	NA	NA	NA	NA
WP_005014605.1|3691773_3692109_-	hypothetical protein	NA	NA	NA	NA	NA
WP_005014607.1|3692163_3692376_-	hypothetical protein	NA	NA	NA	NA	NA
WP_005014610.1|3692451_3692790_+	IS66 family insertion sequence hypothetical protein	NA	A0A218MNG9	uncultured_virus	50.0	3.7e-05
WP_005014613.1|3692786_3693122_+	IS66 family insertion sequence element accessory protein TnpB	NA	NA	NA	NA	NA
WP_005014618.1|3693184_3694756_+|transposase	IS66 family transposase	transposase	A0A218MNE7	uncultured_virus	47.5	2.0e-125
