The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
NC_020300	Bartonella australis Aust/NH1, complete sequence	1596490	260223	284543	1596490	tail,integrase	Brucella_phage(10.53%)	37	249200:249214	289156:289170
249200:249214	attL	GAATTTTTGATGTTT	NA	NA	NA	NA
WP_041582888.1|260223_261267_-|integrase	tyrosine-type recombinase/integrase	integrase	I3UM24	Rhodobacter_phage	25.3	3.5e-14
WP_041582890.1|261289_261490_-	hypothetical protein	NA	NA	NA	NA	NA
WP_015397620.1|261493_262090_-	YqaJ viral recombinase family protein	NA	A0A0U2BXF3	Paracoccus_phage	47.5	4.1e-44
WP_015397621.1|262091_263186_-	AAA family ATPase	NA	A0A141GF08	Brucella_phage	64.5	1.6e-105
WP_015397622.1|263324_263837_-	hypothetical protein	NA	NA	NA	NA	NA
WP_015397623.1|263980_264328_-	hypothetical protein	NA	NA	NA	NA	NA
WP_015397624.1|264818_265502_+	S24/S26 family peptidase	NA	NA	NA	NA	NA
WP_015397625.1|265567_266212_-	helix-turn-helix domain-containing protein	NA	A0A076G6G1	Sinorhizobium_phage	60.0	1.5e-47
WP_015397626.1|266306_266597_+	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_015397627.1|266580_267336_+	polymer-forming cytoskeletal protein	NA	K4PXF0	Edwardsiella_phage	59.6	2.5e-14
WP_187287499.1|267338_267497_-	hypothetical protein	NA	NA	NA	NA	NA
WP_015397628.1|267558_267927_+	hypothetical protein	NA	NA	NA	NA	NA
WP_015397629.1|268039_268504_+	hypothetical protein	NA	NA	NA	NA	NA
WP_144050530.1|269025_269613_+	hypothetical protein	NA	NA	NA	NA	NA
WP_015397631.1|269799_270189_+	RusA family crossover junction endodeoxyribonuclease	NA	Q8HA93	Salmonella_phage	32.4	3.2e-05
WP_015397632.1|270169_270628_+	single-stranded DNA-binding protein	NA	A0A0K1LLZ9	Caulobacter_phage	64.9	6.9e-39
WP_015397633.1|270638_271235_+	hypothetical protein	NA	NA	NA	NA	NA
WP_015397634.1|271271_271595_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_015397635.1|271578_271959_-	type II toxin-antitoxin system RelE/ParE family toxin	NA	NA	NA	NA	NA
WP_015397636.1|272234_272495_+	type II toxin-antitoxin system RelB/DinJ family antitoxin	NA	NA	NA	NA	NA
WP_015397637.1|272496_272778_+	type II toxin-antitoxin system YafQ family toxin	NA	NA	NA	NA	NA
WP_015397639.1|273579_273855_+	type II toxin-antitoxin system RelE/ParE family toxin	NA	A0A0M3LQB1	Mannheimia_phage	40.2	2.0e-09
WP_015397640.1|273879_274206_+	HigA family addiction module antidote protein	NA	NA	NA	NA	NA
WP_015397641.1|274461_275853_+|tail	phage tail sheath subtilisin-like domain-containing protein	tail	A0A1W6JT53	Escherichia_phage	53.2	9.5e-132
WP_015397642.1|275852_276359_+|tail	phage major tail tube protein	tail	K4I1G5	Acidithiobacillus_phage	42.8	6.2e-33
WP_015397643.1|276361_276649_+|tail	phage tail assembly protein	tail	Q75QK8	Wolbachia_phage	33.8	3.1e-05
WP_144050554.1|276645_276759_+|tail	GpE family phage tail protein	tail	NA	NA	NA	NA
WP_015397644.1|276755_278639_+|tail	phage tail protein	tail	A0A0E3U2N9	Fusobacterium_phage	22.9	1.2e-09
WP_015397645.1|278644_279022_+|tail	phage tail protein	tail	V5YTC2	Pseudomonas_phage	48.4	1.7e-22
WP_015397646.1|279021_279246_+|tail	tail protein X	tail	Q8H9M2	Vibrio_phage	46.2	1.3e-06
WP_015397647.1|279242_280547_+	phage late control protein D	NA	K4HZC6	Acidithiobacillus_phage	38.6	4.1e-68
WP_015397648.1|280582_280861_-	HigA family addiction module antidote protein	NA	A0A0M3LPV0	Mannheimia_phage	48.8	5.5e-15
WP_015397649.1|280871_281150_-	type II toxin-antitoxin system RelE/ParE family toxin	NA	A0A2L1IV28	Escherichia_phage	45.7	8.7e-21
WP_015397650.1|281244_281922_+	lysozyme	NA	A0A141GEY9	Brucella_phage	54.2	1.0e-38
WP_015397651.1|281921_282140_+	hypothetical protein	NA	NA	NA	NA	NA
WP_015397652.1|282366_283671_+	class I SAM-dependent methyltransferase	NA	NA	NA	NA	NA
WP_015397653.1|283787_284543_+	phage regulatory protein/antirepressor Ant	NA	A0A2D1GNK4	Pseudomonas_phage	42.0	4.3e-38
289156:289170	attR	AAACATCAAAAATTC	NA	NA	NA	NA
>prophage 2
NC_020300	Bartonella australis Aust/NH1, complete sequence	1596490	558631	568193	1596490		Bacillus_phage(33.33%)	8	NA	NA
WP_041583192.1|558631_560515_+	ABC transporter ATP-binding protein/permease	NA	W8CYL7	Bacillus_phage	26.2	2.4e-37
WP_015397837.1|560630_561329_+	phosphatidylserine decarboxylase	NA	A0A1V0SDU9	Indivirus	27.1	9.9e-13
WP_015397838.1|561337_562177_+	CDP-diacylglycerol--serine O-phosphatidyltransferase	NA	NA	NA	NA	NA
WP_041583194.1|562255_563005_-	SDR family NAD(P)-dependent oxidoreductase	NA	Q06VL0	Trichoplusia_ni_ascovirus	28.3	4.3e-06
WP_015397840.1|563013_564504_-	amidophosphoribosyltransferase	NA	A0A0M3SGR2	Mollivirus	33.5	9.4e-45
WP_015397841.1|564583_565165_-	CvpA family protein	NA	NA	NA	NA	NA
WP_015397842.1|565289_566684_-	DNA repair protein RadA	NA	A0A1B1SGK4	Bacillus_phage	34.8	4.0e-05
WP_015397843.1|566690_568193_-	replicative DNA helicase	NA	A0A1P8VVQ6	Streptococcus_phage	36.0	6.7e-75
>prophage 3
NC_020300	Bartonella australis Aust/NH1, complete sequence	1596490	941362	951888	1596490	tRNA	uncultured_Mediterranean_phage(71.43%)	7	NA	NA
WP_041583241.1|941362_942481_-|tRNA	tRNA guanosine(34) transglycosylase Tgt	tRNA	A0A1B1IVQ4	uncultured_Mediterranean_phage	52.9	2.2e-99
WP_015398131.1|943334_943847_-	peptidylprolyl isomerase	NA	A0A1B1IVS0	uncultured_Mediterranean_phage	62.7	1.8e-48
WP_015398132.1|943865_944441_-	peptidylprolyl isomerase	NA	A0A1B1IVS0	uncultured_Mediterranean_phage	52.6	3.1e-44
WP_187287505.1|944430_944949_-	pantetheine-phosphate adenylyltransferase	NA	A0A1B1IVQ3	uncultured_Mediterranean_phage	34.6	1.1e-21
WP_015398134.1|944973_947754_-	DNA gyrase subunit A	NA	G3M9Z5	Bacillus_virus	34.1	1.8e-102
WP_015398135.1|948220_948754_-	single-stranded DNA-binding protein	NA	A0A0K1LLZ9	Caulobacter_phage	75.2	1.7e-44
WP_015398136.1|948978_951888_+	excinuclease ABC subunit UvrA	NA	A0A1B1IVR3	uncultured_Mediterranean_phage	61.7	0.0e+00
>prophage 4
NC_020300	Bartonella australis Aust/NH1, complete sequence	1596490	1127154	1229737	1596490	plate,terminase,tRNA,portal,capsid,tail,head,integrase	Acidithiobacillus_phage(23.68%)	105	1181014:1181040	1227524:1227550
WP_015398273.1|1127154_1127613_+|tRNA	tRNA (cytidine(34)-2'-O)-methyltransferase	tRNA	NA	NA	NA	NA
WP_015398274.1|1127692_1128946_-|tRNA	CCA tRNA nucleotidyltransferase	tRNA	A0A1B0V011	Roseobacter_phage	44.2	9.0e-49
WP_015398275.1|1129194_1130223_+	MoxR family ATPase	NA	NA	NA	NA	NA
WP_015398276.1|1130222_1131134_+	DUF58 domain-containing protein	NA	NA	NA	NA	NA
WP_015398277.1|1131130_1133932_+	DUF4159 domain-containing protein	NA	NA	NA	NA	NA
WP_015398278.1|1133928_1136025_+	hypothetical protein	NA	NA	NA	NA	NA
WP_144050542.1|1136087_1136306_-	hypothetical protein	NA	NA	NA	NA	NA
WP_144050543.1|1136403_1136625_-	hypothetical protein	NA	NA	NA	NA	NA
WP_015398280.1|1138040_1138952_-	cation transporter	NA	NA	NA	NA	NA
WP_015398281.1|1140109_1141339_-|tRNA	tRNA 2-thiouridine(34) synthase MnmA	tRNA	NA	NA	NA	NA
WP_015398282.1|1141628_1141904_+	DUF1153 domain-containing protein	NA	NA	NA	NA	NA
WP_015398283.1|1142031_1142418_-	hypothetical protein	NA	NA	NA	NA	NA
WP_015398284.1|1143009_1143711_+	response regulator transcription factor	NA	F4YXP8	Roseobacter_phage	48.9	1.6e-15
WP_015398285.1|1143894_1144527_-	hypothetical protein	NA	NA	NA	NA	NA
WP_015398286.1|1144748_1145345_+	DUF1134 domain-containing protein	NA	NA	NA	NA	NA
WP_015398287.1|1145370_1146042_+	hypothetical protein	NA	NA	NA	NA	NA
WP_015398288.1|1146814_1147933_-	DegT/DnrJ/EryC1/StrS aminotransferase family protein	NA	A0A2P1ELT3	Moumouvirus	34.4	4.6e-28
WP_015398289.1|1147969_1148938_-	Gfo/Idh/MocA family oxidoreductase	NA	NA	NA	NA	NA
WP_015398290.1|1149906_1150689_-	ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	30.9	2.7e-19
WP_015398291.1|1150675_1151560_-	ABC transporter ATP-binding protein	NA	NA	NA	NA	NA
WP_015398292.1|1151552_1152479_-	ABC transporter permease	NA	NA	NA	NA	NA
WP_015398293.1|1152481_1153555_-	ABC transporter permease	NA	NA	NA	NA	NA
WP_015398294.1|1153669_1155286_-	ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_015398295.1|1155637_1157263_-	ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_144050544.1|1157860_1157950_-	DNA-3-methyladenine glycosylase I	NA	NA	NA	NA	NA
WP_015398296.1|1158182_1159808_-	ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_015398297.1|1160447_1161074_-	DNA-3-methyladenine glycosylase I	NA	NA	NA	NA	NA
WP_015398298.1|1161051_1162482_-	exodeoxyribonuclease VII large subunit	NA	A0A1V0SIT1	Klosneuvirus	32.1	6.5e-35
WP_015398299.1|1163223_1164024_-	TIGR02186 family protein	NA	NA	NA	NA	NA
WP_015398300.1|1164026_1164947_-	sulfite exporter TauE/SafE family protein	NA	NA	NA	NA	NA
WP_041583030.1|1165542_1165794_+	hypothetical protein	NA	NA	NA	NA	NA
WP_015398301.1|1166279_1167026_+	electron transfer flavoprotein subunit beta/FixA family protein	NA	NA	NA	NA	NA
WP_015398302.1|1167075_1168005_+	electron transfer flavoprotein subunit alpha/FixB family protein	NA	NA	NA	NA	NA
WP_015398303.1|1168008_1169670_+	electron transfer flavoprotein-ubiquinone oxidoreductase	NA	NA	NA	NA	NA
WP_015398304.1|1169989_1170793_-	NAD(P)-binding domain-containing protein	NA	NA	NA	NA	NA
WP_015398305.1|1171257_1171626_-	YraN family protein	NA	NA	NA	NA	NA
WP_015398306.1|1171629_1172517_-	16S rRNA (cytidine(1402)-2'-O)-methyltransferase	NA	M1PLC5	Streptococcus_phage	40.7	1.9e-45
WP_015398307.1|1173314_1174409_-	Mrp/NBP35 family ATP-binding protein	NA	NA	NA	NA	NA
WP_024864273.1|1174898_1175033_+	50S ribosomal protein L34	NA	NA	NA	NA	NA
WP_015398308.1|1175139_1175508_+	ribonuclease P protein component	NA	NA	NA	NA	NA
WP_015398309.1|1175533_1177372_+	membrane protein insertase YidC	NA	NA	NA	NA	NA
WP_015398310.1|1177368_1178016_+	YihA family ribosome biogenesis GTP-binding protein	NA	NA	NA	NA	NA
WP_015398311.1|1178146_1178839_+	glutathione S-transferase family protein	NA	NA	NA	NA	NA
WP_015398312.1|1179370_1180177_+	4-hydroxy-tetrahydrodipicolinate reductase	NA	NA	NA	NA	NA
WP_015398313.1|1180213_1180834_+	2,3-bisphosphoglycerate-dependent phosphoglycerate mutase	NA	NA	NA	NA	NA
1181014:1181040	attL	CCTCTTCTGGGCACCAAAGCGCTTTTT	NA	NA	NA	NA
WP_015398315.1|1181511_1182018_+	hypothetical protein	NA	NA	NA	NA	NA
WP_015398316.1|1182135_1182348_-	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_015398317.1|1182427_1183732_-	class I SAM-dependent methyltransferase	NA	NA	NA	NA	NA
WP_144050545.1|1184047_1184338_-	hypothetical protein	NA	NA	NA	NA	NA
WP_015398318.1|1184334_1185078_-	phage antirepressor Ant	NA	Q7Y5W2	Haemophilus_phage	47.1	8.2e-50
WP_015398319.1|1186036_1186600_-	hypothetical protein	NA	NA	NA	NA	NA
WP_015398320.1|1186826_1187045_-	hypothetical protein	NA	NA	NA	NA	NA
WP_015398321.1|1187044_1187722_-	lysozyme	NA	A0A141GEY9	Brucella_phage	53.5	5.0e-38
WP_015398322.1|1187780_1189085_-	phage late control protein D	NA	K4HZC6	Acidithiobacillus_phage	38.3	5.3e-68
WP_015397646.1|1189081_1189306_-|tail	tail protein X	tail	Q8H9M2	Vibrio_phage	46.2	1.3e-06
WP_015397645.1|1189305_1189683_-|tail	phage tail protein	tail	V5YTC2	Pseudomonas_phage	48.4	1.7e-22
WP_015398323.1|1189688_1191572_-|tail	phage tail tape measure protein	tail	A0A0E3U2N9	Fusobacterium_phage	22.9	1.2e-09
WP_144050554.1|1191568_1191682_-|tail	GpE family phage tail protein	tail	NA	NA	NA	NA
WP_015397643.1|1191678_1191966_-|tail	phage tail assembly protein	tail	Q75QK8	Wolbachia_phage	33.8	3.1e-05
WP_015398324.1|1191968_1192475_-|tail	phage major tail tube protein	tail	K4I1G5	Acidithiobacillus_phage	42.8	6.2e-33
WP_015398325.1|1192474_1193866_-|tail	phage tail sheath subtilisin-like domain-containing protein	tail	D5LGY7	Escherichia_phage	54.3	2.9e-133
WP_015398326.1|1194121_1194448_-	HigA family addiction module antidote protein	NA	NA	NA	NA	NA
WP_015398327.1|1194472_1194748_-	type II toxin-antitoxin system RelE/ParE family toxin	NA	A0A0M3LQB1	Mannheimia_phage	39.1	2.6e-09
WP_015398328.1|1194930_1195851_-|tail	tail fiber protein	tail	A0A291LA10	Bordetella_phage	31.6	3.7e-15
WP_015398329.1|1195864_1199017_-	DUF4815 domain-containing protein	NA	K4ICQ5	Acidithiobacillus_phage	34.3	8.6e-157
WP_015398330.1|1199018_1200128_-	phage protein	NA	K4I1F8	Acidithiobacillus_phage	37.3	4.1e-21
WP_015398331.1|1200127_1200955_-|plate	baseplate J/gp47 family protein	plate	A0A219VH98	Ochrobactrum_phage	36.4	5.0e-40
WP_041583040.1|1200951_1201293_-	GPW/gp25 family protein	NA	Q75QM0	Wolbachia_phage	56.9	2.5e-30
WP_015398333.1|1201289_1201979_-|plate	phage baseplate assembly protein V	plate	K4HZZ9	Acidithiobacillus_phage	34.9	4.4e-21
WP_015398334.1|1201971_1202499_-	hypothetical protein	NA	NA	NA	NA	NA
WP_015398335.1|1202476_1202845_-	hypothetical protein	NA	NA	NA	NA	NA
WP_015398336.1|1202846_1203923_-|capsid	major capsid protein	capsid	A0A0A8ILA9	Aurantimonas_phage	35.8	1.5e-55
WP_015398337.1|1203935_1204304_-|head	head decoration protein	head	A0A0A8IL52	Aurantimonas_phage	43.5	1.4e-10
WP_083878144.1|1204300_1204672_-	hypothetical protein	NA	NA	NA	NA	NA
WP_015398338.1|1204563_1205658_-	S49 family peptidase	NA	K4HZZ6	Acidithiobacillus_phage	47.0	1.7e-64
WP_015398339.1|1205647_1207189_-|portal	phage portal protein	portal	K4I1F2	Acidithiobacillus_phage	42.6	2.0e-98
WP_015398340.1|1207188_1207437_-	hypothetical protein	NA	NA	NA	NA	NA
WP_015398341.1|1207445_1209371_-|terminase	phage terminase large subunit family protein	terminase	K4I3Y9	Acidithiobacillus_phage	54.1	6.0e-169
WP_015398342.1|1209415_1209967_-	hypothetical protein	NA	NA	NA	NA	NA
WP_015398343.1|1210360_1210939_-	hypothetical protein	NA	A0A0A8IL87	Aurantimonas_phage	26.5	1.0e-07
WP_015398344.1|1210942_1211254_-	hypothetical protein	NA	NA	NA	NA	NA
WP_083878126.1|1211611_1212037_-	type II toxin-antitoxin system VapC family toxin	NA	NA	NA	NA	NA
WP_041583042.1|1212033_1212300_-	hypothetical protein	NA	NA	NA	NA	NA
WP_015398346.1|1212357_1212981_-	hypothetical protein	NA	NA	NA	NA	NA
WP_015398347.1|1212991_1213450_-	single-stranded DNA-binding protein	NA	A0A0K1LLZ9	Caulobacter_phage	65.8	5.3e-39
WP_015398348.1|1213430_1213820_-	RusA family crossover junction endodeoxyribonuclease	NA	Q8HA93	Salmonella_phage	32.4	3.2e-05
WP_144050546.1|1214006_1214330_-	hypothetical protein	NA	NA	NA	NA	NA
WP_015398350.1|1214367_1215486_-	hypothetical protein	NA	NA	NA	NA	NA
WP_015398351.1|1215475_1215961_-	phage related protein	NA	K4ICN3	Acidithiobacillus_phage	59.5	5.6e-47
WP_015398353.1|1216837_1217332_-	hypothetical protein	NA	NA	NA	NA	NA
WP_041583048.1|1217523_1217805_-	hypothetical protein	NA	NA	NA	NA	NA
WP_015398354.1|1217779_1218100_-	hypothetical protein	NA	A0A1B0T6N5	Pelagibaca_phage	42.3	2.7e-05
WP_015398355.1|1218191_1218875_+	S24/S26 family peptidase	NA	NA	NA	NA	NA
WP_015398356.1|1218991_1219690_-	XRE family transcriptional regulator	NA	A0A2H4J5K1	uncultured_Caudovirales_phage	25.7	5.8e-05
WP_015398357.1|1220125_1220506_+	hypothetical protein	NA	NA	NA	NA	NA
WP_041583052.1|1220649_1220874_+	hypothetical protein	NA	NA	NA	NA	NA
WP_015398358.1|1220870_1221380_+	hypothetical protein	NA	K4PXF0	Edwardsiella_phage	54.2	2.3e-11
WP_015398359.1|1221398_1222493_+	AAA family ATPase	NA	A0A141GF08	Brucella_phage	64.5	1.4e-106
WP_015398360.1|1222494_1223091_+	YqaJ viral recombinase family protein	NA	A0A0U2BXF3	Paracoccus_phage	48.5	4.9e-45
WP_015398361.1|1223094_1224087_+|integrase	tyrosine-type recombinase/integrase	integrase	A0A0F7L5T4	uncultured_marine_virus	27.3	5.5e-25
WP_041583054.1|1225185_1226403_-	MFS transporter	NA	NA	NA	NA	NA
WP_051039103.1|1226873_1227215_-	hypothetical protein	NA	NA	NA	NA	NA
WP_187287491.1|1227999_1228158_-	hypothetical protein	NA	NA	NA	NA	NA
1227524:1227550	attR	CCTCTTCTGGGCACCAAAGCGCTTTTT	NA	NA	NA	NA
WP_041583060.1|1228261_1228507_-	hypothetical protein	NA	NA	NA	NA	NA
WP_015398364.1|1228702_1229737_-|capsid	phage capsid protein	capsid	G9L6C5	Escherichia_phage	48.8	1.2e-83
>prophage 5
NC_020300	Bartonella australis Aust/NH1, complete sequence	1596490	1370721	1417742	1596490	portal,capsid,tail,terminase,protease	Pseudomonas_phage(14.29%)	45	NA	NA
WP_015398457.1|1370721_1371693_-|tail	tail fiber protein	tail	D5LGZ0	Escherichia_phage	40.5	7.8e-24
WP_015398458.1|1371689_1372802_-|tail	tail fiber domain-containing protein	tail	NA	NA	NA	NA
WP_015398459.1|1372798_1373257_-	hypothetical protein	NA	NA	NA	NA	NA
WP_015398460.1|1373313_1374777_-	hypothetical protein	NA	D6PEY0	uncultured_phage	26.5	6.2e-41
WP_015398461.1|1374777_1375476_-	hypothetical protein	NA	NA	NA	NA	NA
WP_015398463.1|1375917_1377036_-|capsid	N4-gp56 family major capsid protein	capsid	H2DE40	Erwinia_phage	31.4	5.8e-39
WP_015398464.1|1377178_1378018_-	hypothetical protein	NA	NA	NA	NA	NA
WP_015398465.1|1378066_1379929_-|portal	phage portal protein	portal	I6NV36	Burkholderia_virus	22.8	3.1e-29
WP_041583310.1|1379928_1381254_-|terminase	terminase	terminase	A0A088F6U9	Sulfitobacter_phage	54.8	4.0e-140
WP_015398467.1|1382070_1382400_-	hypothetical protein	NA	NA	NA	NA	NA
WP_015398468.1|1382828_1385468_-	ATP-dependent chaperone ClpB	NA	A0A2I7SAX5	Vibrio_phage	34.9	1.1e-120
WP_015398469.1|1386021_1386264_-	DNA gyrase inhibitor YacG	NA	NA	NA	NA	NA
WP_015398470.1|1386293_1386935_-	septum formation protein Maf	NA	NA	NA	NA	NA
WP_004856585.1|1387208_1387427_-	translation initiation factor IF-1	NA	NA	NA	NA	NA
WP_015398471.1|1387782_1388280_+	5-(carboxyamino)imidazole ribonucleotide mutase	NA	A0A2P0VNU7	Tetraselmis_virus	37.7	4.4e-15
WP_051039108.1|1388248_1389382_+	5-(carboxyamino)imidazole ribonucleotide synthase	NA	NA	NA	NA	NA
WP_041583312.1|1389825_1389951_+	50S ribosomal protein L36	NA	NA	NA	NA	NA
WP_015398473.1|1390090_1390861_+	hypothetical protein	NA	NA	NA	NA	NA
WP_015398474.1|1391451_1392060_+	5-formyltetrahydrofolate cyclo-ligase	NA	NA	NA	NA	NA
WP_015398475.1|1392078_1392903_+	TIGR00282 family metallophosphoesterase	NA	NA	NA	NA	NA
WP_015398476.1|1393145_1394441_-	UDP-N-acetylglucosamine 1-carboxyvinyltransferase	NA	NA	NA	NA	NA
WP_015398477.1|1394747_1394891_-	hypothetical protein	NA	NA	NA	NA	NA
WP_015398478.1|1395224_1395860_-	YqaJ viral recombinase family protein	NA	A0A1B0VMB3	Pseudomonas_phage	43.0	1.2e-36
WP_015398480.1|1396314_1396704_-	hypothetical protein	NA	NA	NA	NA	NA
WP_015398481.1|1397012_1397330_-	hypothetical protein	NA	A0A2L0V128	Agrobacterium_phage	47.4	4.6e-18
WP_015398482.1|1397834_1398893_+	DUF1376 domain-containing protein	NA	A0A076GD06	Sinorhizobium_phage	40.7	1.2e-17
WP_015398483.1|1398943_1400785_+	toprim domain-containing protein	NA	K4NWL6	Pseudomonas_phage	38.8	5.8e-121
WP_015398484.1|1400921_1401500_+	hypothetical protein	NA	NA	NA	NA	NA
WP_015398485.1|1401934_1402240_+	hypothetical protein	NA	NA	NA	NA	NA
WP_015398486.1|1402388_1402544_-	hypothetical protein	NA	NA	NA	NA	NA
WP_015398487.1|1402540_1402696_-	hypothetical protein	NA	NA	NA	NA	NA
WP_015398488.1|1403412_1403709_+	hypothetical protein	NA	NA	NA	NA	NA
WP_015398491.1|1405232_1405580_+	hypothetical protein	NA	NA	NA	NA	NA
WP_015398492.1|1406117_1406471_+	hypothetical protein	NA	NA	NA	NA	NA
WP_015398493.1|1406580_1406877_+	hypothetical protein	NA	NA	NA	NA	NA
WP_015398495.1|1408085_1408697_+	DedA family protein	NA	NA	NA	NA	NA
WP_015398496.1|1408730_1409303_+	disulfide bond formation protein B	NA	NA	NA	NA	NA
WP_015398497.1|1409439_1410261_+	hypothetical protein	NA	NA	NA	NA	NA
WP_015398498.1|1410431_1410992_+	dUTP diphosphatase	NA	K4JSC8	Caulobacter_phage	53.7	4.3e-35
WP_015398499.1|1411143_1411611_-	biopolymer transporter ExbD	NA	NA	NA	NA	NA
WP_015398500.1|1411594_1412470_-	MotA/TolQ/ExbB proton channel family protein	NA	NA	NA	NA	NA
WP_015398501.1|1412872_1413208_+	DUF883 family protein	NA	NA	NA	NA	NA
WP_015398502.1|1413210_1413648_+	hypothetical protein	NA	NA	NA	NA	NA
WP_041583320.1|1413921_1415271_-	phosphoglucosamine mutase	NA	A0A127AWJ1	Bacillus_phage	24.1	1.0e-18
WP_015398504.1|1415687_1417742_-|protease	ATP-dependent zinc metalloprotease FtsH	protease	A0A0P0CCN8	Ostreococcus_mediterraneus_virus	41.5	1.6e-111
