The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
NC_020238	Bacillus thuringiensis serovar kurstaki str. HD73, complete sequence	5646799	229219	329221	5646799	holin,tRNA,protease,terminase,head,transposase,integrase,portal,tail	Bacillus_phage(58.93%)	85	246184:246201	268770:268787
WP_000908522.1|229219_229792_-|protease	rhomboid family intramembrane serine protease	protease	NA	NA	NA	NA
WP_000583417.1|229885_230245_+	holo-ACP synthase	NA	NA	NA	NA	NA
WP_002100659.1|230401_231352_+	outer membrane lipoprotein carrier protein LolA	NA	NA	NA	NA	NA
WP_000390616.1|231469_232639_+	alanine racemase	NA	NA	NA	NA	NA
WP_000004570.1|232947_233235_+	antitoxin EndoAI	NA	NA	NA	NA	NA
WP_000635965.1|233239_233590_+	type II toxin-antitoxin system endoribonuclease NdoA	NA	A0A2P0ZKX3	Lactobacillus_phage	37.7	1.7e-13
WP_000426236.1|233657_235826_+	RNA-binding transcriptional accessory protein	NA	NA	NA	NA	NA
WP_001143642.1|235884_236001_-	cortex morphogenetic protein CmpA	NA	NA	NA	NA	NA
WP_000344239.1|236196_236655_+	SprT family protein	NA	NA	NA	NA	NA
WP_000049649.1|243149_243623_+|tRNA	tRNA (adenosine(37)-N6)-threonylcarbamoyltransferase complex ATPase subunit type 1 TsaE	tRNA	NA	NA	NA	NA
WP_000865756.1|243603_244296_+|tRNA	tRNA (adenosine(37)-N6)-threonylcarbamoyltransferase complex dimerization subunit type 1 TsaB	tRNA	NA	NA	NA	NA
WP_000367190.1|244309_244753_+	ribosomal protein S18-alanine N-acetyltransferase	NA	NA	NA	NA	NA
WP_000414585.1|244752_245769_+|tRNA	tRNA (adenosine(37)-N6)-threonylcarbamoyltransferase complex transferase subunit TsaD	tRNA	A0A0R6PI74	Moraxella_phage	43.4	1.9e-68
246184:246201	attL	ATTAAAAGAAAAAAAGAT	NA	NA	NA	NA
WP_001987845.1|246254_248234_-	ABC-F family ATP-binding cassette domain-containing protein	NA	A0A2K9L3Z8	Tupanvirus	29.9	2.8e-52
WP_000372699.1|248367_248997_+	redox-sensing transcriptional repressor Rex	NA	NA	NA	NA	NA
WP_001246200.1|249026_249218_-	YdiK family protein	NA	NA	NA	NA	NA
WP_000745326.1|249214_249964_-|protease	CPBP family intramembrane metalloprotease	protease	NA	NA	NA	NA
WP_000917311.1|250355_250640_+	co-chaperone GroES	NA	A0A221S3C8	uncultured_virus	54.8	1.2e-20
WP_001029993.1|250678_252313_+	chaperonin GroEL	NA	A0A219YK78	uncultured_virus	58.0	1.5e-157
WP_000743906.1|252719_254258_+	glutamine-hydrolyzing GMP synthase	NA	A0A1V0SH76	Hokovirus	31.7	8.8e-22
WP_001123356.1|254323_255391_-|integrase	site-specific integrase	integrase	A0A0S2MV79	Bacillus_phage	99.7	3.3e-201
WP_000654304.1|255417_255858_-	ImmA/IrrE family metallo-endopeptidase	NA	A0A0S2MV59	Bacillus_phage	97.9	6.5e-79
WP_000435973.1|255871_256351_-	helix-turn-helix transcriptional regulator	NA	A0A0S2MVI1	Bacillus_phage	99.4	6.9e-82
WP_001042666.1|256536_256791_+	DUF739 family protein	NA	A0A0S2MVA3	Bacillus_phage	98.8	5.5e-38
WP_000383685.1|256804_256993_+	hypothetical protein	NA	A0A0S2MV91	Bacillus_phage	100.0	4.5e-29
WP_000359729.1|257218_258034_+	hypothetical protein	NA	A0A0S2MV65	Bacillus_phage	81.6	6.1e-123
WP_000665325.1|258046_258244_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000073375.1|258657_259545_+	DnaD domain protein	NA	W8CYG5	Bacillus_phage	41.7	6.8e-43
WP_000235015.1|259483_260359_+	ATP-binding protein	NA	Q2I8C8	Bacillus_phage	47.2	4.3e-66
WP_000337986.1|260374_260569_+	hypothetical protein	NA	A0A0U3K3J8	Bacillus_phage	76.6	1.0e-20
WP_000805170.1|260594_260768_+	DUF3954 domain-containing protein	NA	A0A1B1P7U5	Bacillus_phage	91.2	2.6e-23
WP_000811696.1|260782_261037_+	hypothetical protein	NA	A0A1B0T6B9	Bacillus_phage	88.1	1.4e-36
WP_002134040.1|261045_261510_+	hypothetical protein	NA	A0A2H4J8I5	uncultured_Caudovirales_phage	35.4	4.4e-17
WP_000665841.1|261536_261749_+	hypothetical protein	NA	A0A1B0T6B5	Bacillus_phage	93.5	1.5e-25
WP_002134037.1|261793_261979_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000387671.1|262030_262429_+	hypothetical protein	NA	A0A068ELY9	Bacillus_phage	79.1	2.8e-57
WP_000805074.1|262453_262876_+	hypothetical protein	NA	A0A1B1P7B4	Bacillus_phage	82.9	2.3e-65
WP_000397931.1|263051_263318_+	hypothetical protein	NA	D2XR50	Bacillus_phage	42.7	2.2e-13
WP_000404182.1|263355_263754_+	hypothetical protein	NA	W8CYU3	Bacillus_phage	75.0	1.2e-52
WP_000365653.1|264040_264259_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000234108.1|264445_264628_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000525861.1|265126_265408_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000166182.1|265721_266204_+	ArpU family transcriptional regulator	NA	H0USV3	Bacillus_phage	82.5	1.9e-71
WP_001012113.1|266203_266746_+|integrase	site-specific integrase	integrase	W8CYP1	Bacillus_phage	92.2	1.3e-89
WP_000124642.1|267421_267682_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000336221.1|267823_268228_+	hypothetical protein	NA	Q2I8B8	Bacillus_phage	75.0	2.7e-47
WP_000666403.1|268224_268560_+	HNH endonuclease	NA	D2XR61	Bacillus_phage	91.9	1.0e-52
WP_000124848.1|268710_269046_+	hypothetical protein	NA	A0A1B1P762	Bacillus_phage	31.2	2.3e-07
268770:268787	attR	ATTAAAAGAAAAAAAGAT	NA	NA	NA	NA
WP_000615714.1|269042_270701_+|terminase	terminase large subunit	terminase	A0A2H4JHE9	uncultured_Caudovirales_phage	79.3	1.0e-257
WP_044157418.1|270766_271873_+|portal	phage portal protein	portal	A0A2H4JAJ1	uncultured_Caudovirales_phage	89.9	2.4e-186
WP_000216402.1|271856_272633_+|protease	Clp protease ClpP	protease	A0A0A7RWX3	Clostridium_phage	57.7	2.5e-57
WP_000234863.1|272653_273817_+	hypothetical protein	NA	A0A2H4JH29	uncultured_Caudovirales_phage	96.9	1.7e-211
WP_001243199.1|273829_274126_+	hypothetical protein	NA	A0A2H4JF26	uncultured_Caudovirales_phage	87.8	1.6e-41
WP_001182260.1|274127_274502_+|head	phage head closure protein	head	A0A2H4JHA9	uncultured_Caudovirales_phage	90.3	1.1e-58
WP_000818829.1|274489_274927_+	hypothetical protein	NA	A0A2H4JBV5	uncultured_Caudovirales_phage	93.1	7.4e-75
WP_000793436.1|274923_275286_+	DUF3168 domain-containing protein	NA	A0A2H4JBW1	uncultured_Caudovirales_phage	85.0	1.4e-55
WP_001251821.1|275301_275886_+|tail	tail protein	tail	A0A2H4JET9	uncultured_Caudovirales_phage	93.3	2.9e-98
WP_015382157.1|275942_276317_+	hypothetical protein	NA	A0A2H4JBU8	uncultured_Caudovirales_phage	86.8	1.8e-53
WP_001173498.1|276481_281479_+|tail	phage tail protein	tail	A0A2H4JI37	uncultured_Caudovirales_phage	80.5	0.0e+00
WP_000093847.1|281518_282988_+|tail	phage tail protein	tail	A0A0S2MV63	Bacillus_phage	78.3	1.1e-231
WP_015382146.1|282984_288549_+	hypothetical protein	NA	A0A0S2MVB4	Bacillus_phage	64.1	0.0e+00
WP_015382147.1|288565_288931_+	hypothetical protein	NA	A0A0S2MVE0	Bacillus_phage	59.0	3.7e-35
WP_000390477.1|289057_289282_+	hypothetical protein	NA	A0A1B1P780	Bacillus_phage	89.2	1.1e-26
WP_000373855.1|289357_289783_+|holin	phage holin family protein	holin	A0A1B1P787	Bacillus_phage	97.2	4.8e-71
WP_000403436.1|289782_290721_+	N-acetylmuramoyl-L-alanine amidase	NA	A0A0S2MV84	Bacillus_phage	94.7	3.3e-136
WP_000579579.1|291172_292423_+|transposase	IS110 family transposase	transposase	A0A1X9I619	Streptococcus_phage	41.9	2.7e-69
WP_000956437.1|293425_293692_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000741567.1|294240_295317_+	recombinase RecA	NA	A0A0S2MVG1	Bacillus_phage	86.6	1.2e-171
WP_002134197.1|295480_296371_-	hypothetical protein	NA	A0A0S2MVF4	Bacillus_phage	63.0	1.9e-85
WP_000833096.1|297088_298414_+	NCS2 family permease	NA	A0A0R6PHV4	Moraxella_phage	29.4	4.1e-44
WP_000929880.1|298557_299259_+	response regulator transcription factor	NA	W8CYM9	Bacillus_phage	36.0	9.5e-40
WP_000719210.1|299242_300748_+	aminopeptidase AmpS	NA	W8CYF6	Bacillus_phage	30.0	7.8e-31
WP_000723976.1|306319_307279_+	alpha/beta hydrolase	NA	NA	NA	NA	NA
WP_000687949.1|307478_308210_+	DsbA family oxidoreductase	NA	NA	NA	NA	NA
WP_001072418.1|313398_313857_-	ASCH domain-containing protein	NA	NA	NA	NA	NA
WP_001279960.1|314219_315017_-	undecaprenyl-diphosphate phosphatase UppP	NA	NA	NA	NA	NA
WP_000247716.1|315034_315772_-	ABC transporter permease	NA	NA	NA	NA	NA
WP_000074580.1|315764_316694_-	ABC transporter ATP-binding protein	NA	A0A2H4PQG7	Staphylococcus_phage	44.2	2.3e-41
WP_000845334.1|316762_317776_-	HAMP domain-containing histidine kinase	NA	A0A2K9L4R6	Tupanvirus	21.6	3.1e-07
WP_000651991.1|317765_318479_-	response regulator transcription factor	NA	W8CYM9	Bacillus_phage	38.1	3.4e-37
WP_000690999.1|323981_325058_-	glycosyl transferase	NA	NA	NA	NA	NA
WP_001058693.1|325281_326154_-	class I SAM-dependent methyltransferase	NA	NA	NA	NA	NA
WP_000405117.1|326181_326904_-	class I SAM-dependent methyltransferase	NA	NA	NA	NA	NA
WP_002134075.1|327123_327891_-	sulfotransferase family 2 domain-containing protein	NA	A0A288WG17	Bacillus_phage	51.9	7.4e-62
WP_000275580.1|327925_329221_+|transposase	IS21-like element IS232 family transposase	transposase	A0A2L1IVA1	Escherichia_phage	28.8	5.3e-12
>prophage 2
NC_020238	Bacillus thuringiensis serovar kurstaki str. HD73, complete sequence	5646799	342103	350479	5646799		Synechococcus_phage(50.0%)	8	NA	NA
WP_000625682.1|342103_343411_+	adenylosuccinate lyase	NA	A0A2H4UUU6	Bodo_saltans_virus	25.3	4.9e-21
WP_001170544.1|343499_344219_+	phosphoribosylaminoimidazolesuccinocarboxamide synthase	NA	G8EYA2	Synechococcus_phage	44.3	4.0e-49
WP_000278823.1|344211_344466_+	phosphoribosylformylglycinamidine synthase subunit PurS	NA	NA	NA	NA	NA
WP_000666789.1|344462_345146_+	phosphoribosylformylglycinamidine synthase subunit PurQ	NA	NA	NA	NA	NA
WP_000055562.1|345129_347349_+	phosphoribosylformylglycinamidine synthase II	NA	A6N228	Microbacterium_phage	41.2	2.6e-163
WP_000879025.1|347333_348749_+	amidophosphoribosyltransferase	NA	A0A0M3SGR2	Mollivirus	35.4	3.3e-55
WP_001262439.1|348854_349895_+	phosphoribosylformylglycinamidine cyclo-ligase	NA	A0A0E3F760	Synechococcus_phage	45.9	1.2e-67
WP_000088589.1|349891_350479_+	phosphoribosylglycinamide formyltransferase	NA	M4QRX9	Synechococcus_phage	37.4	9.1e-28
>prophage 3
NC_020238	Bacillus thuringiensis serovar kurstaki str. HD73, complete sequence	5646799	371554	471691	5646799	tRNA,capsid,protease,terminase,head,portal,integrase,transposase,tail	Bacillus_phage(63.64%)	105	389266:389294	438223:438251
WP_000086999.1|371554_371845_+|tRNA	Asp-tRNA(Asn)/Glu-tRNA(Gln) amidotransferase subunit GatC	tRNA	NA	NA	NA	NA
WP_000051441.1|371860_373318_+|tRNA	Asp-tRNA(Asn)/Glu-tRNA(Gln) amidotransferase subunit GatA	tRNA	NA	NA	NA	NA
WP_001047685.1|373332_374760_+|tRNA	Asp-tRNA(Asn)/Glu-tRNA(Gln) amidotransferase subunit GatB	tRNA	NA	NA	NA	NA
WP_000977679.1|375317_376223_+	diacylglycerol kinase	NA	A0A1V0SBJ0	Catovirus	30.8	4.1e-27
WP_000416667.1|376362_377106_+	HAD family hydrolase	NA	NA	NA	NA	NA
WP_000890399.1|377185_378625_+	4-aminobutyrate--2-oxoglutarate transaminase	NA	NA	NA	NA	NA
WP_000225143.1|378740_380108_+	sigma 54-interacting transcriptional regulator	NA	NA	NA	NA	NA
WP_000358128.1|380100_381552_+	NADP-dependent succinate-semialdehyde dehydrogenase	NA	NA	NA	NA	NA
WP_000263262.1|381599_381923_+	multidrug efflux SMR transporter	NA	NA	NA	NA	NA
WP_003283018.1|382039_382546_+	DUF4352 domain-containing protein	NA	NA	NA	NA	NA
WP_000007357.1|382591_383821_-	aminopeptidase	NA	NA	NA	NA	NA
WP_001233712.1|383937_385020_-	polysaccharide deacetylase family protein	NA	NA	NA	NA	NA
WP_000875595.1|385556_386264_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001200489.1|386310_387507_-	NupC family nucleoside transporter	NA	NA	NA	NA	NA
WP_000105033.1|387932_389312_+	23S rRNA (uracil(1939)-C(5))-methyltransferase RlmD	NA	A0A2K5B251	Erysipelothrix_phage	46.7	3.8e-117
389266:389294	attL	ATACGACTCATGTGGAGTGTGTGGCTTGG	NA	NA	NA	NA
WP_000679465.1|389370_390495_-|integrase	site-specific integrase	integrase	A0A1B0T6A8	Bacillus_phage	98.1	2.0e-212
WP_000703672.1|390653_391517_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000838797.1|392078_393218_+	hypothetical protein	NA	H0UST6	Bacillus_phage	58.6	1.6e-124
WP_000710221.1|393220_393364_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000172107.1|393731_394085_-	helix-turn-helix transcriptional regulator	NA	A0A1B0T6A7	Bacillus_phage	85.5	9.6e-49
WP_000022043.1|394306_394549_+	helix-turn-helix transcriptional regulator	NA	A0A1B0T6B2	Bacillus_phage	83.3	1.1e-24
WP_001246222.1|394545_394896_+	helix-turn-helix domain-containing protein	NA	A0A1B0T6C2	Bacillus_phage	87.1	7.5e-54
WP_000969632.1|394892_395060_+	hypothetical protein	NA	A0A0U3B230	Bacillus_phage	79.6	6.0e-17
WP_000190244.1|395270_396011_+	DnaD domain protein	NA	A0A1B0T6C0	Bacillus_phage	82.5	2.4e-81
WP_001148230.1|395958_396822_+	ATP-binding protein	NA	A0A1B0T6C3	Bacillus_phage	94.9	3.1e-133
WP_000337984.1|396824_397019_+	hypothetical protein	NA	A0A0U3K3J8	Bacillus_phage	81.2	6.5e-23
WP_000799098.1|397035_397314_+	AbrB/MazE/SpoVT family DNA-binding domain-containing protein	NA	A0A2I7SC16	Paenibacillus_phage	59.3	1.6e-11
WP_001125972.1|397306_397666_+	hypothetical protein	NA	A0A1B1P7A1	Bacillus_phage	54.2	4.9e-32
WP_000717829.1|397684_397852_+	DUF3954 domain-containing protein	NA	A0A1B0T6B8	Bacillus_phage	64.2	9.5e-15
WP_000109543.1|397877_398129_+	hypothetical protein	NA	A0A0K2CNP4	Brevibacillus_phage	42.2	2.2e-07
WP_001054607.1|398148_398658_+	dUTPase	NA	A0A1L2JY27	Aeribacillus_phage	44.9	1.4e-27
WP_001134294.1|398698_399172_+	hypothetical protein	NA	A0A0H3UZ60	Geobacillus_virus	57.5	2.7e-30
WP_000331942.1|399216_399606_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000323893.1|399641_399839_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001030635.1|399831_400365_+	hypothetical protein	NA	U5PUK4	Bacillus_phage	59.4	4.4e-53
WP_000455138.1|400394_400778_+	hypothetical protein	NA	Q2LI92	Bacillus_phage	44.1	1.1e-24
WP_001268380.1|400821_401094_+	hypothetical protein	NA	I7J4K9	Bacillus_phage	58.1	2.7e-19
WP_000670920.1|401133_401343_+	hypothetical protein	NA	A0A068EPB6	Bacillus_phage	47.1	2.4e-07
WP_000350118.1|401684_402113_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002134061.1|402353_402719_+	hypothetical protein	NA	I7J6W4	Bacillus_phage	100.0	3.6e-59
WP_000351065.1|402964_403162_+	hypothetical protein	NA	I7IDJ9	Bacillus_phage	100.0	5.6e-30
WP_000873130.1|403158_403437_+	hypothetical protein	NA	I7J4K9	Bacillus_phage	100.0	8.1e-43
WP_001226456.1|403556_403943_+	hypothetical protein	NA	I7I4E2	Bacillus_phage	100.0	5.2e-72
WP_015382153.1|404153_405347_-|transposase	IS110 family transposase	transposase	A0A0U3ULR1	Bacillus_phage	25.1	9.6e-24
WP_041184425.1|405814_406363_+|integrase	site-specific integrase	integrase	W8CYP1	Bacillus_phage	91.4	2.6e-85
WP_000370222.1|407009_407252_+	hypothetical protein	NA	A0A0S2MVA9	Bacillus_phage	87.5	1.1e-30
WP_000002735.1|407244_407679_+	hypothetical protein	NA	A0A0A7AQA1	Bacillus_phage	55.0	4.3e-14
WP_002134055.1|407675_407903_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001091354.1|407907_408072_+	helix-turn-helix domain-containing protein	NA	A0A142F1N8	Bacillus_phage	64.4	2.0e-09
WP_000869623.1|408074_408320_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000924768.1|408300_408714_+	HNH endonuclease	NA	Q0SPJ9	Clostridium_phage	43.0	1.6e-23
WP_000113652.1|408813_409335_+|terminase	phage terminase small subunit P27 family	terminase	Q9ZXG2	Bacillus_phage	63.7	5.6e-53
WP_001082759.1|409344_411060_+|terminase	terminase large subunit	terminase	A0A0A7RVS5	Clostridium_phage	63.2	5.3e-217
WP_000264107.1|411073_412294_+|portal	phage portal protein	portal	A6M949	Geobacillus_virus	53.0	5.4e-123
WP_000499523.1|412388_413582_-|transposase	IS110-like element ISBth13 family transposase	transposase	A0A0U3ULR1	Bacillus_phage	26.1	1.1e-24
WP_002134054.1|413872_414571_+|protease	Clp protease ClpP	protease	A0A0A7RTN2	Clostridium_phage	59.0	2.7e-71
WP_001123701.1|414608_415781_+|capsid	phage major capsid protein	capsid	A0A2H4JHG1	uncultured_Caudovirales_phage	62.5	2.4e-128
WP_000904085.1|415815_416109_+	hypothetical protein	NA	A0A0A7S0C9	Clostridium_phage	39.6	4.6e-12
WP_001068032.1|416105_416450_+|head	phage head closure protein	head	A0A2H4JHA9	uncultured_Caudovirales_phage	71.1	7.0e-44
WP_000818832.1|416437_416875_+	hypothetical protein	NA	A0A2H4JBV5	uncultured_Caudovirales_phage	80.7	4.5e-64
WP_001243517.1|416871_417234_+	DUF3168 domain-containing protein	NA	A0A2H4JBW1	uncultured_Caudovirales_phage	84.2	2.4e-55
WP_001251821.1|417249_417834_+|tail	tail protein	tail	A0A2H4JET9	uncultured_Caudovirales_phage	93.3	2.9e-98
WP_015382157.1|417890_418265_+	hypothetical protein	NA	A0A2H4JBU8	uncultured_Caudovirales_phage	86.8	1.8e-53
WP_015382160.1|423467_424937_+	hypothetical protein	NA	A0A0S2MV63	Bacillus_phage	78.3	6.5e-232
WP_015382161.1|424933_429328_+	hypothetical protein	NA	A0A0S2MVB4	Bacillus_phage	63.6	0.0e+00
WP_000354142.1|429344_429722_+	hypothetical protein	NA	A0A0S2MVE0	Bacillus_phage	59.5	8.4e-35
WP_000215408.1|429758_430040_+	hypothetical protein	NA	A0A0S2GM64	Bacillus_phage	81.7	2.4e-34
WP_000159646.1|430042_430249_+	hypothetical protein	NA	D2XR32	Bacillus_phage	97.1	1.3e-32
WP_000542507.1|430248_431067_+	N-acetylmuramoyl-L-alanine amidase	NA	A0A0S2GLD4	Bacillus_phage	95.6	1.6e-158
WP_002133890.1|431111_431420_-	YolD-like family protein	NA	NA	NA	NA	NA
WP_000794364.1|431716_432505_+	sulfotransferase family 2 domain-containing protein	NA	A0A288WG17	Bacillus_phage	51.4	2.8e-64
WP_000027993.1|432593_433367_+	sulfite exporter TauE/SafE family protein	NA	NA	NA	NA	NA
WP_000349585.1|433407_434199_+	sulfotransferase family 2 domain-containing protein	NA	A0A288WG17	Bacillus_phage	68.4	6.8e-103
WP_000247457.1|434267_434672_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001028065.1|434664_436674_-|integrase	tyrosine-type recombinase/integrase	integrase	NA	NA	NA	NA
WP_000477499.1|436670_437768_-|integrase	tyrosine-type recombinase/integrase	integrase	A0A0E3M2X0	Bacillus_phage	23.4	2.1e-09
WP_000566707.1|438427_439417_+|tRNA	tRNA-dihydrouridine synthase	tRNA	NA	NA	NA	NA
438223:438251	attR	ATACGACTCATGTGGAGTGTGTGGCTTGG	NA	NA	NA	NA
WP_001251702.1|439767_440286_+	DUF1456 family protein	NA	Q9EYF4	Enterobacteria_phage	36.5	4.3e-21
WP_000233735.1|440381_441089_+	M48 family metallopeptidase	NA	NA	NA	NA	NA
WP_000217543.1|441289_441985_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000704490.1|441999_443109_-	dipeptide epimerase	NA	Q6A202	Oenococcus_phage	25.6	5.0e-19
WP_000972812.1|443202_444474_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000853511.1|446176_447292_+	amidohydrolase	NA	NA	NA	NA	NA
WP_001005631.1|447526_448132_+	class I SAM-dependent methyltransferase	NA	NA	NA	NA	NA
WP_000924420.1|449707_450271_-	peroxiredoxin	NA	NA	NA	NA	NA
WP_000033255.1|450862_452092_+	S-methyl-5-thioribose kinase	NA	NA	NA	NA	NA
WP_003283000.1|452101_453148_+	S-methyl-5-thioribose-1-phosphate isomerase	NA	NA	NA	NA	NA
WP_000926553.1|453201_453843_+	L-fuculose-phosphate aldolase	NA	NA	NA	NA	NA
WP_000983744.1|453888_454896_-	iron ABC transporter permease	NA	NA	NA	NA	NA
WP_002100683.1|454892_455933_-	iron ABC transporter permease	NA	NA	NA	NA	NA
WP_000732593.1|455981_456899_-	iron-hydroxamate ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_001078266.1|457232_458282_+	NAD(P)/FAD-dependent oxidoreductase	NA	NA	NA	NA	NA
WP_000235475.1|458477_458846_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000276022.1|459041_459272_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_000051528.1|459507_460017_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000443836.1|460037_460487_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001004265.1|460648_461317_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000434752.1|461555_462821_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001046104.1|462958_464185_+	GHKL domain-containing protein	NA	NA	NA	NA	NA
WP_000424119.1|464413_464794_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000862985.1|464821_465454_-	cyclase family protein	NA	NA	NA	NA	NA
WP_000147471.1|465800_466910_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001208232.1|467021_467804_+	nucleotidyltransferase domain-containing protein	NA	Q8SCS5	Pseudomonas_phage	43.5	1.4e-44
WP_001182683.1|467817_469119_-	aromatic acid/H+ symport family MFS transporter	NA	NA	NA	NA	NA
WP_015382163.1|470254_471691_-|transposase	IS4-like element IS231C family transposase	transposase	NA	NA	NA	NA
>prophage 4
NC_020238	Bacillus thuringiensis serovar kurstaki str. HD73, complete sequence	5646799	758104	816038	5646799	capsid,protease,terminase,head,portal,integrase,transposase,tail	Bacillus_phage(86.21%)	66	767853:767871	813404:813422
WP_001252962.1|758104_760504_+|protease	M6 family metalloprotease domain-containing protein	protease	NA	NA	NA	NA
WP_000658667.1|760822_761164_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000964468.1|761185_761611_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000873276.1|761531_762686_-	MFS transporter	NA	NA	NA	NA	NA
WP_000645827.1|762911_763964_+	(R,R)-butanediol dehydrogenase	NA	E3SJ82	Synechococcus_phage	27.6	3.9e-21
WP_000948209.1|764083_764428_+	two pore domain potassium channel family protein	NA	NA	NA	NA	NA
WP_087970930.1|764471_765631_-|transposase	IS3-like element ISBth8 family transposase	transposase	A0A0C5AEA5	Paenibacillus_phage	42.0	2.5e-37
WP_000730997.1|765973_766825_+	phospholipase C	NA	NA	NA	NA	NA
WP_000676802.1|766901_767948_+	sphingomyelin phosphodiesterase	NA	A0A1P8L6H7	Staphylococcus_phage	59.0	1.1e-87
767853:767871	attL	AATGATTACTCTGATCATT	NA	NA	NA	NA
WP_000262047.1|767886_768987_-|integrase	site-specific integrase	integrase	A0A0S2GLI2	Bacillus_phage	100.0	8.6e-205
WP_000466636.1|769504_770743_+	hypothetical protein	NA	I7J4K0	Bacillus_phage	100.0	8.2e-236
WP_000511082.1|771142_771487_-	helix-turn-helix transcriptional regulator	NA	I7J6V3	Bacillus_phage	100.0	4.2e-57
WP_000813892.1|771635_771872_+	helix-turn-helix transcriptional regulator	NA	A0A0S2GLE0	Bacillus_phage	100.0	8.7e-38
WP_000549466.1|771904_772093_+	helix-turn-helix transcriptional regulator	NA	A0A0S2GLE9	Bacillus_phage	100.0	3.2e-27
WP_015382175.1|772318_773098_+	phage regulatory protein	NA	A0A0S2GLP8	Bacillus_phage	100.0	1.6e-141
WP_000218620.1|773259_773574_+	hypothetical protein	NA	A0A0S2GLB6	Bacillus_phage	100.0	1.1e-51
WP_000123128.1|773848_774496_+	sigma-70 family RNA polymerase sigma factor	NA	A0A0S2GLJ1	Bacillus_phage	100.0	1.8e-117
WP_015382176.1|774719_775736_+	hypothetical protein	NA	A0A0S2GLI6	Bacillus_phage	100.0	2.8e-189
WP_002133989.1|775698_776511_+	ATP-binding protein	NA	A0A0S2GLK2	Bacillus_phage	100.0	1.2e-155
WP_000436951.1|776552_776819_+	hypothetical protein	NA	A0A0S2GLK4	Bacillus_phage	100.0	7.7e-43
WP_000817807.1|776890_777055_+	DUF3954 domain-containing protein	NA	A0A0S2GLF5	Bacillus_phage	100.0	1.0e-24
WP_001025406.1|777072_777288_+	hypothetical protein	NA	A0A0S2GLC6	Bacillus_phage	100.0	8.7e-37
WP_000705118.1|777284_777584_-	hypothetical protein	NA	A0A0S2GLD6	Bacillus_phage	100.0	1.9e-50
WP_001098845.1|777734_778034_+	hypothetical protein	NA	A0A0S2GLL5	Bacillus_phage	100.0	2.7e-52
WP_000404184.1|778387_778795_+	hypothetical protein	NA	A0A0S2GLF8	Bacillus_phage	100.0	4.9e-73
WP_000965619.1|780203_780485_+	hypothetical protein	NA	A0A0S2GLD3	Bacillus_phage	100.0	8.7e-45
WP_000166155.1|780842_781328_+	ArpU family transcriptional regulator	NA	A0A0S2GLJ9	Bacillus_phage	99.4	1.8e-85
WP_001012176.1|781324_781867_+|integrase	site-specific integrase	integrase	A0A0S2GLG4	Bacillus_phage	100.0	3.3e-96
WP_015382178.1|782073_782319_+	hypothetical protein	NA	A0A0S2GLK0	Bacillus_phage	100.0	9.0e-38
WP_000792998.1|782690_782873_+	hypothetical protein	NA	A0A0S2GLH0	Bacillus_phage	100.0	3.1e-27
WP_001050326.1|782954_783821_+	hypothetical protein	NA	A0A0S2GLF7	Bacillus_phage	100.0	2.8e-166
WP_000443964.1|783869_784055_+	hypothetical protein	NA	A0A0S2GLH7	Bacillus_phage	100.0	8.6e-25
WP_000002720.1|784083_784323_+	hypothetical protein	NA	A0A0S2GLE8	Bacillus_phage	98.7	5.2e-22
WP_000778983.1|784339_784552_+	hypothetical protein	NA	A0A0S2GM40	Bacillus_phage	100.0	2.7e-30
WP_001198493.1|784687_784942_+	hypothetical protein	NA	A0A0S2GLL6	Bacillus_phage	100.0	3.9e-44
WP_001139459.1|784931_785309_+	HNH endonuclease	NA	A0A0S2GLI5	Bacillus_phage	100.0	6.8e-69
WP_000233388.1|785437_785941_+|terminase	phage terminase small subunit P27 family	terminase	A0A0S2GLF2	Bacillus_phage	100.0	8.0e-89
WP_015382179.1|785942_787637_+|terminase	terminase large subunit	terminase	A0A0S2GLF0	Bacillus_phage	100.0	0.0e+00
WP_162471174.1|787647_787821_+	hypothetical protein	NA	A0A2H4J4T1	uncultured_Caudovirales_phage	76.3	6.8e-08
WP_015382180.1|787826_789080_+|portal	phage portal protein	portal	A0A0S2GLJ4	Bacillus_phage	99.8	3.5e-242
WP_015382181.1|789066_789777_+|protease	Clp protease ClpP	protease	A0A0S2GLD5	Bacillus_phage	100.0	5.5e-128
WP_015382182.1|789814_790981_+|capsid	phage major capsid protein	capsid	A0A0S2GLG0	Bacillus_phage	100.0	3.3e-210
WP_000244586.1|791001_791289_+|head,tail	phage gp6-like head-tail connector protein	head,tail	A0A0S2GLH6	Bacillus_phage	100.0	1.8e-45
WP_015382183.1|791275_791599_+|head	phage head closure protein	head	H0USW8	Bacillus_phage	98.1	7.4e-56
WP_015382184.1|791591_792026_+	HK97 gp10 family phage protein	NA	H0USW9	Bacillus_phage	99.3	2.3e-76
WP_015382185.1|792022_792382_+	DUF3168 domain-containing protein	NA	A0A2H4JAR3	uncultured_Caudovirales_phage	95.8	2.7e-59
WP_000896775.1|792382_792988_+|tail	tail protein	tail	A0A288WG55	Bacillus_phage	88.6	1.1e-95
WP_015382186.1|793035_793353_+	hypothetical protein	NA	W8CYN3	Bacillus_phage	98.1	1.3e-52
WP_041184427.1|794727_794907_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000169371.1|795080_796388_+	group II intron reverse transcriptase/maturase	NA	H7BV92	unidentified_phage	24.2	1.7e-10
WP_162471175.1|797048_797195_+	hypothetical protein	NA	I3WTY5	Bacillus_phage	95.7	4.3e-19
WP_015382188.1|797209_801058_+|tail	phage tail tape measure protein	tail	A0A2H4J380	uncultured_Caudovirales_phage	90.9	0.0e+00
WP_000232880.1|801069_802554_+|tail	phage tail protein	tail	A0A0S2GLF9	Bacillus_phage	100.0	9.9e-297
WP_015382189.1|802550_806576_+	minor structural protein	NA	A0A0S2GLH1	Bacillus_phage	100.0	0.0e+00
WP_000822820.1|806672_807632_+|integrase	site-specific integrase	integrase	A0A0S2GLC8	Bacillus_phage	99.7	3.1e-182
WP_000151530.1|807645_807927_+	hypothetical protein	NA	A0A0S2GM64	Bacillus_phage	100.0	9.1e-42
WP_001076454.1|807929_808142_+	hypothetical protein	NA	A0A0S2GM50	Bacillus_phage	100.0	1.4e-34
WP_000542506.1|808141_808960_+	N-acetylmuramoyl-L-alanine amidase	NA	A0A0S2GLD4	Bacillus_phage	100.0	3.2e-164
WP_000423300.1|809000_809330_-	hypothetical protein	NA	A0A0S2GLG3	Bacillus_phage	100.0	2.4e-54
WP_000467327.1|809398_809620_-	helix-turn-helix transcriptional regulator	NA	A0A0S2GLH4	Bacillus_phage	100.0	2.9e-35
WP_000495118.1|810082_810403_+	hypothetical protein	NA	A0A0S2GLK1	Bacillus_phage	100.0	1.9e-51
WP_000511371.1|810413_811580_+	DNA translocase FtsK	NA	A0A0S2GLG9	Bacillus_phage	100.0	9.4e-226
WP_000842173.1|811569_812178_+	hypothetical protein	NA	A0A0S2GLL8	Bacillus_phage	100.0	3.3e-113
WP_000730127.1|812182_813064_-	HTH domain-containing protein	NA	I7ILW0	Bacillus_phage	100.0	1.5e-159
WP_000373746.1|813561_814734_+	amino acid deaminase/aldolase	NA	NA	NA	NA	NA
813404:813422	attR	AATGATTACTCTGATCATT	NA	NA	NA	NA
WP_000948949.1|814721_816038_+	FAD-binding protein	NA	A0A2K9L0J9	Tupanvirus	22.1	5.3e-07
>prophage 5
NC_020238	Bacillus thuringiensis serovar kurstaki str. HD73, complete sequence	5646799	1282707	1329029	5646799	holin,capsid,protease,terminase,head,transposase,portal,tail	Bacillus_phage(48.0%)	56	NA	NA
WP_000333967.1|1282707_1284486_+	asparagine synthase (glutamine-hydrolyzing)	NA	A0A1V0SGM7	Hokovirus	27.3	1.6e-22
WP_000650392.1|1284516_1285920_-	recombinase family protein	NA	A0A2I7SDG6	Paenibacillus_phage	44.8	1.5e-113
WP_000289677.1|1286063_1286282_-	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_000130922.1|1286297_1286981_-	LexA family transcriptional regulator	NA	D7RWF2	Brochothrix_phage	34.2	1.3e-22
WP_000385074.1|1287130_1287403_+	helix-turn-helix transcriptional regulator	NA	A0A141E0W0	Streptococcus_phage	50.0	3.0e-10
WP_000372563.1|1287885_1288638_+	phage regulatory protein	NA	A0A2H4JBC7	uncultured_Caudovirales_phage	81.0	4.8e-106
WP_001186272.1|1288649_1288838_+	hypothetical protein	NA	A0A2H4J4V8	uncultured_Caudovirales_phage	96.8	6.1e-26
WP_000453494.1|1288864_1289299_+	hypothetical protein	NA	A0A0S2MVA8	Bacillus_phage	99.3	1.1e-73
WP_000178947.1|1289317_1290031_+	hypothetical protein	NA	A0A0S2MV99	Bacillus_phage	98.3	1.0e-126
WP_015382226.1|1290030_1290246_+	hypothetical protein	NA	A0A1C8E9A6	Bacillus_phage	97.2	5.5e-31
WP_038413358.1|1290178_1290517_+	hypothetical protein	NA	A0A0S2MVH7	Bacillus_phage	96.4	2.6e-51
WP_000510888.1|1290610_1291564_+	DnaD domain protein	NA	A0A0S2MVA0	Bacillus_phage	90.2	6.4e-148
WP_000933912.1|1291575_1292055_+	hypothetical protein	NA	A0A2H4J396	uncultured_Caudovirales_phage	93.7	1.3e-80
WP_000139235.1|1292047_1292278_+	hypothetical protein	NA	A0A1C8E9C2	Bacillus_phage	100.0	2.5e-34
WP_015382228.1|1292301_1292859_+	hypothetical protein	NA	A0A1B1P7A6	Bacillus_phage	71.4	4.0e-65
WP_001010921.1|1292897_1293332_+	hypothetical protein	NA	A0A1C8E9B0	Bacillus_phage	95.1	1.3e-76
WP_001268033.1|1293390_1293681_+	hypothetical protein	NA	A0A1C8EA94	Bacillus_phage	94.8	8.4e-51
WP_001093039.1|1293827_1294619_+	prohibitin family protein	NA	A0A1C8E9A9	Bacillus_phage	100.0	6.8e-143
WP_000356654.1|1294703_1294886_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000389429.1|1295045_1295450_+	hypothetical protein	NA	I6TG10	Staphylococcus_virus	37.1	7.7e-10
WP_000590880.1|1295683_1295995_+	hypothetical protein	NA	A0A0A7AR06	Bacillus_phage	83.5	2.9e-41
WP_000540088.1|1296030_1296558_+	Holliday junction resolvase RecU	NA	A0A1C8E9C3	Bacillus_phage	98.3	5.4e-96
WP_000074646.1|1296554_1296881_+	hypothetical protein	NA	A0A1C8E9C1	Bacillus_phage	96.3	4.0e-57
WP_015382230.1|1296918_1297320_+	hypothetical protein	NA	A0A1C8E9D1	Bacillus_phage	97.7	6.8e-67
WP_000711196.1|1297703_1298123_-	HicB family protein	NA	A0A2H4J4X8	uncultured_Caudovirales_phage	79.9	7.6e-61
WP_071686481.1|1298174_1298357_-	type II toxin-antitoxin system HicA family toxin	NA	A0A0U4KLG1	Pseudomonas_phage	67.2	9.4e-16
WP_000499523.1|1298653_1299847_+|transposase	IS110-like element ISBth13 family transposase	transposase	A0A0U3ULR1	Bacillus_phage	26.1	1.1e-24
WP_000196707.1|1300118_1300319_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001051281.1|1300335_1300638_+	HNH endonuclease	NA	A0A1B0YEC6	Lactobacillus_phage	48.5	1.5e-18
WP_001149928.1|1300640_1301036_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001282601.1|1301128_1301491_+	hypothetical protein	NA	A0A290GJQ7	Caldibacillus_phage	43.5	2.4e-18
WP_033676369.1|1301499_1303188_+|terminase	terminase large subunit	terminase	A0A290GJW3	Caldibacillus_phage	72.6	3.9e-249
WP_000522435.1|1303201_1304380_+|portal	phage portal protein	portal	A0A0A8WJ25	Clostridium_phage	61.6	5.5e-141
WP_000499523.1|1304474_1305668_-|transposase	IS110-like element ISBth13 family transposase	transposase	A0A0U3ULR1	Bacillus_phage	26.1	1.1e-24
WP_000361708.1|1305964_1306549_+|head,protease	HK97 family phage prohead protease	head,protease	A0A2I7SBY1	Paenibacillus_phage	44.6	2.7e-32
WP_001031425.1|1306565_1307750_+|capsid	phage major capsid protein	capsid	A0A2I4R671	Erysipelothrix_phage	24.4	5.1e-09
WP_001016250.1|1307765_1308023_+	hypothetical protein	NA	A6XMJ7	Bacillus_virus	43.2	1.1e-06
WP_000600950.1|1308019_1308292_+	DNA-packaging protein	NA	R9TMB7	Paenibacillus_phage	53.9	3.0e-18
WP_000998123.1|1308288_1308588_+|head	phage head closure protein	head	NA	NA	NA	NA
WP_001273706.1|1308580_1308937_+	HK97 gp10 family phage protein	NA	D2XR21	Bacillus_phage	60.7	3.0e-34
WP_000172080.1|1308933_1309263_+	hypothetical protein	NA	A0A2H4JAG4	uncultured_Caudovirales_phage	83.5	2.9e-47
WP_001004921.1|1309263_1309857_+|tail	phage tail protein	tail	A0A2H4JDV4	uncultured_Caudovirales_phage	93.3	6.7e-103
WP_000415929.1|1309863_1310226_+	hypothetical protein	NA	A0A2H4JAG8	uncultured_Caudovirales_phage	70.0	6.8e-42
WP_015382231.1|1310456_1314089_+	hypothetical protein	NA	A0A2H4JAI2	uncultured_Caudovirales_phage	84.1	2.4e-182
WP_000094123.1|1314130_1315600_+|tail	phage tail protein	tail	A0A0S2MV63	Bacillus_phage	79.6	2.8e-235
WP_015382232.1|1315596_1320441_+	hypothetical protein	NA	A0A0S2MVB4	Bacillus_phage	83.4	0.0e+00
WP_001004976.1|1320456_1320831_+	hypothetical protein	NA	A0A0S2MVE0	Bacillus_phage	98.4	2.7e-65
WP_000499523.1|1320962_1322156_-|transposase	IS110-like element ISBth13 family transposase	transposase	A0A0U3ULR1	Bacillus_phage	26.1	1.1e-24
WP_000373898.1|1322451_1322877_+|holin	phage holin family protein	holin	A0A0S2MVC4	Bacillus_phage	100.0	2.6e-72
WP_000405773.1|1322876_1323809_+	N-acetylmuramoyl-L-alanine amidase	NA	A0A0S2MVR5	Bacillus_phage	84.2	3.3e-157
WP_000742862.1|1323974_1324541_-	hypothetical protein	NA	A6XML2	Bacillus_virus	45.7	5.9e-24
WP_001016122.1|1324680_1324899_+	hypothetical protein	NA	A0A2H4JC50	uncultured_Caudovirales_phage	90.3	3.6e-30
WP_000100788.1|1324923_1325214_+	hypothetical protein	NA	A0A1C8E992	Bacillus_phage	90.7	9.3e-42
WP_000730207.1|1325231_1326065_-	hypothetical protein	NA	A0A2H4J6G7	uncultured_Caudovirales_phage	81.9	2.6e-121
WP_000163133.1|1326543_1327503_+	ferrochelatase	NA	NA	NA	NA	NA
WP_001069180.1|1327562_1329029_+	catalase	NA	A0A2K9L572	Tupanvirus	47.4	1.0e-123
>prophage 6
NC_020238	Bacillus thuringiensis serovar kurstaki str. HD73, complete sequence	5646799	2022229	2030380	5646799		Bacillus_phage(66.67%)	7	NA	NA
WP_000755525.1|2022229_2023510_+	C40 family peptidase	NA	A0A1V0DZX6	Clostridioides_phage	31.5	3.4e-11
WP_001194306.1|2023609_2024374_-	alpha/beta hydrolase	NA	NA	NA	NA	NA
WP_000453861.1|2024614_2026375_+	ABC transporter ATP-binding protein	NA	W8CYL7	Bacillus_phage	98.0	2.4e-273
WP_000612414.1|2026460_2027138_+	response regulator transcription factor	NA	W8CYM9	Bacillus_phage	99.1	1.1e-122
WP_001231621.1|2027134_2028208_+	HAMP domain-containing sensor histidine kinase	NA	W8CYF6	Bacillus_phage	98.0	6.1e-187
WP_000818979.1|2028497_2029217_+	3-ketoacyl-ACP reductase	NA	W8CYX9	Bacillus_phage	100.0	5.9e-61
WP_001258538.1|2029507_2030380_+	aminoglycoside 6-adenylyltransferase	NA	A0A1X9I6F2	Streptococcus_phage	44.7	2.1e-65
>prophage 7
NC_020238	Bacillus thuringiensis serovar kurstaki str. HD73, complete sequence	5646799	2034212	2094988	5646799	protease,transposase	Bacillus_phage(33.33%)	59	NA	NA
WP_015382261.1|2034212_2035406_-|transposase	IS110-like element ISBth13 family transposase	transposase	A0A0U3ULR1	Bacillus_phage	26.4	1.5e-24
WP_001066899.1|2035809_2037105_+	homoserine dehydrogenase	NA	NA	NA	NA	NA
WP_000276439.1|2037097_2038156_+	threonine synthase	NA	NA	NA	NA	NA
WP_000612105.1|2038152_2039046_+	homoserine kinase	NA	NA	NA	NA	NA
WP_001031481.1|2039177_2039387_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000738151.1|2039594_2041898_+	glycoside hydrolase	NA	NA	NA	NA	NA
WP_002100920.1|2042218_2043220_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001174860.1|2043385_2044633_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000036070.1|2044645_2045335_+	response regulator transcription factor	NA	W8CYM9	Bacillus_phage	33.6	1.4e-30
WP_000824531.1|2045331_2046690_+	HAMP domain-containing histidine kinase	NA	W8CYF6	Bacillus_phage	31.3	3.7e-40
WP_000409482.1|2046791_2047613_+	polysaccharide deacetylase	NA	NA	NA	NA	NA
WP_000873565.1|2047627_2048284_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000119510.1|2048443_2049124_+	MgtC/SapB family protein	NA	G3MA03	Bacillus_virus	41.0	2.2e-17
WP_002100922.1|2049217_2049754_+	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_000710470.1|2050341_2051499_+|transposase	IS200/IS605 family element transposase accessory protein TnpB	transposase	Q331V1	Clostridium_botulinum_C_phage	59.0	1.8e-123
WP_001163356.1|2051655_2053464_+	Petrobactin biosynthesis protein AsbA	NA	NA	NA	NA	NA
WP_000798699.1|2054190_2054943_-	ATP-binding protein	NA	A0A059NT77	Lactococcus_phage	47.3	7.0e-57
WP_000275580.1|2054932_2056228_-|transposase	IS21-like element IS232 family transposase	transposase	A0A2L1IVA1	Escherichia_phage	28.8	5.3e-12
WP_000909581.1|2057538_2058777_+	AMP-binding protein	NA	NA	NA	NA	NA
WP_001250558.1|2058773_2059040_+	petrobactin biosynthesis protein AsbD	NA	NA	NA	NA	NA
WP_000200704.1|2059063_2060047_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000877670.1|2060084_2060927_+	sugar phosphate isomerase/epimerase	NA	NA	NA	NA	NA
WP_000113545.1|2061051_2061258_+	alpha/beta-type small acid-soluble spore protein	NA	Q77YX0	Bacillus_phage	63.1	3.4e-14
WP_033667350.1|2061493_2062723_+	MFS transporter	NA	NA	NA	NA	NA
WP_001287305.1|2062776_2063391_-	amino acid transporter	NA	NA	NA	NA	NA
WP_000439399.1|2063509_2064952_+	PLP-dependent aminotransferase family protein	NA	NA	NA	NA	NA
WP_000816391.1|2064964_2065132_+	DUF3933 family protein	NA	NA	NA	NA	NA
WP_000686789.1|2065245_2066211_-	patatin-like phospholipase family protein	NA	A0A1V0SKV5	Klosneuvirus	31.2	1.1e-25
WP_000540423.1|2066298_2066439_-	YjcZ family sporulation protein	NA	NA	NA	NA	NA
WP_001034835.1|2066662_2067415_+	DUF1963 domain-containing protein	NA	NA	NA	NA	NA
WP_000520856.1|2067565_2068726_+	peptidase	NA	NA	NA	NA	NA
WP_001048102.1|2068831_2069029_+	DUF4083 domain-containing protein	NA	NA	NA	NA	NA
WP_000024999.1|2069060_2069522_+	NUDIX hydrolase	NA	A0A2I6PFL2	Proteus_phage	35.1	8.5e-05
WP_000174901.1|2069571_2070390_-	ammonia-dependent NAD(+) synthetase	NA	G3MA24	Bacillus_virus	63.3	1.7e-93
WP_001026002.1|2070665_2072546_+	ABC transporter permease	NA	NA	NA	NA	NA
WP_000648325.1|2072661_2072949_+	AbrB/MazE/SpoVT family DNA-binding domain-containing protein	NA	A0A2I7SC16	Paenibacillus_phage	56.5	1.2e-12
WP_000099756.1|2073223_2074171_+|protease	serine protease	protease	A0A127AWU5	Bacillus_phage	57.4	1.4e-94
WP_001259906.1|2074212_2074521_-	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_000874082.1|2074627_2075563_+	aldo/keto reductase	NA	NA	NA	NA	NA
WP_001082497.1|2075610_2076786_+	MFS transporter	NA	NA	NA	NA	NA
WP_001101741.1|2076834_2077041_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001198794.1|2077184_2077547_+	DUF805 domain-containing protein	NA	NA	NA	NA	NA
WP_000162602.1|2077746_2077971_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000426317.1|2078055_2078403_-	DUF4257 domain-containing protein	NA	NA	NA	NA	NA
WP_001073075.1|2079308_2080361_+	ribosome small subunit-dependent GTPase A	NA	NA	NA	NA	NA
WP_000517294.1|2080557_2082540_+	methyl-accepting chemotaxis protein	NA	A0A2H4J162	uncultured_Caudovirales_phage	31.0	3.5e-23
WP_000539571.1|2082736_2083042_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000965059.1|2083364_2083730_+	DUF3979 family protein	NA	NA	NA	NA	NA
WP_000370203.1|2083764_2084805_-	membrane protein	NA	NA	NA	NA	NA
WP_000105199.1|2085045_2085489_+	DNA starvation/stationary phase protection protein	NA	A0A0A7RTZ1	Clostridium_phage	62.1	6.2e-45
WP_000488206.1|2085591_2086047_+	DUF3939 domain-containing protein	NA	NA	NA	NA	NA
WP_000798320.1|2086262_2087207_+	hypothetical protein	NA	NA	NA	NA	NA
WP_096001707.1|2087267_2088610_-|transposase	IS3 family transposase	transposase	A0A1B1P773	Bacillus_phage	37.3	3.7e-32
WP_000594031.1|2088722_2089724_-	LLM class flavin-dependent oxidoreductase	NA	NA	NA	NA	NA
WP_000683357.1|2089828_2090020_-	DUF3896 family protein	NA	NA	NA	NA	NA
WP_001168116.1|2090197_2091661_+	flavin monoamine oxidase family protein	NA	A0A2K9L022	Tupanvirus	22.3	1.2e-15
WP_001068749.1|2091745_2092330_+	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_000376357.1|2092354_2093257_-	aldo/keto reductase family oxidoreductase	NA	NA	NA	NA	NA
WP_001040871.1|2093518_2094988_+|transposase	IS200/IS605 family element transposase accessory protein TnpB	transposase	G3MB42	Bacillus_virus	41.7	2.7e-68
>prophage 8
NC_020238	Bacillus thuringiensis serovar kurstaki str. HD73, complete sequence	5646799	2109374	2185540	5646799	portal,capsid,protease,bacteriocin,terminase,head,coat,integrase,transposase,tail	Bacillus_phage(91.67%)	82	2138968:2138986	2185885:2185903
WP_000937997.1|2109374_2110451_+|coat	spore coat protein CotH	coat	NA	NA	NA	NA
WP_000153584.1|2110556_2111174_+	NUDIX hydrolase	NA	NA	NA	NA	NA
WP_000880691.1|2111278_2111881_+	DedA family protein	NA	NA	NA	NA	NA
WP_000678847.1|2111977_2113357_+	polysaccharide biosynthesis protein	NA	NA	NA	NA	NA
WP_000932389.1|2113691_2114633_+	magnesium transporter CorA family protein	NA	NA	NA	NA	NA
WP_000418716.1|2114831_2115728_+	permease	NA	NA	NA	NA	NA
WP_000488043.1|2115731_2116601_+	TIGR03943 family protein	NA	NA	NA	NA	NA
WP_000141164.1|2116720_2117227_+	acyl-CoA thioesterase	NA	NA	NA	NA	NA
WP_000505094.1|2117352_2117439_-	YjcZ family sporulation protein	NA	NA	NA	NA	NA
WP_002004934.1|2117599_2118784_+	cardiolipin synthase	NA	NA	NA	NA	NA
WP_000340535.1|2118815_2119274_+|coat	spore coat protein	coat	NA	NA	NA	NA
WP_001045960.1|2119499_2119679_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000861653.1|2119780_2120404_+	SDR family oxidoreductase	NA	NA	NA	NA	NA
WP_000217338.1|2120428_2120911_-	DUF456 family protein	NA	NA	NA	NA	NA
WP_000353738.1|2120912_2122220_-	HlyC/CorC family transporter	NA	NA	NA	NA	NA
WP_000055257.1|2122428_2123298_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001220524.1|2123555_2124203_+	CBS domain-containing protein	NA	NA	NA	NA	NA
WP_087942842.1|2124262_2125608_-|transposase	IS3-like element ISBth10 family transposase	transposase	A0A1B1P773	Bacillus_phage	74.4	3.6e-112
WP_000839661.1|2126084_2127431_+	branched-chain amino acid transport system II carrier protein	NA	NA	NA	NA	NA
WP_001263016.1|2127496_2127826_+	chaperone CsaA	NA	NA	NA	NA	NA
WP_000435828.1|2127806_2128373_+	DUF1572 family protein	NA	NA	NA	NA	NA
WP_016109792.1|2128345_2128651_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000770738.1|2128655_2128952_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001079274.1|2129040_2130195_+	stage II sporulation protein P	NA	NA	NA	NA	NA
WP_000617573.1|2130450_2130948_+	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_000178288.1|2131724_2132171_+	NUDIX domain-containing protein	NA	NA	NA	NA	NA
WP_000405394.1|2132353_2133829_+	amidase	NA	NA	NA	NA	NA
WP_001245226.1|2133878_2135096_-	MFS transporter	NA	NA	NA	NA	NA
WP_000741975.1|2135370_2135799_+	NfeD family protein	NA	NA	NA	NA	NA
WP_000226253.1|2135801_2136770_+	SPFH/Band 7/PHB domain protein	NA	NA	NA	NA	NA
WP_002004921.1|2136840_2137995_+	stage II sporulation protein P	NA	NA	NA	NA	NA
WP_001166434.1|2138084_2138675_+	histidine phosphatase family protein	NA	NA	NA	NA	NA
2138968:2138986	attL	ATGGTCACAGTGTTTCTTA	NA	NA	NA	NA
WP_000237493.1|2139006_2140098_-|integrase	site-specific integrase	integrase	A0A0S2GLI2	Bacillus_phage	79.8	8.1e-163
WP_000936291.1|2140837_2142058_+	hypothetical protein	NA	A0A0U3TNF6	Bacillus_phage	49.5	2.2e-108
WP_000258007.1|2142457_2142802_-	helix-turn-helix domain-containing protein	NA	H0UST7	Bacillus_phage	40.6	1.2e-14
WP_000714354.1|2142977_2143184_+	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_000549467.1|2143259_2143448_+	helix-turn-helix transcriptional regulator	NA	W8CYN7	Bacillus_phage	95.2	1.4e-25
WP_015382272.1|2143673_2144417_+	phage regulatory protein	NA	A0A0S2GLP8	Bacillus_phage	76.4	2.9e-103
WP_000176230.1|2144578_2144887_+	hypothetical protein	NA	W8CYU1	Bacillus_phage	92.6	2.2e-41
WP_038415676.1|2144910_2145558_+	sigma-70 family RNA polymerase sigma factor	NA	A0A0S2GLJ1	Bacillus_phage	96.3	3.9e-112
WP_015382274.1|2145801_2146818_+	hypothetical protein	NA	A0A0S2GLI6	Bacillus_phage	97.6	2.0e-187
WP_002133989.1|2146780_2147593_+	ATP-binding protein	NA	A0A0S2GLK2	Bacillus_phage	100.0	1.2e-155
WP_000436951.1|2147634_2147901_+	hypothetical protein	NA	A0A0S2GLK4	Bacillus_phage	100.0	7.7e-43
WP_000817807.1|2147972_2148137_+	DUF3954 domain-containing protein	NA	A0A0S2GLF5	Bacillus_phage	100.0	1.0e-24
WP_001025406.1|2148154_2148370_+	hypothetical protein	NA	A0A0S2GLC6	Bacillus_phage	100.0	8.7e-37
WP_000705118.1|2148366_2148666_-	hypothetical protein	NA	A0A0S2GLD6	Bacillus_phage	100.0	1.9e-50
WP_001098845.1|2148816_2149116_+	hypothetical protein	NA	A0A0S2GLL5	Bacillus_phage	100.0	2.7e-52
WP_000404184.1|2149469_2149877_+	hypothetical protein	NA	A0A0S2GLF8	Bacillus_phage	100.0	4.9e-73
WP_000965619.1|2151285_2151567_+	hypothetical protein	NA	A0A0S2GLD3	Bacillus_phage	100.0	8.7e-45
WP_000166155.1|2151924_2152410_+	ArpU family transcriptional regulator	NA	A0A0S2GLJ9	Bacillus_phage	99.4	1.8e-85
WP_001012176.1|2152406_2152949_+|integrase	site-specific integrase	integrase	A0A0S2GLG4	Bacillus_phage	100.0	3.3e-96
WP_015382276.1|2153155_2153401_+	hypothetical protein	NA	W8CYG8	Bacillus_phage	97.5	6.5e-36
WP_000017440.1|2153803_2154091_+	hypothetical protein	NA	H0USV6	Bacillus_phage	91.6	1.7e-43
WP_000464752.1|2154127_2154355_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000443965.1|2154400_2154580_+	hypothetical protein	NA	W8CYF7	Bacillus_phage	98.3	6.0e-23
WP_000002725.1|2154614_2154854_+	hypothetical protein	NA	W8CZ42	Bacillus_phage	93.7	1.1e-16
WP_001139454.1|2155462_2155840_+	HNH endonuclease	NA	A0A0S2GLI5	Bacillus_phage	94.4	2.1e-65
WP_000233390.1|2155969_2156473_+|terminase	phage terminase small subunit P27 family	terminase	A0A0S2GLF2	Bacillus_phage	99.4	1.0e-88
WP_000621131.1|2156474_2158169_+|terminase	terminase large subunit	terminase	A0A0S2GLF0	Bacillus_phage	99.6	0.0e+00
WP_015382180.1|2158357_2159611_+|portal	phage portal protein	portal	A0A0S2GLJ4	Bacillus_phage	99.8	3.5e-242
WP_001259159.1|2159597_2160308_+|protease	Clp protease ClpP	protease	W8CYT5	Bacillus_phage	95.8	2.4e-123
WP_015382278.1|2160345_2161512_+|capsid	phage major capsid protein	capsid	W8CYN2	Bacillus_phage	96.9	1.0e-208
WP_000244586.1|2161532_2161820_+|head,tail	phage gp6-like head-tail connector protein	head,tail	A0A0S2GLH6	Bacillus_phage	100.0	1.8e-45
WP_015382183.1|2161806_2162130_+|head	phage head closure protein	head	H0USW8	Bacillus_phage	98.1	7.4e-56
WP_015382184.1|2162122_2162557_+	HK97 gp10 family phage protein	NA	H0USW9	Bacillus_phage	99.3	2.3e-76
WP_015382185.1|2162553_2162913_+	DUF3168 domain-containing protein	NA	A0A2H4JAR3	uncultured_Caudovirales_phage	95.8	2.7e-59
WP_000896775.1|2162913_2163519_+|tail	tail protein	tail	A0A288WG55	Bacillus_phage	88.6	1.1e-95
WP_015382186.1|2163566_2163884_+	hypothetical protein	NA	W8CYN3	Bacillus_phage	98.1	1.3e-52
WP_001100112.1|2165258_2165438_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000169371.1|2165611_2166919_+	group II intron reverse transcriptase/maturase	NA	H7BV92	unidentified_phage	24.2	1.7e-10
WP_162471176.1|2167579_2167726_+	hypothetical protein	NA	I3WTY5	Bacillus_phage	97.9	5.0e-20
WP_015382283.1|2173082_2177108_+	minor structural protein	NA	A0A0S2GLH1	Bacillus_phage	90.2	0.0e+00
WP_015382284.1|2177210_2178170_+|integrase	site-specific integrase	integrase	D2XR30	Bacillus_phage	94.0	1.5e-173
WP_000499524.1|2178304_2179498_-|transposase	IS110 family transposase	transposase	A0A0U3ULR1	Bacillus_phage	25.1	1.2e-23
WP_000389067.1|2179793_2180024_+|bacteriocin	bacteriocin biosynthesis protein	bacteriocin	A0A1B1P7Q9	Bacillus_phage	93.4	5.3e-32
WP_000669561.1|2181155_2181959_-	hypothetical protein	NA	A6M971	Geobacillus_virus	41.3	5.4e-23
WP_000941958.1|2181958_2182165_-	helix-turn-helix transcriptional regulator	NA	A0A288WG80	Bacillus_phage	41.5	4.1e-07
WP_001257568.1|2182353_2182668_+	hypothetical protein	NA	H0USY0	Bacillus_phage	96.2	7.7e-50
WP_000170790.1|2182664_2182847_+	hypothetical protein	NA	A0A288WGN6	Bacillus_phage	90.0	1.1e-21
WP_000891545.1|2182962_2184144_+	cell division protein FtsK	NA	H0USY1	Bacillus_phage	93.4	1.9e-213
WP_000551102.1|2184085_2184706_+	hypothetical protein	NA	H0USY2	Bacillus_phage	96.1	8.3e-112
WP_015382287.1|2184715_2185540_-	helix-turn-helix domain-containing protein	NA	A0A2H4J969	uncultured_Caudovirales_phage	66.9	9.6e-100
2185885:2185903	attR	ATGGTCACAGTGTTTCTTA	NA	NA	NA	NA
>prophage 9
NC_020238	Bacillus thuringiensis serovar kurstaki str. HD73, complete sequence	5646799	2234826	2291374	5646799	integrase,transposase	Bacillus_phage(33.33%)	53	2256075:2256091	2293813:2293829
WP_001236344.1|2234826_2236056_+|transposase	IS110-like element ISBth166 family transposase	transposase	M1NSC9	Streptococcus_phage	49.4	1.7e-84
WP_000675562.1|2236395_2236974_+	sigma-70 family RNA polymerase sigma factor	NA	NA	NA	NA	NA
WP_001174543.1|2237709_2238144_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000754973.1|2238230_2239202_-	MBL fold metallo-hydrolase	NA	NA	NA	NA	NA
WP_001236345.1|2239557_2240787_+|transposase	IS110 family transposase	transposase	M1NSC9	Streptococcus_phage	49.4	4.5e-85
WP_000844984.1|2241016_2241226_-	DUF3925 domain-containing protein	NA	NA	NA	NA	NA
WP_000219434.1|2241449_2241932_+	glutathione peroxidase	NA	Q70H87	Fowlpox_virus	40.6	3.5e-25
WP_002134082.1|2242015_2244244_-	DUF4129 domain-containing protein	NA	NA	NA	NA	NA
WP_000827540.1|2244240_2245455_-	DUF58 domain-containing protein	NA	NA	NA	NA	NA
WP_001135816.1|2245454_2246417_-	MoxR family ATPase	NA	NA	NA	NA	NA
WP_001236345.1|2247056_2248286_-|transposase	IS110 family transposase	transposase	M1NSC9	Streptococcus_phage	49.4	4.5e-85
WP_000730783.1|2248641_2252325_+	nitrate reductase subunit alpha	NA	NA	NA	NA	NA
WP_000692704.1|2252314_2253790_+	nitrate reductase subunit beta	NA	A0A077SL61	Escherichia_phage	47.3	1.2e-20
WP_001249921.1|2253809_2254340_+	nitrate reductase molybdenum cofactor assembly chaperone	NA	NA	NA	NA	NA
WP_000969223.1|2254357_2255047_+	respiratory nitrate reductase subunit gamma	NA	NA	NA	NA	NA
WP_000013866.1|2255183_2255876_-	Crp/Fnr family transcriptional regulator	NA	NA	NA	NA	NA
2256075:2256091	attL	TGTAGCTTCTTTTTTAT	NA	NA	NA	NA
WP_000545028.1|2256153_2257167_+	GTP 3',8-cyclase MoaA	NA	NA	NA	NA	NA
WP_001158130.1|2257184_2258198_+	molybdopterin-synthase adenylyltransferase MoeB	NA	NA	NA	NA	NA
WP_000884821.1|2258241_2259531_+	molybdopterin molybdotransferase MoeA	NA	NA	NA	NA	NA
WP_000616827.1|2259575_2259998_+	molybdenum cofactor biosynthesis protein MoaE	NA	NA	NA	NA	NA
WP_000573683.1|2259994_2260228_+	molybdopterin converting factor subunit 1	NA	NA	NA	NA	NA
WP_000841857.1|2260308_2261478_+	nitrate transporter NarK	NA	NA	NA	NA	NA
WP_000043362.1|2261790_2262168_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000282595.1|2262358_2262832_-	precorrin-2 dehydrogenase	NA	NA	NA	NA	NA
WP_000676479.1|2262824_2263535_-	sirohydrochlorin chelatase	NA	NA	NA	NA	NA
WP_001014978.1|2263531_2264956_-	uroporphyrin-III C-methyltransferase	NA	NA	NA	NA	NA
WP_000616694.1|2265014_2265332_-	nitrite reductase small subunit NirD	NA	NA	NA	NA	NA
WP_000746917.1|2265347_2267753_-	NADPH-nitrite reductase large subunit	NA	NA	NA	NA	NA
WP_000401358.1|2267961_2268669_-	iron-sulfur cluster repair di-iron protein	NA	NA	NA	NA	NA
WP_000025813.1|2268871_2269690_-	calcium-binding protein	NA	NA	NA	NA	NA
WP_000395679.1|2269898_2270051_+	exosporium protein ExsG	NA	NA	NA	NA	NA
WP_000824207.1|2270267_2270477_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000988430.1|2270573_2271413_-	acetyltransferase	NA	NA	NA	NA	NA
WP_001238710.1|2271944_2273546_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000536153.1|2273698_2274247_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000427801.1|2274857_2275133_+	stage V sporulation protein S	NA	J9PTX7	Bacillus_phage	41.2	2.9e-08
WP_000071989.1|2275353_2275593_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000283853.1|2275760_2276216_+	HNH endonuclease	NA	NA	NA	NA	NA
WP_003284113.1|2276477_2276786_-	YolD-like family protein	NA	NA	NA	NA	NA
WP_015382294.1|2277082_2277871_+	sulfotransferase family 2 domain-containing protein	NA	A0A288WG17	Bacillus_phage	51.4	2.8e-64
WP_000027993.1|2277959_2278733_+	sulfite exporter TauE/SafE family protein	NA	NA	NA	NA	NA
WP_000349585.1|2278773_2279565_+	sulfotransferase family 2 domain-containing protein	NA	A0A288WG17	Bacillus_phage	68.4	6.8e-103
WP_000247457.1|2279633_2280038_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001028065.1|2280030_2282040_-|integrase	tyrosine-type recombinase/integrase	integrase	NA	NA	NA	NA
WP_000477499.1|2282036_2283134_-|integrase	tyrosine-type recombinase/integrase	integrase	A0A0E3M2X0	Bacillus_phage	23.4	2.1e-09
WP_000109863.1|2283514_2284588_+	tetratricopeptide repeat protein	NA	A0A2H4J8G3	uncultured_Caudovirales_phage	43.7	1.8e-74
WP_000709202.1|2284584_2284710_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000499723.1|2285006_2285771_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000165969.1|2285880_2286528_+	HD domain-containing protein	NA	S4W232	Pandoravirus	28.3	9.5e-10
WP_000783186.1|2286524_2288420_+	ABC-F family ATP-binding cassette domain-containing protein	NA	A0A2H4UUX5	Bodo_saltans_virus	25.5	2.2e-46
WP_001260655.1|2288495_2289227_+	Bax inhibitor-1/YccA family protein	NA	NA	NA	NA	NA
WP_000975140.1|2289332_2289587_+	DUF4318 domain-containing protein	NA	NA	NA	NA	NA
WP_000116992.1|2289943_2291374_-|transposase	IS4 family transposase	transposase	NA	NA	NA	NA
2293813:2293829	attR	ATAAAAAAGAAGCTACA	NA	NA	NA	NA
>prophage 10
NC_020238	Bacillus thuringiensis serovar kurstaki str. HD73, complete sequence	5646799	4634397	4642083	5646799		Bacillus_phage(33.33%)	9	NA	NA
WP_000221066.1|4634397_4635321_-	ABC transporter ATP-binding protein	NA	A0A2H4PQG7	Staphylococcus_phage	43.5	1.5e-45
WP_000609140.1|4635446_4636382_-	HAMP domain-containing histidine kinase	NA	W8CYF6	Bacillus_phage	24.8	9.2e-22
WP_000018029.1|4636383_4637076_-	response regulator transcription factor	NA	W8CYM9	Bacillus_phage	38.2	3.7e-36
WP_001014310.1|4637418_4637613_+	YwbE family protein	NA	NA	NA	NA	NA
WP_001255971.1|4637651_4638851_-	class I SAM-dependent rRNA methyltransferase	NA	W6LLI2	Streptococcus_phage	41.2	1.6e-71
WP_000587826.1|4639146_4639470_+	heme oxygenase	NA	NA	NA	NA	NA
WP_001086121.1|4639542_4640307_-	class B sortase	NA	NA	NA	NA	NA
WP_000403760.1|4640339_4641110_-	ABC transporter ATP-binding protein	NA	W6JKT0	Anomala_cuprea_entomopoxvirus	28.6	7.6e-14
WP_001036847.1|4641099_4642083_-	iron ABC transporter permease	NA	A0A2H4IY97	uncultured_Caudovirales_phage	27.2	2.5e-17
>prophage 11
NC_020238	Bacillus thuringiensis serovar kurstaki str. HD73, complete sequence	5646799	4993419	5084130	5646799	holin,tRNA,capsid,protease,terminase,coat,head,portal,integrase,transposase,tail	Bacillus_phage(78.69%)	95	4987946:4987965	5076364:5076383
4987946:4987965	attL	TTTTGTCGGTAAATCGATAT	NA	NA	NA	NA
WP_000287147.1|4993419_4994796_+|tRNA	glycine--tRNA ligase	tRNA	A0A1V0SIF1	Klosneuvirus	27.9	5.8e-49
WP_096001715.1|4994909_4996251_+|transposase	IS3 family transposase	transposase	A0A1B1P773	Bacillus_phage	37.3	8.2e-32
WP_001140612.1|4996306_4996690_-	hotdog fold thioesterase	NA	NA	NA	NA	NA
WP_000810336.1|4996785_4997529_+	DUF3298 and DUF4163 domain-containing protein	NA	NA	NA	NA	NA
WP_001252163.1|4997579_4998173_+	biotin transporter BioY	NA	NA	NA	NA	NA
WP_002097988.1|4998218_4999106_-	UTP--glucose-1-phosphate uridylyltransferase GalU	NA	A0A127AW70	Bacillus_phage	54.1	7.0e-80
WP_001104221.1|4999213_5000938_-	phospho-sugar mutase	NA	A0A1X9I671	Streptococcus_phage	53.5	1.6e-176
WP_000545253.1|5001081_5001687_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000487942.1|5001861_5003346_-	cytosol aminopeptidase	NA	Q6GYZ8	Mycoplasma_phage	36.9	8.7e-59
WP_000920098.1|5003505_5004132_-	3D domain-containing protein	NA	A0A0H3UZG2	Geobacillus_virus	42.1	6.1e-14
WP_000027016.1|5004218_5004536_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000415321.1|5004532_5005039_-	NUDIX hydrolase	NA	NA	NA	NA	NA
WP_000856612.1|5005162_5006371_-	NAD(P)/FAD-dependent oxidoreductase	NA	NA	NA	NA	NA
WP_000829788.1|5006832_5007822_+	NAD(P)/FAD-dependent oxidoreductase	NA	Q9JRK7	Streptococcus_phage	52.4	3.0e-31
WP_000815771.1|5007934_5017906_-	DUF11 domain-containing protein	NA	NA	NA	NA	NA
WP_000902159.1|5018376_5018856_+	AraC family transcriptional regulator	NA	NA	NA	NA	NA
WP_000391942.1|5019021_5020269_+	MFS transporter	NA	NA	NA	NA	NA
WP_000535259.1|5020286_5021168_-	decarboxylase	NA	NA	NA	NA	NA
WP_000635484.1|5021247_5021709_+	DUF523 domain-containing protein	NA	NA	NA	NA	NA
WP_000710530.1|5022031_5022859_+	hypothetical protein	NA	A0A2H4J6G7	uncultured_Caudovirales_phage	69.5	1.8e-101
WP_000551103.1|5022868_5023489_-	hypothetical protein	NA	H0USY2	Bacillus_phage	93.2	6.5e-109
WP_000891535.1|5023430_5024612_-	cell division protein FtsK	NA	H0USY1	Bacillus_phage	94.4	9.0e-216
WP_000170777.1|5024727_5024910_-	hypothetical protein	NA	Q2I8E2	Bacillus_phage	90.0	1.4e-22
WP_001257569.1|5024906_5025224_-	hypothetical protein	NA	H0USY0	Bacillus_phage	98.1	6.4e-52
WP_000649833.1|5025406_5025604_+	helix-turn-helix transcriptional regulator	NA	A0A288WG80	Bacillus_phage	76.2	3.4e-19
WP_001137905.1|5025612_5025792_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000043398.1|5025797_5026376_+	type IV secretory system conjugative DNA transfer family protein	NA	H0USX9	Bacillus_phage	88.5	2.2e-95
WP_000119484.1|5026429_5026768_+	hypothetical protein	NA	A0A1B1P7R0	Bacillus_phage	92.9	4.6e-48
WP_000579579.1|5027075_5028326_-|transposase	IS110 family transposase	transposase	A0A1X9I619	Streptococcus_phage	41.9	2.7e-69
WP_000405777.1|5030376_5031078_-	N-acetylmuramoyl-L-alanine amidase	NA	W8CZ46	Bacillus_phage	89.8	6.4e-121
WP_000373903.1|5031077_5031503_-|holin	phage holin family protein	holin	H0USX7	Bacillus_phage	97.2	7.0e-70
WP_015382487.1|5031927_5035953_-	phage minor structural protein	NA	H0USX5	Bacillus_phage	93.7	0.0e+00
WP_000517105.1|5035949_5037431_-|tail	phage tail protein	tail	W8CYY9	Bacillus_phage	99.6	5.4e-295
WP_015382488.1|5037445_5041369_-|tail	phage tail tape measure protein	tail	I3WTY6	Bacillus_phage	99.3	0.0e+00
WP_000344049.1|5041383_5041560_-	hypothetical protein	NA	W8CYG0	Bacillus_phage	100.0	6.7e-27
WP_015382489.1|5041589_5041907_-	hypothetical protein	NA	W8CYN3	Bacillus_phage	97.1	4.9e-52
WP_000896769.1|5041953_5042562_-|tail	tail protein	tail	W8CYT6	Bacillus_phage	94.1	1.3e-98
WP_000609194.1|5042562_5042922_-	DUF3168 domain-containing protein	NA	H0USX0	Bacillus_phage	96.6	2.5e-60
WP_000763219.1|5042918_5043353_-	HK97 gp10 family phage protein	NA	H0USW9	Bacillus_phage	100.0	1.8e-76
WP_015382490.1|5043345_5043669_-|head	phage head closure protein	head	H0USW8	Bacillus_phage	99.1	3.3e-56
WP_000244586.1|5043655_5043943_-|head,tail	phage gp6-like head-tail connector protein	head,tail	A0A0S2GLH6	Bacillus_phage	100.0	1.8e-45
WP_000361137.1|5043963_5045130_-|capsid	phage major capsid protein	capsid	W8CYN2	Bacillus_phage	96.6	4.0e-208
WP_001259159.1|5045167_5045878_-|protease	Clp protease ClpP	protease	W8CYT5	Bacillus_phage	95.8	2.4e-123
WP_000577489.1|5045864_5047118_-|portal	phage portal protein	portal	A0A0S2GLJ4	Bacillus_phage	99.3	1.7e-241
WP_000621131.1|5047306_5049001_-|terminase	terminase large subunit	terminase	A0A0S2GLF0	Bacillus_phage	99.6	0.0e+00
WP_000233390.1|5049002_5049506_-|terminase	phage terminase small subunit P27 family	terminase	A0A0S2GLF2	Bacillus_phage	99.4	1.0e-88
WP_001139454.1|5049635_5050013_-	HNH endonuclease	NA	A0A0S2GLI5	Bacillus_phage	94.4	2.1e-65
WP_000773601.1|5050391_5050604_-	hypothetical protein	NA	H0USV9	Bacillus_phage	97.1	1.0e-29
WP_000002725.1|5050620_5050860_-	hypothetical protein	NA	W8CZ42	Bacillus_phage	93.7	1.1e-16
WP_000443965.1|5050894_5051074_-	hypothetical protein	NA	W8CYF7	Bacillus_phage	98.3	6.0e-23
WP_000464752.1|5051119_5051347_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000017440.1|5051383_5051671_-	hypothetical protein	NA	H0USV6	Bacillus_phage	91.6	1.7e-43
WP_015382276.1|5052073_5052319_-	hypothetical protein	NA	W8CYG8	Bacillus_phage	97.5	6.5e-36
WP_001012176.1|5052525_5053068_-|integrase	site-specific integrase	integrase	A0A0S2GLG4	Bacillus_phage	100.0	3.3e-96
WP_015382492.1|5053064_5053550_-	transcription regulator	NA	A0A0S2GLJ9	Bacillus_phage	100.0	7.9e-86
WP_000965619.1|5053907_5054189_-	hypothetical protein	NA	A0A0S2GLD3	Bacillus_phage	100.0	8.7e-45
WP_000404184.1|5055597_5056005_-	hypothetical protein	NA	A0A0S2GLF8	Bacillus_phage	100.0	4.9e-73
WP_001098845.1|5056358_5056658_-	hypothetical protein	NA	A0A0S2GLL5	Bacillus_phage	100.0	2.7e-52
WP_000705118.1|5056808_5057108_+	hypothetical protein	NA	A0A0S2GLD6	Bacillus_phage	100.0	1.9e-50
WP_001025406.1|5057104_5057320_-	hypothetical protein	NA	A0A0S2GLC6	Bacillus_phage	100.0	8.7e-37
WP_000817807.1|5057337_5057502_-	DUF3954 domain-containing protein	NA	A0A0S2GLF5	Bacillus_phage	100.0	1.0e-24
WP_000436951.1|5057573_5057840_-	hypothetical protein	NA	A0A0S2GLK4	Bacillus_phage	100.0	7.7e-43
WP_002133989.1|5057881_5058694_-	ATP-binding protein	NA	A0A0S2GLK2	Bacillus_phage	100.0	1.2e-155
WP_015382495.1|5059895_5060543_-	sigma-70 family RNA polymerase sigma factor	NA	A0A0S2GLJ1	Bacillus_phage	99.5	8.9e-117
WP_000218620.1|5060817_5061132_-	hypothetical protein	NA	A0A0S2GLB6	Bacillus_phage	100.0	1.1e-51
WP_000960416.1|5061293_5062010_-	hypothetical protein	NA	Q3HL19	Bacillus_phage	78.2	6.4e-100
WP_000277643.1|5062327_5062516_-	helix-turn-helix domain-containing protein	NA	A0A1B2APY7	Phage_Wrath	80.6	2.6e-21
WP_000368216.1|5062660_5062906_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000005253.1|5063153_5063483_+	helix-turn-helix transcriptional regulator	NA	H0UST7	Bacillus_phage	97.2	5.6e-51
WP_001164934.1|5063885_5065016_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000896931.1|5065183_5065414_-	hypothetical protein	NA	H0UST5	Bacillus_phage	90.8	8.5e-30
WP_000237487.1|5066376_5067438_+|integrase	site-specific integrase	integrase	A0A1B2AQ00	Phage_Wrath	83.9	3.5e-171
WP_000833145.1|5067526_5067880_-	YxeA family protein	NA	A0A0K2CYS5	Paenibacillus_phage	39.7	4.5e-14
WP_000834606.1|5068503_5069268_-	hypothetical protein	NA	NA	NA	NA	NA
WP_087942842.1|5069693_5071038_+|transposase	IS3-like element ISBth10 family transposase	transposase	A0A1B1P773	Bacillus_phage	74.4	3.6e-112
WP_000573825.1|5071120_5071474_-	iron-sulfur cluster assembly accessory protein	NA	A0A2H4N7M3	Lake_Baikal_phage	43.3	3.7e-16
WP_000077397.1|5071515_5072382_-	diaminopimelate epimerase	NA	NA	NA	NA	NA
WP_000595026.1|5072650_5072890_-	YuzB family protein	NA	NA	NA	NA	NA
WP_000682077.1|5073236_5074307_+	NAD(P)/FAD-dependent oxidoreductase	NA	NA	NA	NA	NA
WP_001054089.1|5074540_5074714_+	aspartyl-phosphate phosphatase Spo0E family protein	NA	NA	NA	NA	NA
WP_000470265.1|5074769_5075429_+	ABC transporter ATP-binding protein	NA	G3M9Y6	Bacillus_virus	35.7	1.3e-22
WP_000679246.1|5075412_5076210_+	iron export ABC transporter permease subunit FetB	NA	NA	NA	NA	NA
WP_000212737.1|5076430_5076772_-	alkylphosphonate utilization operon protein PhnA	NA	NA	NA	NA	NA
5076364:5076383	attR	ATATCGATTTACCGACAAAA	NA	NA	NA	NA
WP_000622258.1|5076931_5077213_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003285671.1|5077282_5078080_-	DUF2628 domain-containing protein	NA	NA	NA	NA	NA
WP_000607080.1|5078368_5078752_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000383681.1|5078788_5079043_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000843107.1|5079132_5079603_+	SMI1/KNR4 family protein	NA	NA	NA	NA	NA
WP_002101500.1|5079589_5080228_+	DUF4304 domain-containing protein	NA	NA	NA	NA	NA
WP_000049707.1|5080278_5080947_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002101505.1|5081069_5081864_-	DUF4111 domain-containing protein	NA	NA	NA	NA	NA
WP_000248588.1|5081916_5082225_-	YuzD family protein	NA	NA	NA	NA	NA
WP_000431159.1|5082420_5082657_+	NifU family protein	NA	Q58MC7	Prochlorococcus_phage	46.6	2.0e-10
WP_001125494.1|5082851_5083067_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000614218.1|5083128_5084130_-|coat	spore coat protein CotS	coat	NA	NA	NA	NA
>prophage 12
NC_020238	Bacillus thuringiensis serovar kurstaki str. HD73, complete sequence	5646799	5190592	5292621	5646799	holin,tRNA,capsid,protease,terminase,head,portal,integrase,transposase,tail	Bacillus_phage(41.94%)	117	5235363:5235383	5276333:5276353
WP_001021098.1|5190592_5191852_-|tRNA	tyrosine--tRNA ligase	tRNA	K4F5T3	Cronobacter_phage	42.4	9.0e-89
WP_001057102.1|5192221_5193139_-	UDP-N-acetylmuramate dehydrogenase	NA	NA	NA	NA	NA
WP_000573649.1|5193521_5193917_-	SET domain-containing protein	NA	NA	NA	NA	NA
WP_000455078.1|5194125_5195628_-	DUF4077 domain-containing protein	NA	NA	NA	NA	NA
WP_000714051.1|5195660_5196719_-	endonuclease	NA	NA	NA	NA	NA
WP_001986875.1|5197035_5197470_+	fluoride efflux transporter CrcB	NA	NA	NA	NA	NA
WP_000568580.1|5197466_5197823_+	fluoride efflux transporter CrcB	NA	NA	NA	NA	NA
WP_000980954.1|5197851_5198091_-	DUF3947 family protein	NA	NA	NA	NA	NA
WP_000792610.1|5198157_5198370_-	DUF3955 domain-containing protein	NA	NA	NA	NA	NA
WP_001293750.1|5198550_5199744_-	MFS transporter	NA	A0A2K5B2B5	Erysipelothrix_phage	32.6	2.0e-42
WP_000054869.1|5199749_5201297_-	ABC-F family ATP-binding cassette domain-containing protein	NA	A0A2K9L0W2	Tupanvirus	29.2	6.7e-54
WP_001071092.1|5201734_5202250_-	spermidine N1-acetyltransferase	NA	NA	NA	NA	NA
WP_000834708.1|5202392_5202797_-	phosphate-starvation-inducible protein PsiE	NA	NA	NA	NA	NA
WP_000635745.1|5202846_5203809_-	NERD domain-containing protein	NA	NA	NA	NA	NA
WP_001036620.1|5204270_5205236_+	DUF4822 domain-containing protein	NA	NA	NA	NA	NA
WP_000576729.1|5205442_5206981_-	anthrolysin O/cereolysin O family cholesterol-dependent cytolysin	NA	NA	NA	NA	NA
WP_000590071.1|5207429_5208182_-	ATP-binding cassette domain-containing protein	NA	NA	NA	NA	NA
WP_000631245.1|5208178_5209243_-	iron chelate uptake ABC transporter family permease subunit	NA	NA	NA	NA	NA
WP_000042063.1|5209239_5210256_-	iron chelate uptake ABC transporter family permease subunit	NA	A0A2H4IY97	uncultured_Caudovirales_phage	37.1	6.0e-59
WP_000749436.1|5210275_5211292_-	ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_000815809.1|5211619_5212297_-	response regulator transcription factor	NA	NA	NA	NA	NA
WP_002101540.1|5213547_5213868_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000169371.1|5214611_5215919_-	group II intron reverse transcriptase/maturase	NA	H7BV92	unidentified_phage	24.2	1.7e-10
WP_001100112.1|5216092_5216272_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000915084.1|5217825_5218758_+|holin	choline-binding protein A	holin	NA	NA	NA	NA
WP_001123919.1|5219565_5220033_-	SsrA-binding protein	NA	W5RAM5	Staphylococcus_phage	63.2	5.4e-47
WP_000391097.1|5220159_5222598_-	ribonuclease R	NA	Q0GXV6	Lactococcus_phage	40.6	1.7e-91
WP_000761976.1|5222740_5223481_-	carboxylesterase	NA	NA	NA	NA	NA
WP_000557264.1|5223642_5223876_-	preprotein translocase subunit SecG	NA	NA	NA	NA	NA
WP_000078304.1|5223970_5224663_-	LrgB family protein	NA	NA	NA	NA	NA
WP_000673222.1|5224659_5225028_-|holin	CidA/LrgA family holin-like protein	holin	NA	NA	NA	NA
WP_001125064.1|5225380_5226331_+	nucleoside hydrolase	NA	NA	NA	NA	NA
WP_000103951.1|5226382_5227678_-	phosphopyruvate hydratase	NA	A0A1X9I5Z8	Streptococcus_phage	75.4	1.1e-182
WP_001231158.1|5227708_5229238_-	2,3-bisphosphoglycerate-independent phosphoglycerate mutase	NA	NA	NA	NA	NA
WP_001231038.1|5229234_5229990_-	triose-phosphate isomerase	NA	NA	NA	NA	NA
WP_001036350.1|5230022_5231207_-	phosphoglycerate kinase	NA	NA	NA	NA	NA
WP_000161236.1|5231346_5232351_-	type I glyceraldehyde-3-phosphate dehydrogenase	NA	NA	NA	NA	NA
WP_001258185.1|5232377_5233406_-	gapA transcriptional regulator CggR	NA	NA	NA	NA	NA
WP_000869730.1|5233541_5233787_-	glutaredoxin family protein	NA	NA	NA	NA	NA
WP_000647955.1|5233796_5235104_-	RNA polymerase factor sigma-54	NA	NA	NA	NA	NA
5235363:5235383	attL	CGCGCCCAGAGGGATTCGAAC	NA	NA	NA	NA
WP_000412580.1|5235666_5236494_+	hypothetical protein	NA	A0A1C8EA76	Bacillus_phage	90.9	7.6e-137
WP_001273481.1|5236509_5236803_-	hypothetical protein	NA	A0A1C8E992	Bacillus_phage	87.6	2.7e-41
WP_001016121.1|5236827_5237046_-	hypothetical protein	NA	A0A2H4JC50	uncultured_Caudovirales_phage	93.1	7.3e-31
WP_000742864.1|5237189_5237756_+	hypothetical protein	NA	A6XML2	Bacillus_virus	45.7	4.8e-26
WP_000734384.1|5237934_5238153_-	hypothetical protein	NA	A0A2H4JBB8	uncultured_Caudovirales_phage	73.8	1.7e-16
WP_000993515.1|5238152_5239268_-	tetratricopeptide repeat protein	NA	A0A2H4J8G3	uncultured_Caudovirales_phage	54.9	4.0e-109
WP_000405783.1|5239471_5240407_-	N-acetylmuramoyl-L-alanine amidase	NA	A0A0S2MVR5	Bacillus_phage	82.3	1.8e-155
WP_000532576.1|5240406_5240832_-|holin	phage holin family protein	holin	A0A0S2MVC4	Bacillus_phage	97.9	8.3e-71
WP_000499524.1|5241126_5242320_+|transposase	IS110 family transposase	transposase	A0A0U3ULR1	Bacillus_phage	25.1	1.2e-23
WP_015382502.1|5242829_5247212_-	phage minor structural protein	NA	A0A0S2MVB4	Bacillus_phage	58.4	0.0e+00
WP_015382503.1|5247208_5248678_-	hypothetical protein	NA	A0A0S2MV63	Bacillus_phage	80.2	2.6e-236
WP_002133928.1|5248719_5251101_-	hypothetical protein	NA	A0A2H4JC82	uncultured_Caudovirales_phage	44.1	3.7e-43
WP_000897021.1|5251378_5252614_-	hypothetical protein	NA	A0A2H4JAI2	uncultured_Caudovirales_phage	73.1	3.6e-151
WP_000415931.1|5252844_5253207_-	hypothetical protein	NA	A0A2H4JAG8	uncultured_Caudovirales_phage	71.7	1.4e-42
WP_001004920.1|5253213_5253807_-|tail	phage tail protein	tail	A0A2H4JDV4	uncultured_Caudovirales_phage	91.8	3.7e-101
WP_000219080.1|5253807_5254143_-	hypothetical protein	NA	A0A2H4JAG4	uncultured_Caudovirales_phage	94.5	3.2e-54
WP_000997537.1|5254139_5254484_-	HK97 gp10 family phage protein	NA	A0A2H4JAH8	uncultured_Caudovirales_phage	80.5	1.7e-45
WP_001247297.1|5254485_5254836_-|head	phage head closure protein	head	D2XR20	Bacillus_phage	87.9	3.7e-53
WP_000361981.1|5254837_5255131_-	hypothetical protein	NA	A0A2H4JG04	uncultured_Caudovirales_phage	76.3	2.7e-36
WP_000245092.1|5255143_5256310_-|capsid	phage major capsid protein	capsid	A0A2H4JH29	uncultured_Caudovirales_phage	77.7	9.6e-162
WP_000791073.1|5256336_5257062_-|protease	Clp protease ClpP	protease	A0A2H4J8Y7	uncultured_Caudovirales_phage	53.2	1.7e-44
WP_000118683.1|5257051_5258203_-|portal	phage portal protein	portal	A8AT96	Listeria_phage	51.1	1.8e-104
WP_000595321.1|5258223_5259909_-|terminase	terminase large subunit	terminase	D2XR15	Bacillus_phage	85.7	5.5e-275
WP_000301150.1|5259905_5260217_-|terminase	terminase	terminase	D2XR14	Bacillus_phage	86.3	4.7e-39
WP_000666398.1|5260341_5260677_-	HNH endonuclease	NA	D2XR61	Bacillus_phage	91.0	1.6e-53
WP_001177571.1|5260642_5261017_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000378699.1|5261007_5261265_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001177575.1|5261271_5261481_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001002014.1|5261549_5261984_-	hypothetical protein	NA	Q2I8B8	Bacillus_phage	61.5	9.8e-19
WP_000343502.1|5261989_5262193_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000650576.1|5262206_5262431_-	hypothetical protein	NA	NA	NA	NA	NA
WP_071686389.1|5262610_5262793_+	type II toxin-antitoxin system HicA family toxin	NA	A0A0U4KLG1	Pseudomonas_phage	64.9	3.9e-14
WP_000711194.1|5262844_5263264_+	HicB family protein	NA	A0A2H4J4X8	uncultured_Caudovirales_phage	79.9	4.5e-61
WP_015382504.1|5263647_5264049_-	hypothetical protein	NA	A0A1C8E9D1	Bacillus_phage	98.5	1.4e-67
WP_015670520.1|5264086_5264413_-	hypothetical protein	NA	A0A1C8E9C1	Bacillus_phage	98.1	4.7e-58
WP_000540086.1|5264409_5264937_-	Holliday junction resolvase RecU	NA	A0A1C8E9C3	Bacillus_phage	97.7	4.1e-96
WP_000590881.1|5264972_5265284_-	hypothetical protein	NA	A0A0A7AR06	Bacillus_phage	84.5	1.0e-41
WP_000858114.1|5265328_5266024_-	hypothetical protein	NA	A0A1I9S6E4	Bacillus_phage	81.5	3.2e-112
WP_000520932.1|5266059_5266314_-	hypothetical protein	NA	I7ILU4	Staphylococcus_phage	100.0	1.2e-40
WP_001268031.1|5267336_5267627_-	hypothetical protein	NA	A0A1C8EA94	Bacillus_phage	93.8	2.5e-50
WP_000775809.1|5267685_5268120_-	hypothetical protein	NA	A0A2H4JBD8	uncultured_Caudovirales_phage	89.6	2.2e-71
WP_001245738.1|5268158_5268716_-	hypothetical protein	NA	A0A1B1P7A6	Bacillus_phage	70.8	2.0e-64
WP_000139235.1|5268739_5268970_-	hypothetical protein	NA	A0A1C8E9C2	Bacillus_phage	100.0	2.5e-34
WP_000933908.1|5268962_5269442_-	hypothetical protein	NA	A0A1C8E9A8	Bacillus_phage	97.5	4.3e-84
WP_000510889.1|5269453_5270407_-	DnaD domain protein	NA	A0A0S2MVA0	Bacillus_phage	90.2	8.4e-148
WP_002133909.1|5270500_5270842_-	hypothetical protein	NA	A0A0S2MVH7	Bacillus_phage	97.3	9.9e-51
WP_000355713.1|5270771_5270987_-	hypothetical protein	NA	A0A1C8E9A6	Bacillus_phage	98.6	1.1e-31
WP_015382506.1|5270986_5271700_-	hypothetical protein	NA	A0A0S2MV99	Bacillus_phage	98.3	1.4e-126
WP_000453495.1|5271717_5272161_-	hypothetical protein	NA	A0A0S2MVA8	Bacillus_phage	90.5	9.8e-67
WP_001187283.1|5272187_5272376_-	hypothetical protein	NA	A0A2H4J4V8	uncultured_Caudovirales_phage	62.9	2.6e-13
WP_001016247.1|5272387_5273143_-	phage regulatory protein	NA	A0A2H4JBC7	uncultured_Caudovirales_phage	83.4	1.9e-110
WP_000711864.1|5273496_5273730_-	DUF771 domain-containing protein	NA	Q9MBW7	Lactococcus_phage	43.5	5.6e-05
WP_000216290.1|5273765_5273996_-	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_002133807.1|5274160_5274553_+	helix-turn-helix transcriptional regulator	NA	A0A1Q1PVX8	Staphylococcus_phage	58.5	3.2e-13
WP_001037137.1|5274563_5275031_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000135757.1|5275061_5276198_+|integrase	site-specific integrase	integrase	A8ATX2	Listeria_phage	48.0	6.8e-96
WP_000216166.1|5276612_5276819_+	DUF1657 domain-containing protein	NA	NA	NA	NA	NA
5276333:5276353	attR	CGCGCCCAGAGGGATTCGAAC	NA	NA	NA	NA
WP_001226064.1|5276912_5277401_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000095408.1|5277430_5277907_+	stage V sporulation protein AC	NA	NA	NA	NA	NA
WP_000938972.1|5277907_5278924_+	stage V sporulation protein AD	NA	NA	NA	NA	NA
WP_000575919.1|5278920_5279271_+	stage V sporulation protein AE	NA	NA	NA	NA	NA
WP_000215909.1|5279282_5279489_+	DUF1657 domain-containing protein	NA	NA	NA	NA	NA
WP_000018924.1|5279509_5280379_+	DUF421 domain-containing protein	NA	NA	NA	NA	NA
WP_001049162.1|5280619_5281201_+	ATP-dependent Clp endopeptidase proteolytic subunit ClpP	NA	A0A223W000	Agrobacterium_phage	56.5	1.3e-55
WP_000250307.1|5281528_5281777_-	HPr family phosphocarrier protein	NA	NA	NA	NA	NA
WP_000006560.1|5281800_5282751_-	DNA-binding protein WhiA	NA	Q7AWZ3	Streptococcus_phage	38.4	1.7e-52
WP_000712186.1|5282839_5283793_-	YvcK family protein	NA	A1IMD5	Streptococcus_phage	42.8	1.7e-63
WP_000138459.1|5283796_5284678_-	RNase adapter RapZ	NA	A0A0R8VB27	Thermobifida_phage	28.9	4.6e-07
WP_001190080.1|5284698_5285157_-	8-oxo-dGTP diphosphatase	NA	NA	NA	NA	NA
WP_000455200.1|5285386_5286193_-	DUF368 domain-containing protein	NA	NA	NA	NA	NA
WP_001288079.1|5286358_5287315_-	thioredoxin-disulfide reductase	NA	G3MA85	Bacillus_virus	53.6	4.0e-89
WP_000517720.1|5287400_5288912_-	tetratricopeptide repeat protein	NA	NA	NA	NA	NA
WP_001255073.1|5289051_5289564_-	acyltransferase	NA	NA	NA	NA	NA
WP_002097946.1|5289597_5290248_-	pyrophosphatase PpaX	NA	NA	NA	NA	NA
WP_000922850.1|5290315_5291128_-	prolipoprotein diacylglyceryl transferase	NA	NA	NA	NA	NA
WP_001127250.1|5291154_5292084_-	HPr(Ser) kinase/phosphatase	NA	NA	NA	NA	NA
WP_001267308.1|5292240_5292621_-|holin	phage holin family protein	holin	NA	NA	NA	NA
>prophage 1
NC_020249	Bacillus thuringiensis serovar kurstaki str. HD73 plasmid pHT73, complete sequence	77351	795	56567	77351	transposase,integrase	Lactococcus_phage(35.71%)	41	11638:11697	35875:38057
WP_015386292.1|795_2091_-|transposase	IS21-like element IS232 family transposase	transposase	A0A059NT83	Lactococcus_phage	31.0	1.7e-42
WP_002133690.1|2636_2888_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000369821.1|3511_7048_-	pesticidal crystal protein cry1Ac	NA	NA	NA	NA	NA
WP_000215667.1|7337_8294_-	N-acetylmuramoyl-L-alanine amidase	NA	A0A0S2MV84	Bacillus_phage	39.5	6.9e-49
WP_001053956.1|10085_11522_+|transposase	IS4-like element IS231B family transposase	transposase	NA	NA	NA	NA
11638:11697	attL	GTATAAATGCTAACTTAAATATGTACATTAACGCTTGAATAAATATGTACATTTTCAATT	NA	NA	NA	NA
WP_000275580.1|11729_13025_+|transposase	IS21-like element IS232 family transposase	transposase	A0A059NT83	Lactococcus_phage	31.0	1.0e-42
WP_000798699.1|13014_13767_+	ATP-binding protein	NA	A0A059NT77	Lactococcus_phage	47.3	7.0e-57
WP_001224533.1|14018_14642_-	recombinase family protein	NA	Q1MVP4	Enterobacteria_phage	33.7	4.4e-12
WP_001025593.1|14892_17964_+|transposase	Tn3 family transposase	transposase	Q1MVP5	Enterobacteria_phage	22.3	4.3e-44
WP_001053969.1|18430_19867_+|transposase	IS4-like element IS231C family transposase	transposase	NA	NA	NA	NA
WP_000538375.1|20059_23023_-|transposase	Tn3 family transposase	transposase	A0A1B0V7H9	Salmonella_phage	39.2	4.1e-201
WP_000382147.1|23041_23896_-|integrase	tyrosine-type recombinase/integrase	integrase	S5M9V8	Brevibacillus_phage	26.4	4.4e-23
WP_001053969.1|24268_25705_-|transposase	IS4-like element IS231C family transposase	transposase	NA	NA	NA	NA
WP_000240401.1|25949_26168_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001100112.1|27484_27664_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000169371.1|27837_29145_+	group II intron reverse transcriptase/maturase	NA	A0A0U4J920	Pseudomonas_phage	31.0	1.3e-26
WP_001236344.1|30356_31586_+|transposase	IS110-like element ISBth166 family transposase	transposase	M1NSC9	Streptococcus_phage	49.4	1.7e-84
WP_000873092.1|31795_32731_-|integrase	site-specific integrase	integrase	A0A1B1P793	Bacillus_phage	46.6	3.8e-76
WP_003275744.1|33234_33444_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000645017.1|33705_34134_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000062290.1|34148_35342_-	ParM/StbA family protein	NA	NA	NA	NA	NA
WP_000275580.1|35966_37262_+|transposase	IS21-like element IS232 family transposase	transposase	A0A059NT83	Lactococcus_phage	31.0	1.0e-42
WP_000798699.1|37251_38004_+	ATP-binding protein	NA	A0A059NT77	Lactococcus_phage	47.3	7.0e-57
WP_000924961.1|38491_39430_-	hypothetical protein	NA	NA	NA	NA	NA
35875:38057	attR	GTATAAATGCTAACTTAAATATGTACATTAACGCTTGAATAAATATGTACATTTTCAATTGGATTCTCCATACTGACTCTGAGGTGGTTAGTATGTATATTAAGCTAGATATTCAAACAGAATTTGAGGTTAAAAGTCTTTCAGACTTACCAAATTTTAAAAAACTAATGGGGAACTTAAAAATGAAGATAAATAAAAGTCAATTAGCCAGAGAATTGAATGTGGATCGGCGTACCATAGATAAGTATTTGAATGGTTTTACACCAAAAGGGACAAAAAATAAAACATCGAAAATCGATACATATTATGAAGTGATTGCAGCTCTTTTATCTAGTGATTCTAAACAAATCTTCTACTACAAACGAGTGTTATGGCAGTATCTAACAGACAATCACGGTTTAAAATGTTCACAGTCTGCATTTCGTGCTTATATTAATAGAAAGCCTGAATTTAGAACATATTTTGATGAGGGGAAGCGTATTTTATCAGGTCATTCAGTGGGTGTCCGTTATGAGACACCTCCAGGAGAACAAGCTCAATTAGATTGGAAAGAAAGCATACGATTTGAAACCAAAAGTGGCGAAATCGTATATGTGAATGTAGCTGTACTTTTATTGTCCTACTCGAGATTTAAAGTTTTTCATTTGAATATTTCAAAATCACAAAGTGTTTTAATGTCATTTATGACAGAGGCATTTGAAATGTTTGGTGGTGTACCGAAGGTAATTGTCACGGATAATATGAAGACGGTAATGGATGAAGCTCGAACAGAACACTTTACAGGAACGATTAACAATAAGTTTGCCCAATTCGCTCAAGATTTTGGATTTAAGGTACAACCTTGTATCGCAGGGCGACCAAATACCAAAGGGAAAGTAGAAGCGCCAATGAAACTTCTAGACGAAATTCATGCTTATCAAGGAAGATTCACTTTTGAAGAATTACATGAATTTGTGCAAAAATTATGTGCAAGAATTAATCAAACATTTCATCAAGGGACTGGTAAGATTCCAGTGTTTGCCCTAAAACAGGAAAAGAATCTCCTACAACCACTCCCGAAGAGCGCGATAAGAGATTCCTATATGATTAAGCATAAACTTGTAAAAGTTAATACATCAGGCATGATATCTTACAAATCGAATCAATACTCAGTTCCAGCTGAATATCAAGGTAAAACCGTCGGTTTACAAGTATATGATAATCAAATATATGTTTATCATAACATGAAGTTAATTGTACAACATAAAATCAGCCAATCTAAGCTCAATTATAAAGAAGAACATTATAAAAAAGCATTGGCTAAGTCACTACCTAAATATCCGAACATTGACAATTTGGCGAAACAAAATTTATCAGTAATTGGTGAGGTATATAGAAATGAAGAATAGCTATCAACAATTAACAACAAACCTAGAGTATTTAAAATTAAAACAAATGGCACAACATTTAGGTGACGTAGTCGATTTTAGCATTAATAATGAATTATCCTTCGTAGAGACACTTGTTAAACTGACAAACTATGAGATTGATGTACGAGAACAAAATATGATTCATTCTATGGTGAAAATGGGCGCATTTCCTCATAGAAAGGAGGTTGATGAGTTTGATTTCGAATTCCAGCCGAGTATTAATAAACAACAAATCTTAGATTTTATTTCTCTACGTTTCTTAGAGCAACAAGAAAACATAGTATTTTTAGGACCTAGTGGTGTTGGTAAGACCCATTTGGCCACGTCTATTGGTATAGCAGCAGCTAAAAAGCGAACAAGTACTTATTTTATTAAATGTCATGATTTACTTCAAAATTTAAAACGTGCCAAGATTGAGAATCGCCTAGAATCTCGTTTAAAGCACTATACAAAATACAAATTACTTATTATTGATGAAATTGGGTACTTGCCTATTGATCCGGAGGATGCAAAATTATTCTTTCAATTAATCGATATGCGTTATGAAAAGCGTAGTACCATCCTAACGACCAATATCAACTTCAAGTCTTGGGACGAAGTATTCCAGGACCCTAAACTCGCCAATGCCATACTAGATCGTGTCTTACATCATGCCACGGTGGTCAGTATTGTAGGACAATCCTATCGAATTAAAGATCATTTTAGCAAAGAAAATGATTGATTTTGTACATGCTTAAACAAGCGAAAATGTACATGTTTATCTTGACATTTACA	NA	NA	NA	NA
WP_000899316.1|39977_40955_+	alpha/beta hydrolase family protein	NA	NA	NA	NA	NA
WP_000636549.1|40970_42329_+	HAMP domain-containing histidine kinase	NA	NA	NA	NA	NA
WP_000152608.1|42332_42920_+	response regulator transcription factor	NA	NA	NA	NA	NA
WP_000988783.1|43071_43263_+	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_000579647.1|43608_44010_-	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_001218521.1|44138_44378_+	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_000410281.1|44542_44797_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002081807.1|45374_45875_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000751260.1|45929_47138_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000837540.1|47223_49773_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003275864.1|49793_50282_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002134136.1|50297_51089_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000516215.1|51105_51921_+	AAA family ATPase	NA	NA	NA	NA	NA
WP_000432467.1|51950_53408_+	CpaF family protein	NA	NA	NA	NA	NA
WP_000506473.1|53394_54342_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001055431.1|54357_55251_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000499523.1|55373_56567_-|transposase	IS110-like element ISBth13 family transposase	transposase	A0A0U3ULR1	Bacillus_phage	26.1	1.1e-24
