The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
NC_020210	Geobacillus sp. GHH01, complete sequence	3583134	171834	234443	3583134	coat,protease,transposase	Klosneuvirus(22.22%)	54	NA	NA
WP_041470620.1|171834_172992_-|transposase	ISL3 family transposase	transposase	NA	NA	NA	NA
WP_015373741.1|173155_174523_+|transposase	ISLre2 family transposase	transposase	NA	NA	NA	NA
WP_015373743.1|174924_176019_-	hypothetical protein	NA	NA	NA	NA	NA
WP_015373744.1|176401_177619_-|transposase	IS110 family transposase	transposase	NA	NA	NA	NA
WP_015373746.1|179757_180891_+|transposase	IS4 family transposase	transposase	NA	NA	NA	NA
WP_011229682.1|181428_182313_+	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_015373747.1|182697_183153_+	(2Fe-2S)-binding protein	NA	NA	NA	NA	NA
WP_033007523.1|183566_184199_+	hypothetical protein	NA	NA	NA	NA	NA
WP_015373750.1|184472_185030_+	cupin domain-containing protein	NA	Q2I8C5	Bacillus_phage	69.9	1.7e-52
WP_015373751.1|185752_186130_-	aldo/keto reductase	NA	A0A1V0SKP9	Klosneuvirus	51.5	2.0e-20
WP_015373752.1|186491_187538_+	NAD(P)-dependent alcohol dehydrogenase	NA	A0A2K9L339	Tupanvirus	45.5	3.4e-73
WP_015373753.1|187704_188925_+	multidrug effflux MFS transporter	NA	NA	NA	NA	NA
WP_081601546.1|189228_189603_+	hypothetical protein	NA	NA	NA	NA	NA
WP_144052020.1|189686_190403_+	SDR family NAD(P)-dependent oxidoreductase	NA	NA	NA	NA	NA
WP_015373756.1|190591_191071_+	DUF2975 domain-containing protein	NA	NA	NA	NA	NA
WP_013144000.1|191081_191306_+	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_051049842.1|191376_192225_+	DUF817 domain-containing protein	NA	NA	NA	NA	NA
WP_081601513.1|192289_192778_-	DinB family protein	NA	NA	NA	NA	NA
WP_015373759.1|192815_193586_-	TatD family hydrolase	NA	NA	NA	NA	NA
WP_015373760.1|193643_195017_-	sigma-54-dependent Fis family transcriptional regulator	NA	NA	NA	NA	NA
WP_015373761.1|195250_196663_+	amino acid permease	NA	NA	NA	NA	NA
WP_014194641.1|196758_198306_+	L-glutamate gamma-semialdehyde dehydrogenase	NA	NA	NA	NA	NA
WP_015373762.1|198376_199576_+	ornithine--oxo-acid transaminase	NA	A0A1V0SKB7	Klosneuvirus	29.0	8.1e-31
WP_014194643.1|199602_200841_+	Glu/Leu/Phe/Val dehydrogenase	NA	NA	NA	NA	NA
WP_015373763.1|201077_201686_+	DedA family protein	NA	NA	NA	NA	NA
WP_015373764.1|201755_202745_-	iron ABC transporter permease	NA	NA	NA	NA	NA
WP_015373765.1|202741_203749_-	iron ABC transporter permease	NA	NA	NA	NA	NA
WP_015373766.1|203816_204743_-	ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_015373767.1|204749_205541_-	ABC transporter ATP-binding protein	NA	A0A1V0SE00	Indivirus	30.3	3.2e-15
WP_015373768.1|205679_205982_+	hypothetical protein	NA	NA	NA	NA	NA
WP_015373769.1|206057_208121_+	sigma 54-interacting transcriptional regulator	NA	NA	NA	NA	NA
WP_015373770.1|208092_209247_+	acyl-CoA dehydrogenase	NA	NA	NA	NA	NA
WP_015373772.1|209870_210272_-	DoxX family protein	NA	NA	NA	NA	NA
WP_015373773.1|210411_211116_+	DsbA family oxidoreductase	NA	NA	NA	NA	NA
WP_081107437.1|211201_211690_-	hypothetical protein	NA	NA	NA	NA	NA
WP_015373775.1|211883_212567_+	N-acetylmuramoyl-L-alanine amidase	NA	E5DV68	Deep-sea_thermophilic_phage	51.6	9.9e-50
WP_015373776.1|212692_214021_+	S8 family peptidase	NA	A0A2K9L1P3	Tupanvirus	32.2	7.6e-22
WP_015373777.1|214038_215994_-	LTA synthase family protein	NA	W6LM83	Streptococcus_phage	46.3	4.1e-141
WP_015373778.1|216443_217781_+	potassium transporter ATPase	NA	NA	NA	NA	NA
WP_015373779.1|218171_220007_+	APC family permease	NA	NA	NA	NA	NA
WP_015373780.1|220112_220751_+	sporulation membrane protein YtaF	NA	NA	NA	NA	NA
WP_015373781.1|220818_221802_+	sporulation protein	NA	NA	NA	NA	NA
WP_015373782.1|221950_222457_+|coat	spore coat protein	coat	NA	NA	NA	NA
WP_015373783.1|222610_223549_+	ROK family protein	NA	NA	NA	NA	NA
WP_015373784.1|223732_224554_+	undecaprenyl-diphosphate phosphatase	NA	NA	NA	NA	NA
WP_015373785.1|224856_225930_-	undecaprenyldiphospho-muramoylpentapeptide beta-N-acetylglucosaminyltransferase	NA	NA	NA	NA	NA
WP_015373786.1|226324_227053_+	polysaccharide deacetylase family protein	NA	NA	NA	NA	NA
WP_011229731.1|227063_227660_+	DedA family protein	NA	NA	NA	NA	NA
WP_015373787.1|227672_228815_+	diacylglycerol glucosyltransferase	NA	NA	NA	NA	NA
WP_015373788.1|229068_230172_+	D-alanine--D-alanine ligase	NA	NA	NA	NA	NA
WP_015373789.1|230178_231555_+	UDP-N-acetylmuramoyl-tripeptide--D-alanyl-D- alanine ligase	NA	NA	NA	NA	NA
WP_011229735.1|231627_232350_+	alpha/beta fold hydrolase	NA	NA	NA	NA	NA
WP_013144041.1|232410_233814_+	DEAD/DEAH box helicase	NA	Q5GF26	Diachasmimorpha_longicaudata_entomopoxvirus	36.9	1.7e-64
WP_011229737.1|233825_234443_-|protease	rhomboid family intramembrane serine protease	protease	NA	NA	NA	NA
>prophage 2
NC_020210	Geobacillus sp. GHH01, complete sequence	3583134	280374	288792	3583134		Synechococcus_phage(33.33%)	8	NA	NA
WP_015373810.1|280374_281670_+	adenylosuccinate lyase	NA	A0A1B3B081	Gordonia_phage	33.6	3.8e-18
WP_041469534.1|281742_282474_+	phosphoribosylaminoimidazolesuccinocarboxamide synthase	NA	A0A0E3HI61	Synechococcus_phage	42.9	7.1e-46
WP_013522818.1|282461_282716_+	phosphoribosylformylglycinamidine synthase subunit PurS	NA	NA	NA	NA	NA
WP_015373811.1|282712_283399_+	phosphoribosylformylglycinamidine synthase subunit PurQ	NA	NA	NA	NA	NA
WP_015373812.1|283382_285611_+	phosphoribosylformylglycinamidine synthase subunit PurL	NA	A6N228	Microbacterium_phage	42.4	2.6e-168
WP_015373813.1|285586_286999_+	amidophosphoribosyltransferase	NA	A0A0M3SGR2	Mollivirus	34.7	3.7e-51
WP_015373814.1|287122_288163_+	phosphoribosylformylglycinamidine cyclo-ligase	NA	A0A0E3FC27	Synechococcus_phage	44.5	3.2e-68
WP_015373815.1|288159_288792_+	phosphoribosylglycinamide formyltransferase	NA	E3SNR5	Prochlorococcus_phage	37.4	1.6e-25
>prophage 3
NC_020210	Geobacillus sp. GHH01, complete sequence	3583134	762112	798197	3583134	transposase,coat	Tupanvirus(25.0%)	42	NA	NA
WP_014195186.1|762112_763207_-|coat	CotS family spore coat protein	coat	NA	NA	NA	NA
WP_015374171.1|763462_764617_-	glycosyltransferase family 4 protein	NA	NA	NA	NA	NA
WP_015374172.1|764613_765570_-	NAD-dependent epimerase/dehydratase family protein	NA	A0A2K9L4U8	Tupanvirus	32.8	1.7e-39
WP_015374173.1|765566_766850_-	UDP-glucose/GDP-mannose dehydrogenase family protein	NA	A0A127AXI2	Bacillus_phage	37.5	3.2e-73
WP_015374174.1|767126_768206_-	glycosyltransferase	NA	NA	NA	NA	NA
WP_015374175.1|768212_769208_-	phosphotransferase	NA	NA	NA	NA	NA
WP_015374176.1|769369_769672_-	hypothetical protein	NA	NA	NA	NA	NA
WP_013146050.1|769850_770201_+	DUF1360 domain-containing protein	NA	NA	NA	NA	NA
WP_015374177.1|770224_770635_+	hypothetical protein	NA	NA	NA	NA	NA
WP_013146049.1|770522_771287_-	hypothetical protein	NA	NA	NA	NA	NA
WP_015374178.1|771388_772108_-	hypothetical protein	NA	NA	NA	NA	NA
WP_013146047.1|772262_772598_+|coat	spore coat protein	coat	NA	NA	NA	NA
WP_011230350.1|772956_773187_+	hypothetical protein	NA	NA	NA	NA	NA
WP_015374179.1|773214_773418_+	hypothetical protein	NA	NA	NA	NA	NA
WP_011230352.1|773576_773783_+	DUF1657 domain-containing protein	NA	NA	NA	NA	NA
WP_011230353.1|773880_774357_+	sporulation protein	NA	NA	NA	NA	NA
WP_015374180.1|774368_774848_+	stage V sporulation protein AC	NA	NA	NA	NA	NA
WP_015374181.1|774847_775861_+	stage V sporulation protein AD	NA	NA	NA	NA	NA
WP_015374182.1|775862_776219_+	stage V sporulation protein AE	NA	NA	NA	NA	NA
WP_011230357.1|776231_776438_+	DUF1657 domain-containing protein	NA	NA	NA	NA	NA
WP_013523193.1|776450_777311_+	DUF421 domain-containing protein	NA	NA	NA	NA	NA
WP_015374183.1|777331_777502_+	hypothetical protein	NA	NA	NA	NA	NA
WP_015374184.1|777642_777963_-	thioredoxin family protein	NA	NA	NA	NA	NA
WP_015374185.1|778090_778327_+	hypothetical protein	NA	NA	NA	NA	NA
WP_011230362.1|778406_778532_+	YjcZ family sporulation protein	NA	NA	NA	NA	NA
WP_011230363.1|778653_778911_+	sporulation protein	NA	NA	NA	NA	NA
WP_013146036.1|779034_779469_-	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_011230365.1|779470_779992_-	hypothetical protein	NA	NA	NA	NA	NA
WP_015374186.1|780090_780819_-	esterase family protein	NA	NA	NA	NA	NA
WP_015374187.1|781316_782420_+	methionine biosynthesis PLP-dependent protein	NA	A0A0B5JD48	Pandoravirus	27.8	1.2e-17
WP_015374188.1|782423_783605_+	cystathionine beta-lyase	NA	NA	NA	NA	NA
WP_011230369.1|783654_783864_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011230370.1|784012_784456_-	hypothetical protein	NA	NA	NA	NA	NA
WP_041470414.1|784701_785400_+	glycosyltransferase family 2 protein	NA	NA	NA	NA	NA
WP_041470416.1|785399_786518_+	glycosyltransferase family 4 protein	NA	NA	NA	NA	NA
WP_015374191.1|786517_787573_+	polysaccharide pyruvyl transferase family protein	NA	NA	NA	NA	NA
WP_015374194.1|789835_790393_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_015374196.1|791036_792695_-|transposase	IS1634 family transposase	transposase	NA	NA	NA	NA
WP_015374198.1|793669_794470_+	AAA family ATPase	NA	NA	NA	NA	NA
WP_015374199.1|794672_795011_-|transposase	IS3 family transposase	transposase	NA	NA	NA	NA
WP_015374200.1|795723_796860_+	hypothetical protein	NA	A0A0H3UZA9	Geobacillus_virus	37.3	6.1e-28
WP_011231214.1|797318_798197_-|transposase	IS982-like element ISGsp1 family transposase	transposase	NA	NA	NA	NA
>prophage 4
NC_020210	Geobacillus sp. GHH01, complete sequence	3583134	890120	896595	3583134		Pneumococcus_phage(33.33%)	10	NA	NA
WP_015374272.1|890120_890792_+	7-cyano-7-deazaguanine synthase QueC	NA	A0A2H4J8Q7	uncultured_Caudovirales_phage	57.7	3.0e-67
WP_015374273.1|890788_891226_+	6-carboxytetrahydropterin synthase QueD	NA	A0A1U9WRB3	Streptococcus_virus	35.8	1.2e-05
WP_015374274.1|891225_891960_+	7-carboxy-7-deazaguanine synthase QueE	NA	E7DN68	Pneumococcus_phage	44.2	6.4e-55
WP_015374275.1|892012_892510_+	NADPH-dependent 7-cyano-7-deazaguanine reductase QueF	NA	E7DN65	Pneumococcus_phage	68.6	3.4e-52
WP_015374276.1|892563_893247_+	NAD(P)H-binding protein	NA	NA	NA	NA	NA
WP_013145942.1|893277_893457_-	DUF2187 family protein	NA	NA	NA	NA	NA
WP_013145941.1|893752_894337_-	LysM peptidoglycan-binding domain-containing protein	NA	A0A172JHR8	Bacillus_phage	46.8	5.0e-42
WP_015374277.1|894537_894732_-	hypothetical protein	NA	NA	NA	NA	NA
WP_015374278.1|894903_895578_+	hypothetical protein	NA	NA	NA	NA	NA
WP_015374279.1|895845_896595_+	glucose 1-dehydrogenase	NA	Q06VL0	Trichoplusia_ni_ascovirus	31.2	7.1e-17
>prophage 5
NC_020210	Geobacillus sp. GHH01, complete sequence	3583134	1297239	1328914	3583134	transposase	Leptospira_phage(33.33%)	19	NA	NA
WP_011231214.1|1297239_1298118_+|transposase	IS982-like element ISGsp1 family transposase	transposase	NA	NA	NA	NA
WP_015374518.1|1298266_1299004_+	hypothetical protein	NA	NA	NA	NA	NA
WP_144052006.1|1299354_1299684_+	hypothetical protein	NA	NA	NA	NA	NA
WP_015374520.1|1299740_1299905_+	hypothetical protein	NA	NA	NA	NA	NA
WP_144052026.1|1300399_1301164_+	hypothetical protein	NA	NA	NA	NA	NA
WP_015374523.1|1301594_1302212_+	hypothetical protein	NA	NA	NA	NA	NA
WP_015374552.1|1303100_1304145_+|transposase	IS630-like element ISBs2 family transposase	transposase	S5VXX4	Leptospira_phage	27.5	1.6e-27
WP_015374525.1|1304310_1305498_-|transposase	IS701 family transposase	transposase	NA	NA	NA	NA
WP_015374528.1|1307650_1309309_+|transposase	IS1634 family transposase	transposase	NA	NA	NA	NA
WP_051049830.1|1310474_1311230_-	3-oxoacyl-ACP reductase FabG	NA	Q06VL0	Trichoplusia_ni_ascovirus	33.3	3.8e-26
WP_015374531.1|1311256_1312117_-	polysaccharide deacetylase	NA	NA	NA	NA	NA
WP_051049844.1|1312173_1313073_-	agmatinase	NA	NA	NA	NA	NA
WP_015374533.1|1315711_1316512_-	AAA family ATPase	NA	NA	NA	NA	NA
WP_015374534.1|1316504_1317755_-|transposase	IS481 family transposase	transposase	M4T586	Rhodobacter_phage	26.6	4.4e-11
WP_144052007.1|1321065_1321269_+	hypothetical protein	NA	NA	NA	NA	NA
WP_041470674.1|1322412_1324029_+	PucR family transcriptional regulator	NA	NA	NA	NA	NA
WP_015374539.1|1324322_1325789_+	CoA-acylating methylmalonate-semialdehyde dehydrogenase	NA	NA	NA	NA	NA
WP_015374540.1|1325925_1327281_+	aspartate aminotransferase family protein	NA	NA	NA	NA	NA
WP_015374541.1|1328014_1328914_+|transposase	Rpn family recombination-promoting nuclease/putative transposase	transposase	NA	NA	NA	NA
>prophage 6
NC_020210	Geobacillus sp. GHH01, complete sequence	3583134	1714547	1736278	3583134	integrase,transposase	Streptococcus_phage(40.0%)	15	1721726:1721785	1731655:1731737
WP_015374822.1|1714547_1716053_+|transposase	IS21 family transposase	transposase	NA	NA	NA	NA
WP_015374823.1|1716049_1716802_+	ATP-binding protein	NA	A0A2L1IVB6	Escherichia_phage	41.0	1.1e-38
WP_015374824.1|1716885_1717608_+	ZIP family metal transporter	NA	NA	NA	NA	NA
WP_015374825.1|1717819_1718269_-	hypothetical protein	NA	NA	NA	NA	NA
WP_015374826.1|1718465_1720127_-|transposase	IS1634 family transposase	transposase	NA	NA	NA	NA
WP_015374828.1|1721501_1721711_+	hypothetical protein	NA	NA	NA	NA	NA
1721726:1721785	attL	TTTTCTGTGAAAATAATGAATCCATGAGCGGTTATTTTCATGCTTGGGTGGCGAGTAAAA	NA	NA	NA	NA
WP_015374830.1|1722562_1723813_+|transposase	IS481 family transposase	transposase	M4T586	Rhodobacter_phage	26.3	9.7e-11
WP_011230283.1|1723805_1724606_+	AAA family ATPase	NA	NA	NA	NA	NA
WP_015374831.1|1724990_1725905_-|integrase	tyrosine-type recombinase/integrase	integrase	A0A1B1IQT7	uncultured_Mediterranean_phage	24.4	2.9e-12
WP_015374832.1|1726199_1727678_-	aldehyde dehydrogenase family protein	NA	NA	NA	NA	NA
WP_015374194.1|1728374_1728932_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_015374835.1|1730316_1731117_+	AAA family ATPase	NA	NA	NA	NA	NA
WP_015374836.1|1731824_1732193_+	helix-turn-helix transcriptional regulator	NA	E4ZFI8	Streptococcus_phage	77.9	4.1e-50
1731655:1731737	attR	TTTTCTGTGAAAATAATGAATCCATGAGCGGTTATTTTCATGCTTGGGTGGCGAGTAAAAGCTTACTCATGGATGTTTTTTGT	NA	NA	NA	NA
WP_015374837.1|1732185_1734324_+	cadmium-translocating P-type ATPase	NA	E4ZFI9	Streptococcus_phage	84.8	0.0e+00
WP_015374838.1|1734616_1736278_-|transposase	IS1634 family transposase	transposase	NA	NA	NA	NA
>prophage 7
NC_020210	Geobacillus sp. GHH01, complete sequence	3583134	1741601	1762985	3583134	integrase,transposase	Indivirus(33.33%)	15	1744751:1744767	1765719:1765735
WP_015374843.1|1741601_1742789_+|transposase	IS701 family transposase	transposase	NA	NA	NA	NA
WP_015374844.1|1742993_1743419_+	NUDIX domain-containing protein	NA	NA	NA	NA	NA
WP_015374846.1|1744441_1746100_-|transposase	IS1634 family transposase	transposase	NA	NA	NA	NA
1744751:1744767	attL	CTCATCCGTGAAAAACG	NA	NA	NA	NA
WP_015374850.1|1748734_1749802_+|transposase	IS630 family transposase	transposase	A0A1V0SCG6	Indivirus	23.7	4.1e-10
WP_041470484.1|1750808_1751516_+	type 1 glutamine amidotransferase-like domain-containing protein	NA	NA	NA	NA	NA
WP_015374853.1|1751753_1752641_+	aminoglycoside 6-adenylyltransferase	NA	E4ZFP8	Streptococcus_phage	38.4	3.5e-55
WP_015374854.1|1752682_1753135_+	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_015374855.1|1753360_1753882_+	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_015374528.1|1754159_1755818_+|transposase	IS1634 family transposase	transposase	NA	NA	NA	NA
WP_015374856.1|1755941_1756541_+	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_015374857.1|1756659_1757538_-|transposase	IS982-like element ISGsp1 family transposase	transposase	NA	NA	NA	NA
WP_015374860.1|1759004_1759481_+	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_015374861.1|1759623_1760247_-	LysE family translocator	NA	NA	NA	NA	NA
WP_015374864.1|1761044_1761452_+	GNAT family acetyltransferase	NA	NA	NA	NA	NA
WP_015374866.1|1762079_1762985_-|integrase	tyrosine-type recombinase/integrase	integrase	A0A1B1IQT7	uncultured_Mediterranean_phage	26.1	1.3e-17
1765719:1765735	attR	CTCATCCGTGAAAAACG	NA	NA	NA	NA
>prophage 8
NC_020210	Geobacillus sp. GHH01, complete sequence	3583134	2160813	2223398	3583134	transposase	Geobacillus_virus(14.29%)	47	NA	NA
WP_015375160.1|2160813_2161926_-|transposase	IS200/IS605 family element transposase accessory protein TnpB	transposase	A0A0H3UZC2	Geobacillus_virus	65.4	1.2e-145
WP_015375161.1|2162135_2163299_-	tryptophan synthase subunit beta	NA	NA	NA	NA	NA
WP_015375162.1|2163702_2165085_+	DNA phosphorothioation system sulfurtransferase DndC	NA	NA	NA	NA	NA
WP_015375163.1|2165074_2167096_+	DNA sulfur modification protein DndD	NA	NA	NA	NA	NA
WP_015375164.1|2167099_2167486_+	DNA sulfur modification protein DndE	NA	NA	NA	NA	NA
WP_015375165.1|2167482_2168631_+	cysteine desulfurase	NA	NA	NA	NA	NA
WP_015375166.1|2168696_2169077_-	DndE family protein	NA	NA	NA	NA	NA
WP_015375167.1|2169064_2171080_-	DNA sulfur modification protein DndD	NA	NA	NA	NA	NA
WP_015375168.1|2171097_2171271_-	hypothetical protein	NA	NA	NA	NA	NA
WP_015375169.1|2171440_2174272_+	hypothetical protein	NA	NA	NA	NA	NA
WP_015375170.1|2174275_2176336_+	UvrD-helicase domain-containing protein	NA	A0A068EQC7	Bacillus_phage	23.1	4.8e-23
WP_015375171.1|2176338_2177436_-	NERD domain-containing protein	NA	NA	NA	NA	NA
WP_015375174.1|2179009_2180437_+	8-oxoguanine deaminase	NA	NA	NA	NA	NA
WP_129447589.1|2180464_2181238_+	ABC transporter ATP-binding protein	NA	A0A076FI99	Aureococcus_anophage	28.5	2.5e-09
WP_015375176.1|2181238_2182099_+	ABC transporter permease	NA	NA	NA	NA	NA
WP_015375177.1|2182308_2183340_+	ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_015375180.1|2184247_2185048_-	AAA family ATPase	NA	NA	NA	NA	NA
WP_015375182.1|2186075_2187443_+|transposase	ISLre2 family transposase	transposase	NA	NA	NA	NA
WP_015375185.1|2189447_2190728_-|transposase	IS110 family transposase	transposase	NA	NA	NA	NA
WP_015375186.1|2190819_2191425_-	nucleotidyltransferase family protein	NA	NA	NA	NA	NA
WP_015375187.1|2191446_2192538_-	XdhC family protein	NA	NA	NA	NA	NA
WP_081601535.1|2192534_2192840_-	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_015375189.1|2194348_2195713_-	allantoinase	NA	NA	NA	NA	NA
WP_051049849.1|2195726_2197202_-	NCS1 family nucleobase:cation symporter-1	NA	NA	NA	NA	NA
WP_015375191.1|2197514_2198771_-	ArgE/DapE family deacylase	NA	NA	NA	NA	NA
WP_041470520.1|2198803_2200042_-	allantoate amidohydrolase	NA	NA	NA	NA	NA
WP_015375193.1|2200218_2201835_+	PucR family transcriptional regulator	NA	NA	NA	NA	NA
WP_041470521.1|2202837_2204337_+	urate oxidase	NA	NA	NA	NA	NA
WP_015375196.1|2204333_2204696_+	hydroxyisourate hydrolase	NA	NA	NA	NA	NA
WP_015375197.1|2204810_2205314_-	(2Fe-2S)-binding protein	NA	A0A0P0IVM8	Acinetobacter_phage	39.6	7.9e-20
WP_015375198.1|2205292_2207590_-	xanthine dehydrogenase subunit D	NA	NA	NA	NA	NA
WP_015375199.1|2207592_2208459_-	xanthine dehydrogenase FAD-binding subunit	NA	NA	NA	NA	NA
WP_015375200.1|2208409_2209045_-	NTP transferase domain-containing protein	NA	NA	NA	NA	NA
WP_168105297.1|2209094_2209292_-	XdhC/CoxF family protein	NA	NA	NA	NA	NA
WP_081601553.1|2209310_2209547_-	XdhC family protein	NA	NA	NA	NA	NA
WP_015375201.1|2209632_2210958_-	NCS2 family permease	NA	A0A0R6PHV4	Moraxella_phage	33.9	3.7e-53
WP_015375202.1|2211421_2212771_+	5'-deoxyadenosine deaminase	NA	NA	NA	NA	NA
WP_015375203.1|2212852_2213383_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_122983787.1|2213397_2213910_+|transposase	IS630 family transposase	transposase	A0A1V0SCG6	Indivirus	28.3	8.3e-09
WP_015375206.1|2214843_2216124_+|transposase	IS110 family transposase	transposase	NA	NA	NA	NA
WP_015375207.1|2216520_2216853_+	hypothetical protein	NA	NA	NA	NA	NA
WP_013144983.1|2216949_2217921_-	sugar phosphate isomerase/epimerase	NA	NA	NA	NA	NA
WP_015375208.1|2218055_2219210_-	Gfo/Idh/MocA family oxidoreductase	NA	NA	NA	NA	NA
WP_015375209.1|2219206_2219956_-	trehalose utilization protein ThuA	NA	NA	NA	NA	NA
WP_015375210.1|2220016_2221096_-	Gfo/Idh/MocA family oxidoreductase	NA	NA	NA	NA	NA
WP_015375211.1|2221238_2222243_-	LacI family transcriptional regulator	NA	C6ZCU4	Enterobacteria_phage	31.7	4.3e-33
WP_015375212.1|2222501_2223398_+|transposase	Rpn family recombination-promoting nuclease/putative transposase	transposase	NA	NA	NA	NA
>prophage 9
NC_020210	Geobacillus sp. GHH01, complete sequence	3583134	2307341	2318041	3583134		Pandoravirus(25.0%)	13	NA	NA
WP_015375268.1|2307341_2308361_-	anthranilate phosphoribosyltransferase	NA	A0A0N7IRD9	Acinetobacter_phage	44.0	1.9e-68
WP_011231689.1|2308354_2309881_-	anthranilate synthase component I	NA	S4VNU7	Pandoravirus	37.4	8.2e-36
WP_015375269.1|2310116_2310497_-	chorismate mutase	NA	NA	NA	NA	NA
WP_015375270.1|2310493_2311594_-	3-dehydroquinate synthase	NA	E5ERI4	Ostreococcus_lucimarinus_virus	30.7	9.1e-21
WP_011231692.1|2311596_2312763_-	chorismate synthase	NA	A0A291AU41	Pandoravirus	36.5	2.0e-42
WP_015375271.1|2312863_2313634_-	protein-glutamate O-methyltransferase CheR	NA	NA	NA	NA	NA
WP_013524132.1|2313706_2314156_-	nucleoside-diphosphate kinase	NA	D2E8E1	Anguillid_herpesvirus	46.2	2.4e-28
WP_015375272.1|2314254_2315217_-	heptaprenyl diphosphate synthase component II	NA	A0A1V0SE37	Indivirus	23.5	2.1e-05
WP_015375273.1|2315232_2315937_-	demethylmenaquinone methyltransferase	NA	NA	NA	NA	NA
WP_015375274.1|2315941_2316721_-	heptaprenyl diphosphate synthase component 1	NA	NA	NA	NA	NA
WP_011231698.1|2316836_2317061_-	trp RNA-binding attenuation protein MtrB	NA	NA	NA	NA	NA
WP_011231699.1|2317073_2317640_-	GTP cyclohydrolase I FolE	NA	E7DN69	Pneumococcus_phage	56.7	8.2e-50
WP_008879623.1|2317768_2318041_-	HU family DNA-binding protein	NA	A7KV42	Bacillus_phage	78.9	3.5e-30
>prophage 10
NC_020210	Geobacillus sp. GHH01, complete sequence	3583134	2332573	2367181	3583134	protease,transposase,coat	Diadromus_pulchellus_ascovirus(20.0%)	39	NA	NA
WP_015375279.1|2332573_2333251_-|protease	intramembrane metalloprotease PrsW	protease	NA	NA	NA	NA
WP_012820743.1|2333339_2334311_-	asparaginase	NA	NA	NA	NA	NA
WP_015375280.1|2334681_2335674_-	YpdA family putative bacillithiol disulfide reductase	NA	NA	NA	NA	NA
WP_015375281.1|2335763_2337035_-	Glu/Leu/Phe/Val dehydrogenase	NA	NA	NA	NA	NA
WP_015375282.1|2337207_2337798_-	genetic competence negative regulator	NA	NA	NA	NA	NA
WP_015375283.1|2337885_2338689_-	metallophosphoesterase	NA	NA	NA	NA	NA
WP_015375284.1|2338700_2339093_-	hypothetical protein	NA	NA	NA	NA	NA
WP_014196217.1|2339196_2339427_+|coat	spore coat associated protein CotJA	coat	NA	NA	NA	NA
WP_014196218.1|2339423_2339684_+|coat	spore coat protein CotJB	coat	NA	NA	NA	NA
WP_011231723.1|2339718_2340288_+	hypothetical protein	NA	NA	NA	NA	NA
WP_011231724.1|2340313_2340760_-	YpbF family protein	NA	NA	NA	NA	NA
WP_011231725.1|2340858_2341389_-	LysM peptidoglycan-binding domain-containing protein	NA	NA	NA	NA	NA
WP_011231726.1|2341385_2341970_-|protease	CPBP family intramembrane metalloprotease	protease	NA	NA	NA	NA
WP_014196219.1|2341953_2343477_-	ATP-dependent DNA helicase RecQ	NA	F2NZ48	Diadromus_pulchellus_ascovirus	39.0	3.3e-61
WP_014196220.1|2343464_2344511_-	Rrf2 family transcriptional regulator	NA	NA	NA	NA	NA
WP_011231729.1|2344764_2345013_+	ferredoxin	NA	A0A127AYY7	Bacillus_phage	53.3	5.6e-19
WP_011231730.1|2345177_2345681_+	inorganic diphosphatase	NA	A0A2H4J8U1	uncultured_Caudovirales_phage	44.8	1.0e-27
WP_012820732.1|2345902_2347477_+	phosphoglycerate dehydrogenase	NA	A0A1B1IVB5	uncultured_Mediterranean_phage	34.0	1.0e-33
WP_015375285.1|2347738_2348551_-	histidinol-phosphatase	NA	NA	NA	NA	NA
WP_011231736.1|2348835_2349930_-	UDP-glucose dehydrogenase	NA	NA	NA	NA	NA
WP_011231737.1|2349907_2350453_-	RNA polymerase sigma factor SigX	NA	NA	NA	NA	NA
WP_015375286.1|2350566_2351283_-	hypothetical protein	NA	NA	NA	NA	NA
WP_015375287.1|2351275_2351764_-	ECF transporter S component	NA	NA	NA	NA	NA
WP_011231740.1|2351760_2352339_-	cob(I)yrinic acid a,c-diamide adenosyltransferase	NA	NA	NA	NA	NA
WP_011231741.1|2352353_2352770_-	hypothetical protein	NA	NA	NA	NA	NA
WP_015375288.1|2352721_2353354_-	histidine phosphatase family protein	NA	NA	NA	NA	NA
WP_015375289.1|2353311_2354097_-	adenosylcobinamide-GDP ribazoletransferase	NA	NA	NA	NA	NA
WP_015375290.1|2354093_2354651_-	bifunctional adenosylcobinamide kinase/adenosylcobinamide-phosphate guanylyltransferase	NA	NA	NA	NA	NA
WP_015375291.1|2354647_2355718_-	threonine-phosphate decarboxylase	NA	NA	NA	NA	NA
WP_015375292.1|2355674_2356649_-	cobalamin biosynthesis protein	NA	NA	NA	NA	NA
WP_041470529.1|2356645_2358118_-	ATP-binding cassette domain-containing protein	NA	A0A2H4PQG7	Staphylococcus_phage	26.0	7.7e-15
WP_041470530.1|2358114_2359170_-	iron ABC transporter permease	NA	NA	NA	NA	NA
WP_015375295.1|2359135_2360095_-	ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_015375296.1|2360504_2360969_-	NUDIX hydrolase	NA	NA	NA	NA	NA
WP_015375298.1|2362483_2363071_-	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_015375299.1|2363500_2364379_-|transposase	IS982 family transposase	transposase	NA	NA	NA	NA
WP_015375300.1|2364539_2365154_-	DUF1696 domain-containing protein	NA	NA	NA	NA	NA
WP_015375301.1|2365224_2365944_-	PTS transporter subunit EIIC	NA	NA	NA	NA	NA
WP_015375302.1|2366125_2367181_-|transposase	IS200/IS605 family element transposase accessory protein TnpB	transposase	NA	NA	NA	NA
>prophage 11
NC_020210	Geobacillus sp. GHH01, complete sequence	3583134	2379265	2389118	3583134		Staphylococcus_phage(50.0%)	11	NA	NA
WP_168105300.1|2379265_2380360_-	D-alanyl-D-alanine carboxypeptidase	NA	B6DZZ7	Stx2-converting_phage	33.6	3.7e-22
WP_013144844.1|2380763_2382077_-	superoxide dismutase	NA	Q56AR7	Bacillus_thuringiensis_phage	44.1	4.0e-39
WP_015375313.1|2382433_2382835_-	hypothetical protein	NA	NA	NA	NA	NA
WP_033005253.1|2382854_2383508_-	SMC-Scp complex subunit ScpB	NA	A0A1B1IVT7	uncultured_Mediterranean_phage	35.3	1.3e-14
WP_033005256.1|2383687_2384443_-	segregation/condensation protein A	NA	A0A1B1IVW1	uncultured_Mediterranean_phage	24.5	9.4e-09
WP_012820694.1|2384637_2385177_+	DUF309 domain-containing protein	NA	NA	NA	NA	NA
WP_013144843.1|2385199_2385556_-	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_011231776.1|2385676_2386141_-	6,7-dimethyl-8-ribityllumazine synthase	NA	A0A2H4PQS3	Staphylococcus_phage	61.1	1.0e-42
WP_014196246.1|2386161_2387355_-	bifunctional 3,4-dihydroxy-2-butanone-4-phosphate synthase/GTP cyclohydrolase II	NA	A0A2H4PQS2	Staphylococcus_phage	54.1	1.5e-117
WP_020756695.1|2387376_2388021_-	riboflavin synthase	NA	A0A2H4PQS5	Staphylococcus_phage	41.8	5.1e-40
WP_013144840.1|2387975_2389118_-	bifunctional diaminohydroxyphosphoribosylaminopyrimidine deaminase/5-amino-6-(5-phosphoribosylamino)uracil reductase RibD	NA	A0A2H4PQS8	Staphylococcus_phage	36.5	6.9e-56
>prophage 12
NC_020210	Geobacillus sp. GHH01, complete sequence	3583134	2660403	2721871	3583134	protease,tRNA,transposase,coat	Salmonella_phage(20.0%)	57	NA	NA
WP_015375490.1|2660403_2661939_-|coat	SafA/ExsA family spore coat assembly protein	coat	NA	NA	NA	NA
WP_015375491.1|2662096_2663200_-	quinolinate synthase NadA	NA	NA	NA	NA	NA
WP_015375492.1|2663214_2664045_-	carboxylating nicotinate-nucleotide diphosphorylase	NA	NA	NA	NA	NA
WP_041470555.1|2664073_2665630_-	L-aspartate oxidase	NA	NA	NA	NA	NA
WP_013524233.1|2665735_2666860_+	IscS subfamily cysteine desulfurase	NA	NA	NA	NA	NA
WP_013144620.1|2666875_2667415_+	transcription repressor NadR	NA	NA	NA	NA	NA
WP_015375494.1|2667523_2668372_-	prephenate dehydratase	NA	NA	NA	NA	NA
WP_011232081.1|2668393_2668837_-	ACT domain-containing protein	NA	NA	NA	NA	NA
WP_011232082.1|2668853_2670152_-	GTPase ObgE	NA	NA	NA	NA	NA
WP_015375495.1|2670390_2670939_-	sporulation initiation phosphotransferase B	NA	NA	NA	NA	NA
WP_011232084.1|2671109_2671400_-	50S ribosomal protein L27	NA	NA	NA	NA	NA
WP_015375496.1|2671415_2671745_-|protease	ribosomal-processing cysteine protease Prp	protease	NA	NA	NA	NA
WP_011232086.1|2671747_2672056_-	50S ribosomal protein L21	NA	NA	NA	NA	NA
WP_015375497.1|2672524_2673385_-	stage IV sporulation protein FB	NA	NA	NA	NA	NA
WP_015375498.1|2673377_2674145_-	M23 family metallopeptidase	NA	NA	NA	NA	NA
WP_013524236.1|2674120_2674381_-	hypothetical protein	NA	NA	NA	NA	NA
WP_014196423.1|2674404_2675211_-	septum site-determining protein MinD	NA	NA	NA	NA	NA
WP_020278403.1|2675213_2675897_-	septum site-determining protein MinC	NA	NA	NA	NA	NA
WP_015375499.1|2675946_2676465_-	rod shape-determining protein MreD	NA	NA	NA	NA	NA
WP_015375500.1|2676461_2677328_-	rod shape-determining protein MreC	NA	NA	NA	NA	NA
WP_011232093.1|2677347_2678370_-	rod shape-determining protein	NA	NA	NA	NA	NA
WP_015375501.1|2678527_2679208_-	DNA repair protein RadC	NA	NA	NA	NA	NA
WP_015375502.1|2679343_2679919_-	septum formation inhibitor Maf	NA	NA	NA	NA	NA
WP_015375503.1|2680347_2681463_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011232097.1|2681579_2682041_-	type II secretion system protein	NA	NA	NA	NA	NA
WP_014196429.1|2682062_2682782_-	hypothetical protein	NA	NA	NA	NA	NA
WP_013144607.1|2682778_2683354_-	fimbrial protein	NA	NA	NA	NA	NA
WP_015375504.1|2683343_2684282_-	pilus assembly protein PilM	NA	NA	NA	NA	NA
WP_015375505.1|2684303_2685065_-	prepilin peptidase	NA	NA	NA	NA	NA
WP_015375506.1|2685126_2685546_-	prepilin-type N-terminal cleavage/methylation domain-containing protein	NA	NA	NA	NA	NA
WP_015375508.1|2686059_2687151_+|transposase	IS4 family transposase	transposase	NA	NA	NA	NA
WP_015375510.1|2688345_2689557_-	type II secretion system F family protein	NA	NA	NA	NA	NA
WP_041470558.1|2689543_2690599_-	type IV pilus twitching motility protein PilT	NA	NA	NA	NA	NA
WP_015375512.1|2690611_2692276_-	Flp pilus assembly complex ATPase component TadA	NA	NA	NA	NA	NA
WP_015375513.1|2692272_2693643_-	hypothetical protein	NA	NA	NA	NA	NA
WP_015375514.1|2693659_2694439_-	hypothetical protein	NA	NA	NA	NA	NA
WP_015375515.1|2694428_2696045_-	hypothetical protein	NA	NA	NA	NA	NA
WP_015375516.1|2696188_2696809_+	prepilin-type N-terminal cleavage/methylation domain-containing protein	NA	NA	NA	NA	NA
WP_014196441.1|2696792_2697371_+	hypothetical protein	NA	NA	NA	NA	NA
WP_015375517.1|2697413_2699120_+	hypothetical protein	NA	NA	NA	NA	NA
WP_015375518.1|2699215_2701486_-	VWA domain-containing protein	NA	J9Q6D6	Salmonella_phage	31.3	7.9e-11
WP_015375519.1|2701554_2702850_-	bifunctional folylpolyglutamate synthase/dihydrofolate synthase	NA	NA	NA	NA	NA
WP_015375520.1|2703067_2705710_-|tRNA	valine--tRNA ligase	tRNA	A0A1V0S951	Catovirus	42.5	8.5e-166
WP_011232115.1|2706282_2706471_+	hypothetical protein	NA	NA	NA	NA	NA
WP_015375521.1|2706509_2707541_-|coat	spore coat protein YsxE	coat	NA	NA	NA	NA
WP_015375522.1|2707584_2708640_-	stage VI sporulation protein D	NA	NA	NA	NA	NA
WP_031407912.1|2708758_2710048_-	glutamate-1-semialdehyde 2,1-aminomutase	NA	NA	NA	NA	NA
WP_013144588.1|2710064_2711039_-	porphobilinogen synthase	NA	NA	NA	NA	NA
WP_015375524.1|2711039_2711807_-	uroporphyrinogen-III synthase	NA	NA	NA	NA	NA
WP_015375525.1|2711803_2712736_-	hydroxymethylbilane synthase	NA	NA	NA	NA	NA
WP_041470563.1|2712751_2713573_-	cytochrome c biogenesis protein CcsA	NA	NA	NA	NA	NA
WP_015375527.1|2713579_2714938_-|tRNA	glutamyl-tRNA reductase	tRNA	NA	NA	NA	NA
WP_013144583.1|2715104_2715590_+	hypothetical protein	NA	NA	NA	NA	NA
WP_013144582.1|2715631_2716219_-	YihA family ribosome biogenesis GTP-binding protein	NA	NA	NA	NA	NA
WP_041470564.1|2716215_2718558_-	endopeptidase La	NA	A0A0R6PGP8	Moraxella_phage	43.2	8.4e-173
WP_014196454.1|2718788_2720462_-|protease	ATP-dependent protease LonB	protease	A0A076FMQ5	Aureococcus_anophage	32.7	1.1e-12
WP_011232128.1|2720605_2721871_-|protease	ATP-dependent protease ATP-binding subunit ClpX	protease	G3M9Z9	Bacillus_virus	67.0	6.3e-151
>prophage 13
NC_020210	Geobacillus sp. GHH01, complete sequence	3583134	3340845	3383922	3583134	transposase	Mycoplasma_phage(33.33%)	34	NA	NA
WP_051049851.1|3340845_3341664_-|transposase	IS982 family transposase	transposase	NA	NA	NA	NA
WP_015374689.1|3341975_3343343_+|transposase	ISLre2 family transposase	transposase	NA	NA	NA	NA
WP_013524772.1|3344241_3345135_-|transposase	Rpn family recombination-promoting nuclease/putative transposase	transposase	NA	NA	NA	NA
WP_015375972.1|3345336_3346269_-	DMT family transporter	NA	NA	NA	NA	NA
WP_015375973.1|3346538_3347015_+	hypothetical protein	NA	NA	NA	NA	NA
WP_015375974.1|3347374_3347872_+	L,D-transpeptidase family protein	NA	NA	NA	NA	NA
WP_015375977.1|3350043_3351117_-	FAD-binding oxidoreductase	NA	NA	NA	NA	NA
WP_099233107.1|3351122_3351446_-	(2Fe-2S)-binding protein	NA	NA	NA	NA	NA
WP_015375978.1|3351473_3352562_-	FAD-dependent oxidoreductase	NA	NA	NA	NA	NA
WP_015375979.1|3352563_3352875_-	(2Fe-2S)-binding protein	NA	NA	NA	NA	NA
WP_015375980.1|3352890_3353691_-	ABC transporter permease	NA	NA	NA	NA	NA
WP_015375981.1|3353687_3354608_-	ABC transporter permease	NA	Q6GZ02	Mycoplasma_phage	25.1	5.5e-11
WP_015375982.1|3354622_3355696_-	ABC transporter ATP-binding protein	NA	G3M9Y6	Bacillus_virus	38.2	9.2e-34
WP_041470778.1|3355713_3356799_-	ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_015375984.1|3357195_3357912_-	GntR family transcriptional regulator	NA	NA	NA	NA	NA
WP_015375987.1|3360161_3360614_+	N-acetyltransferase	NA	NA	NA	NA	NA
WP_011888351.1|3360963_3361221_-	DUF2283 domain-containing protein	NA	NA	NA	NA	NA
WP_015375988.1|3361189_3361585_-	hypothetical protein	NA	NA	NA	NA	NA
WP_015375990.1|3363827_3364595_+	DeoR/GlpR transcriptional regulator	NA	A0A077SK06	Escherichia_phage	35.8	5.4e-28
WP_015375991.1|3364746_3366069_+	four-carbon acid sugar kinase family protein	NA	NA	NA	NA	NA
WP_015375992.1|3366052_3367069_+	4-hydroxythreonine-4-phosphate dehydrogenase PdxA	NA	NA	NA	NA	NA
WP_015375993.1|3367119_3368490_+	gluconate transporter	NA	NA	NA	NA	NA
WP_015375995.1|3368892_3369891_-	DUF4003 domain-containing protein	NA	NA	NA	NA	NA
WP_015375996.1|3370405_3372736_-	beta-glucosidase	NA	NA	NA	NA	NA
WP_015375997.1|3373149_3374448_+	hypothetical protein	NA	NA	NA	NA	NA
WP_015375998.1|3374606_3376133_+	AbgT family transporter	NA	NA	NA	NA	NA
WP_015375999.1|3376165_3377425_+	amidohydrolase	NA	NA	NA	NA	NA
WP_015376000.1|3377438_3378842_+	amidohydrolase	NA	NA	NA	NA	NA
WP_015376001.1|3379160_3380294_+|transposase	IS4 family transposase	transposase	NA	NA	NA	NA
WP_011888351.1|3380685_3380943_-	DUF2283 domain-containing protein	NA	NA	NA	NA	NA
WP_015376003.1|3380911_3381307_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011888353.1|3381306_3381585_-	DUF3467 domain-containing protein	NA	NA	NA	NA	NA
WP_015376004.1|3381873_3382350_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_015376005.1|3382746_3383922_+|transposase	ISL3 family transposase	transposase	NA	NA	NA	NA
>prophage 14
NC_020210	Geobacillus sp. GHH01, complete sequence	3583134	3552597	3562417	3583134		uncultured_Mediterranean_phage(16.67%)	8	NA	NA
WP_015376120.1|3552597_3553818_-	PDZ domain-containing protein	NA	A0A1B1IT49	uncultured_Mediterranean_phage	28.8	6.1e-18
WP_013146695.1|3553919_3554714_-	MBL fold metallo-hydrolase	NA	A0A0C5AJ83	Bacteriophage	37.7	6.5e-45
WP_013146696.1|3554720_3555503_-	hypothetical protein	NA	NA	NA	NA	NA
WP_015376121.1|3555489_3556818_-	hypothetical protein	NA	NA	NA	NA	NA
WP_015376122.1|3556810_3558640_-	cell wall metabolism sensor histidine kinase WalK	NA	A0A1V0SGX0	Hokovirus	27.2	5.6e-23
WP_011232938.1|3558646_3559360_-	response regulator transcription factor	NA	W8CYM9	Bacillus_phage	41.4	1.7e-44
WP_015376123.1|3559548_3560835_-	adenylosuccinate synthase	NA	A0A2P1EKE7	Megavirus	36.5	7.8e-72
WP_013146699.1|3561052_3562417_-	replicative DNA helicase	NA	A0A1P8VVQ6	Streptococcus_phage	52.8	7.9e-123
