The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
NC_020895	Streptomyces hygroscopicus subsp. jinggangensis TL01, complete sequence	9840102	10631	68094	9840102	integrase,transposase	Shigella_phage(16.67%)	51	4355:4373	22499:22517
4355:4373	attL	CAAGCTCACCCAGGAGCAG	NA	NA	NA	NA
WP_078611907.1|10631_12227_-|integrase,transposase	DDE-type integrase/transposase/recombinase	integrase,transposase	NA	NA	NA	NA
WP_041667344.1|12391_13669_-	ATP-binding protein	NA	NA	NA	NA	NA
WP_014668663.1|13938_14067_+	hypothetical protein	NA	NA	NA	NA	NA
WP_014668664.1|14129_16040_-	AAA family ATPase	NA	NA	NA	NA	NA
WP_148282008.1|16095_16329_-	hypothetical protein	NA	NA	NA	NA	NA
WP_014668665.1|16435_16774_+	hypothetical protein	NA	NA	NA	NA	NA
WP_041664657.1|18373_19342_+	SDR family NAD(P)-dependent oxidoreductase	NA	NA	NA	NA	NA
WP_014668669.1|20339_20759_-	hypothetical protein	NA	NA	NA	NA	NA
WP_015493094.1|20761_21775_-	hypothetical protein	NA	NA	NA	NA	NA
WP_148282009.1|22508_23000_+	hypothetical protein	NA	NA	NA	NA	NA
22499:22517	attR	CTGCTCCTGGGTGAGCTTG	NA	NA	NA	NA
WP_086011463.1|23371_24552_-|transposase	IS3 family transposase	transposase	U5P429	Shigella_phage	33.5	1.8e-30
WP_041664660.1|24905_25382_-	hypothetical protein	NA	NA	NA	NA	NA
WP_014668672.1|26112_27273_+	hypothetical protein	NA	NA	NA	NA	NA
WP_014668673.1|27838_28360_-	winged helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_175251995.1|28528_29614_-	alkene reductase	NA	NA	NA	NA	NA
WP_014668676.1|29871_30438_-	TetR/AcrR family transcriptional regulator	NA	NA	NA	NA	NA
WP_041664661.1|30978_32262_+	ParA family protein	NA	NA	NA	NA	NA
WP_041664662.1|32258_33296_+	ParB/RepB/Spo0J family partition protein	NA	I3NLC2	Bifidobacterium_phage	32.3	8.1e-11
WP_014668679.1|33397_33922_-	hypothetical protein	NA	NA	NA	NA	NA
WP_014668680.1|33918_34608_-	hypothetical protein	NA	NA	NA	NA	NA
WP_041664663.1|34765_35260_-	nucleoside 2-deoxyribosyltransferase domain-containing protein	NA	A0A1P8DIV6	Virus_Rctr197k	32.2	1.0e-11
WP_078611908.1|35256_35634_-	HIT domain-containing protein	NA	S5VWB9	Mycobacterium_phage	49.1	1.8e-16
WP_014668682.1|35639_35954_-	hypothetical protein	NA	NA	NA	NA	NA
WP_014668683.1|36047_36230_-	hypothetical protein	NA	NA	NA	NA	NA
WP_014668684.1|36259_36841_-	hypothetical protein	NA	NA	NA	NA	NA
WP_148282010.1|36793_37555_+	UTRA domain-containing protein	NA	NA	NA	NA	NA
WP_041664664.1|37541_38309_+	glycosyltransferase	NA	NA	NA	NA	NA
WP_148282011.1|41306_41903_-	hypothetical protein	NA	NA	NA	NA	NA
WP_014668686.1|42043_42655_+	serine/threonine protein kinase	NA	NA	NA	NA	NA
WP_014668687.1|42666_42879_-	hypothetical protein	NA	NA	NA	NA	NA
WP_014668688.1|42901_43363_-	hypothetical protein	NA	NA	NA	NA	NA
WP_014668689.1|43538_45776_+	transcriptional regulator	NA	NA	NA	NA	NA
WP_015493095.1|45805_46120_+	hypothetical protein	NA	NA	NA	NA	NA
WP_014668691.1|46126_46684_+	hypothetical protein	NA	NA	NA	NA	NA
WP_014668692.1|46760_47249_-	hypothetical protein	NA	NA	NA	NA	NA
WP_014668693.1|47645_48119_+	nuclear transport factor 2 family protein	NA	NA	NA	NA	NA
WP_014668694.1|48596_49097_+	ATP-binding protein	NA	NA	NA	NA	NA
WP_014668695.1|49235_49811_+	TetR/AcrR family transcriptional regulator	NA	NA	NA	NA	NA
WP_148282012.1|50060_50627_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_014668693.1|51275_51749_+	nuclear transport factor 2 family protein	NA	NA	NA	NA	NA
WP_014668698.1|52850_54089_-|transposase	IS256 family transposase	transposase	A0A220NQR7	Corynebacterium_phage	44.6	1.6e-82
WP_014668699.1|54512_54968_-	hypothetical protein	NA	NA	NA	NA	NA
WP_175251996.1|55042_57418_-	hypothetical protein	NA	NA	NA	NA	NA
WP_041664666.1|57926_58364_-	hypothetical protein	NA	NA	NA	NA	NA
WP_148282013.1|58842_59394_-	hypothetical protein	NA	NA	NA	NA	NA
WP_051009537.1|59927_60758_-	ParA family protein	NA	Q8JL10	Natrialba_phage	26.7	9.6e-07
WP_014668702.1|62320_62554_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_148282014.1|63633_64221_+	hypothetical protein	NA	NA	NA	NA	NA
WP_041664669.1|64729_65416_+	hypothetical protein	NA	NA	NA	NA	NA
WP_014668704.1|66062_66320_+	hypothetical protein	NA	NA	NA	NA	NA
WP_014668705.1|67140_68094_+|transposase	IS481 family transposase	transposase	NA	NA	NA	NA
>prophage 2
NC_020895	Streptomyces hygroscopicus subsp. jinggangensis TL01, complete sequence	9840102	74862	134870	9840102	integrase,transposase	Streptococcus_phage(25.0%)	44	85084:85143	133839:134705
WP_015493100.1|74862_75654_-|transposase	IS5 family transposase	transposase	NA	NA	NA	NA
WP_148282015.1|76550_77129_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_041664672.1|77074_77614_-	winged helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_014668711.1|77795_78998_+|transposase	IS110 family transposase	transposase	NA	NA	NA	NA
WP_041664673.1|81609_82737_+	FAD-dependent monooxygenase	NA	NA	NA	NA	NA
WP_015493101.1|83683_84892_-|transposase	IS110 family transposase	transposase	M1NSC9	Streptococcus_phage	27.2	1.9e-11
85084:85143	attL	AGACGGTGTCCTATGTGGTGATCGCTCGTTGGGCCGTGTATGGGGCGGGGTACGTGGAGT	NA	NA	NA	NA
WP_086011454.1|85122_85939_+|transposase	IS5 family transposase	transposase	NA	NA	NA	NA
WP_014668718.1|85961_86654_+|transposase	IS5/IS1182 family transposase	transposase	NA	NA	NA	NA
WP_014668720.1|87598_89998_+	protein kinase/ transcriptional regulator	NA	NA	NA	NA	NA
WP_041664674.1|91570_91936_-	hypothetical protein	NA	NA	NA	NA	NA
WP_014668721.1|91932_92115_-	hypothetical protein	NA	NA	NA	NA	NA
WP_041664676.1|92895_93219_-	hypothetical protein	NA	NA	NA	NA	NA
WP_041664677.1|93463_94648_+|transposase	IS701 family transposase	transposase	NA	NA	NA	NA
WP_106436792.1|94916_96464_+|transposase	IS1182 family transposase	transposase	NA	NA	NA	NA
WP_078611501.1|96579_97809_+|transposase	IS701 family transposase	transposase	NA	NA	NA	NA
WP_014668727.1|97948_98230_+|integrase,transposase	DDE-type integrase/transposase/recombinase	integrase,transposase	NA	NA	NA	NA
WP_041664678.1|98534_99002_+	hypothetical protein	NA	NA	NA	NA	NA
WP_041665705.1|98998_99958_-|transposase	IS481 family transposase	transposase	NA	NA	NA	NA
WP_014668729.1|100134_101301_-|transposase	IS110 family transposase	transposase	NA	NA	NA	NA
WP_078611912.1|105182_106031_-	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_078611505.1|106643_107756_+	bifunctional DNA primase/polymerase	NA	NA	NA	NA	NA
WP_041664682.1|107752_109282_+	DNA primase	NA	A0A1D8EQ76	Mycobacterium_phage	44.6	2.6e-98
WP_014668731.1|109278_109680_+	hypothetical protein	NA	NA	NA	NA	NA
WP_078611507.1|109832_110153_+	N-acetyltransferase	NA	NA	NA	NA	NA
WP_041664683.1|110266_110674_+	ester cyclase	NA	NA	NA	NA	NA
WP_041664684.1|110885_111773_+	SDR family NAD(P)-dependent oxidoreductase	NA	NA	NA	NA	NA
WP_014668732.1|111850_114637_-	AAA family ATPase	NA	NA	NA	NA	NA
WP_148282015.1|114937_115516_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_041667346.1|115461_116001_-	winged helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_078611508.1|116077_117535_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_015493104.1|117731_118502_-|transposase	IS5/IS1182 family transposase	transposase	NA	NA	NA	NA
WP_167546354.1|119989_120892_+|transposase	IS5 family transposase	transposase	NA	NA	NA	NA
WP_041664688.1|120848_121379_-	hypothetical protein	NA	NA	NA	NA	NA
WP_051009562.1|121534_122323_+	alpha/beta hydrolase	NA	NA	NA	NA	NA
WP_051009563.1|122619_123081_+	SsgA family sporulation/cell division regulator	NA	NA	NA	NA	NA
WP_041664721.1|123214_123919_+	alpha/beta hydrolase	NA	NA	NA	NA	NA
WP_106436849.1|124119_126996_+	AfsR/SARP family transcriptional regulator	NA	NA	NA	NA	NA
WP_078611914.1|127246_127792_+	sigma-70 family RNA polymerase sigma factor	NA	NA	NA	NA	NA
WP_086011458.1|128129_128948_+|transposase	IS5 family transposase	transposase	NA	NA	NA	NA
WP_041665719.1|130551_130860_+|transposase	IS3 family transposase	transposase	A0A1B3AZF8	Gordonia_phage	47.1	2.5e-08
WP_014668769.1|130856_131729_+|transposase	IS3 family transposase	transposase	A0A1P8CWQ3	Bacillus_phage	36.1	2.4e-40
WP_167546358.1|131826_132966_-|transposase	IS701 family transposase	transposase	NA	NA	NA	NA
WP_086011454.1|133041_133859_-|transposase	IS5 family transposase	transposase	NA	NA	NA	NA
WP_175252359.1|133955_134870_-|transposase	transposase family protein	transposase	NA	NA	NA	NA
133839:134705	attR	ACTCCACGTACCCCGCCCCATACACGGCCCAACGAGCGATCACCACATAGGACACCGTCTTAACGAGTTGGTGCGTGATAGCGGGTGAGGCGCCTTTAGCCTGGTCGTGGCCTGTTTTCAGATGTTGATGTTGCGGTCGGAGACGAGGCTGGCGATGGCGCGGTAGGTGTCGGGCAGGCGGTCGCGGCGGTGGGTCCAGCGCGTCAGTTGCTTCCAGCGTTTGTGGTCGGCGAGAGCGTGTTCGACGGTGATGCGGTCGGAGGAGTGTTCGTGGCGGTCGCGTTCCCACTGCTGGACTCTGCCGGGCAGTGCTCCCGGGCGCGGTTTTCGTGGTGGTGTGATCGCTTGCCCGCGGTGGTCGCGGCTCAGGCCGAGGTAGCCGTCGTCCAGGAGGACCTCGACGTCGGGGAAGTGCTGGAAGCAGACGGCGATGCCCTCGTTGCGGGCGGCCGTGGCATCATGCATCCGTCCAGGTCGCAGGGTGTCGGTCCATAAGGTGCGACCCCGCCAGTCAGCGATGACGGTGGCCTTCATGGTGTTCTGTTTCTTCTTCCCGGAAACGAATGCGCGCCGTCCGCCGCGGCCGGCCGGTGGCCGGCGGACCTGGATCTCGGTGGCGTCCAGCCTCAGCTCCACACCCTCGGCCTGGGCGTAGGCGAACACGTCGGCCAGAGTCCGTAATCGCAGGCCGGGGCGGTCGGGGACCGCACACCCCCGCTCGGCCAGTAGCGTACGTATCTCTGCGATCGCGCGGGTGACGGTGGAGCGGTCGACGCCGAACAGCAGGCCCAGTACCGAGTGCGGCAGGTCGTGCCGCAGATGGATCAGCGTAGCCACCAGCCGGTCGACGAAGACCAGCCGGTGGCG	NA	NA	NA	NA
>prophage 3
NC_020895	Streptomyces hygroscopicus subsp. jinggangensis TL01, complete sequence	9840102	1461425	1505873	9840102	integrase,transposase	Bacillus_phage(40.0%)	42	1467146:1467161	1501357:1501372
WP_086011463.1|1461425_1462605_+|transposase	IS3 family transposase	transposase	U5P429	Shigella_phage	33.5	1.8e-30
WP_014670029.1|1464590_1465709_+	dimethyl sulfone monooxygenase SfnG	NA	NA	NA	NA	NA
WP_014670030.1|1465806_1467024_+	acyl-CoA dehydrogenase family protein	NA	NA	NA	NA	NA
WP_014670031.1|1467079_1467316_+	FMN reductase	NA	NA	NA	NA	NA
1467146:1467161	attL	CACCTCGACGACCGGC	NA	NA	NA	NA
WP_078611627.1|1467258_1467612_+|transposase	transposase	transposase	A0A0N9SHJ4	Paenibacillus_phage	35.7	5.5e-12
WP_014670034.1|1468144_1468378_-	hypothetical protein	NA	NA	NA	NA	NA
WP_014670035.1|1468425_1469856_-	UbiD family decarboxylase	NA	NA	NA	NA	NA
WP_041664869.1|1469931_1470522_-	UbiX family flavin prenyltransferase	NA	NA	NA	NA	NA
WP_014670037.1|1470690_1471554_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_014670038.1|1471563_1471794_-	DUF397 domain-containing protein	NA	NA	NA	NA	NA
WP_014670039.1|1471780_1472170_-	hypothetical protein	NA	NA	NA	NA	NA
WP_014670040.1|1472428_1473370_-	MBL fold metallo-hydrolase	NA	NA	NA	NA	NA
WP_041664870.1|1473471_1474410_+	AraC family transcriptional regulator	NA	NA	NA	NA	NA
WP_148282050.1|1475118_1475616_-	hypothetical protein	NA	NA	NA	NA	NA
WP_014670042.1|1475658_1476858_+	hypothetical protein	NA	NA	NA	NA	NA
WP_148282051.1|1477617_1477842_+	hypothetical protein	NA	NA	NA	NA	NA
WP_051009622.1|1477993_1478650_+	SMI1/KNR4 family protein	NA	NA	NA	NA	NA
WP_014670046.1|1478730_1479714_-	hypothetical protein	NA	NA	NA	NA	NA
WP_148282053.1|1480728_1481106_+	hypothetical protein	NA	NA	NA	NA	NA
WP_041664872.1|1481136_1481544_+	hypothetical protein	NA	NA	NA	NA	NA
WP_014670047.1|1482294_1482435_+	hypothetical protein	NA	NA	NA	NA	NA
WP_014670048.1|1482943_1483327_-	hypothetical protein	NA	NA	NA	NA	NA
WP_014670049.1|1483701_1483905_-	hypothetical protein	NA	NA	NA	NA	NA
WP_175252038.1|1484612_1484966_+	hypothetical protein	NA	NA	NA	NA	NA
WP_051009623.1|1485256_1485775_+	peptidylprolyl isomerase	NA	A0A076FI46	Aureococcus_anophage	41.0	2.8e-20
WP_086011474.1|1487188_1488390_-|transposase	IS3 family transposase	transposase	A0A1P8CWQ3	Bacillus_phage	34.5	5.6e-32
WP_063609130.1|1488978_1489248_+	hypothetical protein	NA	NA	NA	NA	NA
WP_014670056.1|1489240_1489615_-	phosphotransferase	NA	NA	NA	NA	NA
WP_014670057.1|1489929_1490283_+	hypothetical protein	NA	NA	NA	NA	NA
WP_051009625.1|1490442_1490943_-	hypothetical protein	NA	NA	NA	NA	NA
WP_014670059.1|1491225_1491441_-	hypothetical protein	NA	NA	NA	NA	NA
WP_015493159.1|1491523_1491961_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_051009627.1|1493433_1493793_-	hypothetical protein	NA	NA	NA	NA	NA
WP_051009630.1|1493789_1495415_-	hypothetical protein	NA	NA	NA	NA	NA
WP_041664873.1|1496085_1496607_+	hypothetical protein	NA	NA	NA	NA	NA
WP_148282054.1|1497375_1497600_+	hypothetical protein	NA	NA	NA	NA	NA
WP_015493160.1|1497974_1498817_+|integrase	site-specific integrase	integrase	NA	NA	NA	NA
WP_014670064.1|1499324_1499747_+	hypothetical protein	NA	NA	NA	NA	NA
WP_014670065.1|1499749_1502593_+	caspase family protein	NA	NA	NA	NA	NA
1501357:1501372	attR	CACCTCGACGACCGGC	NA	NA	NA	NA
WP_078611633.1|1502849_1503392_+	SUKH-4 family immunity protein	NA	NA	NA	NA	NA
WP_086011630.1|1503795_1504623_-	phosphatase PAP2 family protein	NA	NA	NA	NA	NA
WP_086011474.1|1504672_1505873_+|transposase	IS3 family transposase	transposase	A0A1P8CWQ3	Bacillus_phage	34.5	5.6e-32
>prophage 4
NC_020895	Streptomyces hygroscopicus subsp. jinggangensis TL01, complete sequence	9840102	2554009	2608730	9840102	tail,plate,protease	Bacillus_phage(33.33%)	39	NA	NA
WP_014670998.1|2554009_2556805_+|protease	M48 family metalloprotease	protease	NA	NA	NA	NA
WP_014670999.1|2556893_2559275_+	SpoIIE family protein phosphatase	NA	NA	NA	NA	NA
WP_014671000.1|2559424_2562196_+	SpoIIE family protein phosphatase	NA	A0A1J0MCT1	Streptomyces_phage	50.6	3.1e-09
WP_014671001.1|2562317_2562650_+	antibiotic biosynthesis monooxygenase	NA	NA	NA	NA	NA
WP_014671002.1|2562902_2563646_-	class I SAM-dependent methyltransferase	NA	NA	NA	NA	NA
WP_014671003.1|2563798_2568544_+	DNA/RNA non-specific endonuclease	NA	A0A2H4JFP5	uncultured_Caudovirales_phage	39.8	1.3e-18
WP_014671004.1|2568568_2569117_+	SMI1/KNR4 family protein	NA	NA	NA	NA	NA
WP_014671005.1|2569204_2569672_-	hypothetical protein	NA	NA	NA	NA	NA
WP_014671006.1|2570160_2571495_-	diaminopimelate decarboxylase	NA	NA	NA	NA	NA
WP_014671007.1|2571509_2571878_-	hypothetical protein	NA	NA	NA	NA	NA
WP_014671008.1|2572183_2572747_+	universal stress protein	NA	NA	NA	NA	NA
WP_014671010.1|2573402_2574086_-	response regulator transcription factor	NA	W8CYM9	Bacillus_phage	31.1	7.9e-23
WP_175252075.1|2574225_2574894_-	potassium-transporting ATPase subunit C	NA	NA	NA	NA	NA
WP_175252076.1|2574917_2577047_-	potassium-transporting ATPase subunit KdpB	NA	M1HBF8	Paramecium_bursaria_Chlorella_virus	23.5	1.1e-27
WP_014671013.1|2577046_2578708_-	potassium-transporting ATPase subunit KdpA	NA	NA	NA	NA	NA
WP_016434100.1|2578715_2578805_-	K(+)-transporting ATPase subunit F	NA	NA	NA	NA	NA
WP_014671014.1|2578801_2579191_-	hypothetical protein	NA	NA	NA	NA	NA
WP_014671015.1|2579193_2581689_-	sensor histidine kinase KdpD	NA	NA	NA	NA	NA
WP_014671016.1|2582352_2584305_+	APC family permease	NA	NA	NA	NA	NA
WP_014671017.1|2584957_2585785_+	DUF4157 domain-containing protein	NA	NA	NA	NA	NA
WP_014671018.1|2585892_2587206_-	lipase chaperone	NA	NA	NA	NA	NA
WP_051009664.1|2587468_2588146_+	response regulator transcription factor	NA	NA	NA	NA	NA
WP_014671020.1|2588423_2590517_+	VWA domain-containing protein	NA	NA	NA	NA	NA
WP_014671021.1|2590526_2591222_+	DUF4255 domain-containing protein	NA	NA	NA	NA	NA
WP_014671022.1|2591218_2593345_+	ATP-binding protein	NA	A0A2D2W2C3	Stenotrophomonas_phage	40.0	7.2e-06
WP_148282074.1|2593397_2594138_-	hypothetical protein	NA	NA	NA	NA	NA
WP_014671023.1|2594134_2597308_-	hypothetical protein	NA	NA	NA	NA	NA
WP_014671024.1|2597811_2599377_+|tail	phage tail sheath family protein	tail	J9PVC2	Bacillus_phage	34.2	9.5e-72
WP_014671025.1|2599427_2599871_+|tail	phage tail protein	tail	NA	NA	NA	NA
WP_014671026.1|2599870_2600311_+	hypothetical protein	NA	NA	NA	NA	NA
WP_014671027.1|2600307_2600451_+	hypothetical protein	NA	NA	NA	NA	NA
WP_014671028.1|2600456_2602217_+	hypothetical protein	NA	NA	NA	NA	NA
WP_014671029.1|2602242_2602674_+|tail	phage tail protein	tail	NA	NA	NA	NA
WP_015493194.1|2602677_2603475_+	LysM peptidoglycan-binding domain-containing protein	NA	NA	NA	NA	NA
WP_014671031.1|2603483_2605412_+	VgrG-related protein	NA	NA	NA	NA	NA
WP_041664984.1|2605518_2605794_+	PAAR domain-containing protein	NA	NA	NA	NA	NA
WP_014671033.1|2605797_2606205_+	GPW/gp25 family protein	NA	NA	NA	NA	NA
WP_014671034.1|2606201_2608169_+|plate	putative baseplate assembly protein	plate	NA	NA	NA	NA
WP_014671035.1|2608169_2608730_+|tail	tail protein	tail	NA	NA	NA	NA
>prophage 5
NC_020895	Streptomyces hygroscopicus subsp. jinggangensis TL01, complete sequence	9840102	9626369	9663979	9840102	integrase,transposase	Bacillus_phage(100.0%)	35	9613485:9613503	9639339:9639357
9613485:9613503	attL	CGGCCGCCCGCGCCGCCGG	NA	NA	NA	NA
WP_014677233.1|9626369_9629009_+|integrase	site-specific integrase	integrase	NA	NA	NA	NA
WP_014677234.1|9629103_9629562_+	hypothetical protein	NA	NA	NA	NA	NA
WP_041665656.1|9629624_9630191_+	DUF4240 domain-containing protein	NA	NA	NA	NA	NA
WP_014677236.1|9631451_9631679_+	hypothetical protein	NA	NA	NA	NA	NA
WP_014677237.1|9631883_9633128_-	SMI1/KNR4 family protein	NA	NA	NA	NA	NA
WP_014677238.1|9633628_9633802_+	hypothetical protein	NA	NA	NA	NA	NA
WP_014677239.1|9634084_9635449_+	discoidin domain-containing protein	NA	NA	NA	NA	NA
WP_014677240.1|9636150_9636783_-	TetR/AcrR family transcriptional regulator	NA	NA	NA	NA	NA
WP_041665658.1|9636953_9637523_+	hypothetical protein	NA	NA	NA	NA	NA
WP_014677242.1|9638405_9639161_+	(5-formylfuran-3-yl)methyl phosphate synthase	NA	NA	NA	NA	NA
WP_014677243.1|9639169_9640573_+	aldehyde dehydrogenase family protein	NA	NA	NA	NA	NA
9639339:9639357	attR	CGGCCGCCCGCGCCGCCGG	NA	NA	NA	NA
WP_014677244.1|9640575_9641682_+	NAD(P)-dependent alcohol dehydrogenase	NA	NA	NA	NA	NA
WP_014677245.1|9641762_9642668_+	class I SAM-dependent methyltransferase	NA	NA	NA	NA	NA
WP_014677246.1|9642820_9643354_-	EF-hand domain-containing protein	NA	NA	NA	NA	NA
WP_014677247.1|9643960_9644242_-	hypothetical protein	NA	NA	NA	NA	NA
WP_014677248.1|9644273_9645662_-	phosphotransferase	NA	NA	NA	NA	NA
WP_014677249.1|9645658_9646510_-	class I SAM-dependent methyltransferase	NA	NA	NA	NA	NA
WP_014677250.1|9646506_9647688_-	methyltransferase domain-containing protein	NA	NA	NA	NA	NA
WP_014677251.1|9647822_9649196_-	MFS transporter	NA	NA	NA	NA	NA
WP_014677252.1|9649298_9649733_-	NUDIX domain-containing protein	NA	NA	NA	NA	NA
WP_014677253.1|9649723_9650767_-	NUDIX domain-containing protein	NA	NA	NA	NA	NA
WP_086011608.1|9652269_9653471_-|transposase	IS3 family transposase	transposase	A0A1P8CWQ3	Bacillus_phage	33.7	3.7e-31
WP_014677257.1|9653624_9653852_+	hypothetical protein	NA	NA	NA	NA	NA
WP_014677258.1|9654450_9654615_+	hypothetical protein	NA	NA	NA	NA	NA
WP_086011609.1|9654633_9655450_+|transposase	IS5 family transposase	transposase	NA	NA	NA	NA
WP_148282122.1|9655570_9655990_+	hypothetical protein	NA	NA	NA	NA	NA
WP_014677262.1|9655982_9658148_+	ATP/GTP-binding protein	NA	NA	NA	NA	NA
WP_041665664.1|9658826_9659399_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_158506455.1|9659395_9659638_-	winged helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_158506456.1|9659698_9659830_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_078611892.1|9660090_9661320_-|transposase	IS701 family transposase	transposase	NA	NA	NA	NA
WP_041665666.1|9661893_9662484_-	hypothetical protein	NA	NA	NA	NA	NA
WP_014677268.1|9662564_9662822_-	hypothetical protein	NA	NA	NA	NA	NA
WP_041665667.1|9662915_9663455_+	winged helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_148282124.1|9663400_9663979_+|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
