The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
NC_020211	Serratia marcescens WW4, complete sequence	5241455	2093135	2133377	5241455	capsid,terminase,plate,integrase	uncultured_Caudovirales_phage(33.33%)	60	2093034:2093056	2137341:2137363
2093034:2093056	attL	AGGAATCGTATTCGGTCTTTTTT	NA	NA	NA	NA
WP_041922215.1|2093135_2094218_-|integrase	phage integrase Arm DNA-binding domain-containing protein	integrase	A0A2H4IYC8	uncultured_Caudovirales_phage	51.0	6.3e-99
WP_161727346.1|2094192_2094456_-	excisionase	NA	A0A2H4J5E1	uncultured_Caudovirales_phage	38.5	1.2e-08
WP_015377486.1|2094543_2095611_-	recombinase RecT	NA	A0A2R9YJJ1	Escherichia_phage	59.3	3.0e-77
WP_015377487.1|2095625_2098268_-	PD-(D/E)XK nuclease-like domain-containing protein	NA	H6WRX1	Salmonella_phage	39.4	1.2e-143
WP_151262562.1|2098430_2098661_-	hypothetical protein	NA	NA	NA	NA	NA
WP_041922216.1|2098772_2098934_-	DUF3927 family protein	NA	A0A0A0YRI9	Escherichia_phage	62.7	4.9e-08
WP_015377488.1|2098933_2099359_-	tellurite/colicin resistance protein	NA	Q71TK7	Escherichia_phage	84.4	1.6e-58
WP_144062351.1|2099453_2099762_-	hypothetical protein	NA	NA	NA	NA	NA
WP_041922217.1|2099843_2101295_-	ATP-binding protein	NA	X5I2M2	Pseudomonas_phage	69.7	2.0e-193
WP_015377490.1|2101405_2101600_-	hypothetical protein	NA	NA	NA	NA	NA
WP_151262564.1|2101737_2101917_-	hypothetical protein	NA	NA	NA	NA	NA
WP_015377491.1|2102254_2102443_-	hypothetical protein	NA	NA	NA	NA	NA
WP_151262565.1|2102552_2102981_-	hypothetical protein	NA	NA	NA	NA	NA
WP_041922219.1|2102977_2103367_-	helix-turn-helix domain-containing protein	NA	A0A0M4R5D1	Salmonella_phage	61.3	2.1e-36
WP_041922220.1|2103470_2103716_+	helix-turn-helix domain-containing protein	NA	A0A0M4QX15	Salmonella_phage	74.4	1.2e-26
WP_015377493.1|2103727_2104189_+	hypothetical protein	NA	H9C162	Pectobacterium_phage	42.6	2.8e-16
WP_041922221.1|2104317_2105253_+	hypothetical protein	NA	A0A193GZ86	Enterobacter_phage	39.8	3.2e-35
WP_147095333.1|2105203_2105740_+	replication protein	NA	A0A0U2JGJ0	Escherichia_phage	50.7	3.9e-41
WP_015377495.1|2105754_2106135_+	hypothetical protein	NA	NA	NA	NA	NA
WP_015377496.1|2106134_2106335_+	DUF1482 family protein	NA	NA	NA	NA	NA
WP_015377497.1|2106592_2106769_+	hypothetical protein	NA	NA	NA	NA	NA
WP_015377498.1|2106828_2107425_+	DUF1367 family protein	NA	H9C173	Pectobacterium_phage	55.6	7.8e-59
WP_041922222.1|2107421_2107706_+	DUF1364 domain-containing protein	NA	H9C174	Pectobacterium_phage	73.4	4.1e-34
WP_015377499.1|2107702_2108263_+	DUF1133 family protein	NA	A0A0U2S606	Escherichia_phage	52.8	4.0e-49
WP_151262566.1|2108401_2108683_+	hypothetical protein	NA	NA	NA	NA	NA
WP_049810920.1|2108856_2109555_+	hypothetical protein	NA	A0A0C4UQZ7	Shigella_phage	68.1	2.5e-88
WP_015377501.1|2109618_2109891_+	hypothetical protein	NA	A0A1V0E5R8	Salmonella_phage	74.4	4.1e-31
WP_015377502.1|2109890_2110385_+	lysozyme	NA	A0A2H4FND7	Salmonella_phage	72.4	2.4e-61
WP_015377503.1|2110381_2110768_+	DUF2570 family protein	NA	NA	NA	NA	NA
WP_015377504.1|2110799_2110937_+	hypothetical protein	NA	NA	NA	NA	NA
WP_015377505.1|2110923_2111154_+	hypothetical protein	NA	NA	NA	NA	NA
WP_015377506.1|2111401_2112094_+	DUF4145 domain-containing protein	NA	A0A1S5S8Y9	Streptococcus_phage	56.2	1.5e-40
WP_015377507.1|2112235_2112967_+|terminase	terminase small subunit	terminase	NA	NA	NA	NA
WP_049811600.1|2112978_2114214_+|terminase	PBSX family phage terminase large subunit	terminase	A0A2H4J196	uncultured_Caudovirales_phage	66.1	1.7e-153
WP_015377509.1|2114210_2115674_+	DUF1073 domain-containing protein	NA	A0A2H4IYV2	uncultured_Caudovirales_phage	65.3	9.8e-188
WP_049811601.1|2115621_2116284_+|capsid	minor capsid protein	capsid	A0A2H4J8F5	uncultured_Caudovirales_phage	60.0	7.8e-68
WP_015377511.1|2116287_2117511_+	DUF2213 domain-containing protein	NA	A0A2H4J159	uncultured_Caudovirales_phage	57.8	2.5e-112
WP_015377512.1|2117522_2118014_+	hypothetical protein	NA	A0A2H4JHM9	uncultured_Caudovirales_phage	63.4	1.4e-50
WP_015377513.1|2118028_2118973_+	DUF2184 domain-containing protein	NA	A0A2H4J191	uncultured_Caudovirales_phage	82.7	7.3e-152
WP_015377514.1|2119007_2119400_+	hypothetical protein	NA	NA	NA	NA	NA
WP_015377515.1|2119386_2119791_+	DUF4054 domain-containing protein	NA	A0A0M5M3S2	Salmonella_phage	67.4	2.8e-44
WP_015377516.1|2119787_2120351_+	hypothetical protein	NA	A0A0M4S631	Salmonella_phage	54.8	2.5e-46
WP_015377517.1|2120337_2120727_+	hypothetical protein	NA	A0A0M3ULK0	Salmonella_phage	81.4	1.4e-53
WP_041922223.1|2120701_2121265_+	hypothetical protein	NA	A0A2H4J1A0	uncultured_Caudovirales_phage	61.1	3.5e-61
WP_015377519.1|2121267_2122749_+	DUF3383 domain-containing protein	NA	A0A0P0I492	Acinetobacter_phage	51.3	6.3e-134
WP_015377520.1|2122760_2123201_+	DUF3277 family protein	NA	A0A2H4J619	uncultured_Caudovirales_phage	64.4	2.5e-46
WP_015377521.1|2123211_2123640_+	hypothetical protein	NA	A0A2H4J2V6	uncultured_Caudovirales_phage	59.9	1.9e-38
WP_015377523.1|2123818_2125825_+	lytic transglycosylase domain-containing protein	NA	A0A0M4REK7	Salmonella_phage	57.4	2.6e-207
WP_015377524.1|2125824_2126430_+	hypothetical protein	NA	A0A2H4J1B3	uncultured_Caudovirales_phage	68.6	1.3e-61
WP_015377525.1|2126426_2126732_+	hypothetical protein	NA	A0A0M4R5B7	Salmonella_phage	48.5	4.7e-20
WP_015377526.1|2126735_2127797_+	hypothetical protein	NA	A0A2H4J1B2	uncultured_Caudovirales_phage	69.3	3.5e-142
WP_015377527.1|2127806_2128151_+	hypothetical protein	NA	A0A2H4J1A5	uncultured_Caudovirales_phage	46.4	9.8e-22
WP_015377528.1|2128289_2128850_+	hypothetical protein	NA	NA	NA	NA	NA
WP_041922224.1|2128846_2129086_+	hypothetical protein	NA	NA	NA	NA	NA
WP_041922225.1|2129095_2129458_+	protein-export chaperone SecB	NA	NA	NA	NA	NA
WP_015377529.1|2129514_2130285_+|plate	phage baseplate assembly protein V	plate	A0A0M5M1K7	Salmonella_phage	62.4	2.9e-82
WP_015377530.1|2130281_2130632_+	hypothetical protein	NA	A9YX11	Burkholderia_phage	61.1	1.6e-32
WP_015377531.1|2130624_2131815_+|plate	baseplate J/gp47 family protein	plate	A0A0M4RD32	Salmonella_phage	54.1	4.0e-107
WP_015377532.1|2131811_2132390_+	DUF2612 domain-containing protein	NA	A9YX13	Burkholderia_phage	46.2	5.4e-41
WP_015377533.1|2132390_2133377_+	hypothetical protein	NA	A0A0M3ULD8	Salmonella_phage	49.5	9.4e-17
2137341:2137363	attR	AGGAATCGTATTCGGTCTTTTTT	NA	NA	NA	NA
>prophage 2
NC_020211	Serratia marcescens WW4, complete sequence	5241455	2289189	2315452	5241455	protease,coat	Moraxella_phage(50.0%)	25	NA	NA
WP_015377659.1|2289189_2290608_+|protease	serralysin family metalloprotease	protease	NA	NA	NA	NA
WP_004931526.1|2290755_2290965_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004931524.1|2291122_2291275_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004931522.1|2291743_2292136_+	ASCH domain-containing protein	NA	NA	NA	NA	NA
WP_015377661.1|2292140_2292740_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004931517.1|2292795_2293035_-	YebV family protein	NA	NA	NA	NA	NA
WP_004931514.1|2293170_2294103_-|coat	spore coat protein U domain-containing protein	coat	NA	NA	NA	NA
WP_193378551.1|2294123_2296544_-	fimbrial biogenesis outer membrane usher protein	NA	NA	NA	NA	NA
WP_015377663.1|2296611_2297376_-	molecular chaperone	NA	NA	NA	NA	NA
WP_166445048.1|2297400_2297949_-|coat	spore coat protein U domain-containing protein	coat	NA	NA	NA	NA
WP_033633239.1|2297954_2298458_-|coat	spore coat protein U domain-containing protein	coat	NA	NA	NA	NA
WP_015377665.1|2298460_2299000_-|coat	spore coat protein U domain-containing protein	coat	NA	NA	NA	NA
WP_041922228.1|2299274_2300711_-	16S rRNA (cytosine(1407)-C(5))-methyltransferase RsmF	NA	NA	NA	NA	NA
WP_015377667.1|2300813_2303444_-	PqiB family protein	NA	NA	NA	NA	NA
WP_031300492.1|2303412_2304660_-	membrane integrity lipid transport subunit YebS	NA	NA	NA	NA	NA
WP_015377669.1|2304915_2305413_+	GAF domain-containing protein	NA	NA	NA	NA	NA
WP_004931497.1|2305509_2306220_+	RNA chaperone ProQ	NA	NA	NA	NA	NA
WP_015377670.1|2306239_2308288_+	carboxy terminal-processing peptidase	NA	A0A0R6PIZ1	Moraxella_phage	33.7	3.4e-85
WP_015377671.1|2308355_2309201_-	DMT family transporter	NA	NA	NA	NA	NA
WP_015377672.1|2309197_2310505_-	opine metallophore biosynthesis dehydrogenase	NA	NA	NA	NA	NA
WP_004931490.1|2310497_2311295_-	hypothetical protein	NA	NA	NA	NA	NA
WP_015377673.1|2311282_2312068_-	ABC transporter ATP-binding protein	NA	W6JKT0	Anomala_cuprea_entomopoxvirus	27.6	2.3e-10
WP_151262586.1|2312064_2313081_-	iron ABC transporter permease	NA	NA	NA	NA	NA
WP_015377675.1|2313107_2314199_-	ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_004931482.1|2314567_2315452_+|protease	protease HtpX	protease	NA	NA	NA	NA
>prophage 3
NC_020211	Serratia marcescens WW4, complete sequence	5241455	4576811	4615707	5241455	lysis,plate,head,integrase,capsid,portal,tRNA,terminase,tail	Erwinia_phage(39.47%)	49	4583442:4583490	4616528:4616576
WP_015379097.1|4576811_4577825_-|tRNA	tRNA (adenosine(37)-N6)-threonylcarbamoyltransferase complex transferase subunit TsaD	tRNA	A0A0R6PI74	Moraxella_phage	59.5	1.7e-109
WP_001144069.1|4578150_4578366_+	30S ribosomal protein S21	NA	NA	NA	NA	NA
WP_015379098.1|4578502_4580251_+	DNA primase	NA	A0A0K1LMQ9	Caulobacter_phage	38.8	8.7e-74
WP_004937194.1|4580408_4582250_+	RNA polymerase sigma factor RpoD	NA	A0A2I7SAT0	Vibrio_phage	33.3	1.9e-34
WP_041922282.1|4582305_4582749_-	ester cyclase	NA	NA	NA	NA	NA
WP_015379100.1|4582775_4583264_-	G/U mismatch-specific DNA glycosylase	NA	NA	NA	NA	NA
4583442:4583490	attL	CTCATAATCGCTTGGTCGTTGGTTCAAACCCAACAGGGGCCACCAAATT	NA	NA	NA	NA
WP_071824297.1|4583890_4584121_-	DNA-binding transcriptional regulator	NA	Q37973	Salmonella_virus	64.5	1.9e-21
WP_015379101.1|4584218_4585367_-	phage late control D family protein	NA	A0A218M4J7	Erwinia_phage	63.9	7.6e-127
WP_015379102.1|4585363_4585849_-|tail	phage tail protein	tail	A0A0F7LDE8	Escherichia_phage	65.7	1.5e-47
WP_015379103.1|4585848_4588626_-|tail	phage tail tape measure protein	tail	Q7Y4C8	Escherichia_virus	39.6	2.1e-98
WP_026142543.1|4588618_4588741_-|tail	GpE family phage tail protein	tail	Q6K1G8	Salmonella_virus	75.0	3.0e-10
WP_015379104.1|4588773_4589055_-|tail	phage tail assembly protein	tail	A0A0F7LDQ8	Escherichia_phage	70.1	1.8e-26
WP_015379105.1|4589109_4589619_-|tail	phage major tail tube protein	tail	A0A218M4J0	Erwinia_phage	75.6	4.9e-70
WP_015379106.1|4589634_4590804_-|tail	phage tail sheath protein	tail	F1BUU3	Erwinia_phage	81.2	9.9e-183
WP_015379107.1|4591080_4591602_-|tail	tail fiber assembly protein	tail	F1BUK2	Cronobacter_phage	48.0	8.6e-38
WP_015379108.1|4591603_4594138_-|tail	phage tail protein	tail	Q858V4	Yersinia_virus	53.3	1.3e-57
WP_015379109.1|4594147_4594681_-|tail	phage tail protein I	tail	Q858V5	Yersinia_virus	76.6	4.3e-77
WP_015379110.1|4594673_4595582_-|plate	baseplate assembly protein	plate	A0A1J0I2M3	Salmonella_phage	67.9	6.2e-108
WP_015379111.1|4595586_4595937_-	GPW/gp25 family protein	NA	F1BUP4	Erwinia_phage	66.4	1.1e-36
WP_154231760.1|4595933_4596074_-	hypothetical protein	NA	NA	NA	NA	NA
WP_015379112.1|4596084_4596714_-|plate	phage baseplate assembly protein V	plate	A0A0M4S6F6	Salmonella_phage	73.8	1.5e-76
WP_015379113.1|4596786_4597233_-	phage virion morphogenesis protein	NA	O80313	Escherichia_phage	59.9	2.7e-40
WP_015379114.1|4597219_4597696_-|tail	phage tail protein	tail	F1BUP9	Erwinia_phage	64.7	2.6e-49
WP_015379115.1|4597791_4598220_-|lysis	LysB family phage lysis regulatory protein	lysis	F1BUQ1	Erwinia_phage	36.6	5.5e-14
WP_015379116.1|4598216_4598729_-	lysozyme	NA	A0A218M4K3	Erwinia_phage	67.1	7.4e-58
WP_015379117.1|4598712_4598922_-	hypothetical protein	NA	B6SD15	Bacteriophage	48.2	9.2e-07
WP_015379118.1|4598924_4599128_-|tail	tail protein X	tail	A0A0F7LCN2	Escherichia_phage	68.7	2.4e-20
WP_015379119.1|4599127_4599616_-|head	head completion/stabilization protein	head	F1BUQ6	Erwinia_phage	54.3	1.9e-39
WP_015379120.1|4599709_4600369_-|terminase	terminase endonuclease subunit	terminase	F1BUQ7	Erwinia_phage	69.4	5.2e-80
WP_015379121.1|4600371_4601583_-|capsid	phage major capsid protein, P2 family	capsid	F1BUQ8	Erwinia_phage	78.2	9.7e-157
WP_015379122.1|4601625_4602441_-|capsid	GPO family capsid scaffolding protein	capsid	S4TP53	Salmonella_phage	53.0	2.3e-69
WP_041922283.1|4602583_4604356_+|terminase	terminase ATPase subunit family protein	terminase	F1BUR2	Erwinia_phage	81.9	4.4e-291
WP_015379124.1|4604355_4605390_+|portal	phage portal protein	portal	F1BUR7	Erwinia_phage	80.4	2.6e-163
WP_041922374.1|4605434_4605776_-	type II toxin-antitoxin system HicB family antitoxin	NA	NA	NA	NA	NA
WP_071605322.1|4605775_4606030_-	type II toxin-antitoxin system HicA family toxin	NA	R4JMD3	Burkholderia_phage	47.6	5.9e-16
WP_015379126.1|4606506_4607274_-	RloB domain-containing protein	NA	NA	NA	NA	NA
WP_015379127.1|4607212_4608490_-	ATP-binding protein	NA	NA	NA	NA	NA
WP_015379128.1|4608897_4609122_-	hypothetical protein	NA	NA	NA	NA	NA
WP_015379129.1|4609160_4611377_-	replication endonuclease	NA	A0A0F7LBQ2	Escherichia_phage	58.0	9.8e-240
WP_015379130.1|4611373_4611754_-	hypothetical protein	NA	NA	NA	NA	NA
WP_015379131.1|4611743_4612025_-	DUF5405 family protein	NA	A0A218M4I8	Erwinia_phage	51.2	4.5e-17
WP_015379132.1|4612147_4612372_-	TraR/DksA C4-type zinc finger protein	NA	Q6K1F5	Salmonella_virus	58.3	2.2e-14
WP_041922285.1|4612371_4612665_-	DUF2732 family protein	NA	E5G6L6	Salmonella_phage	54.4	6.4e-06
WP_031221632.1|4612729_4613032_-	hypothetical protein	NA	NA	NA	NA	NA
WP_041922375.1|4613043_4613223_-	DUF2724 domain-containing protein	NA	F1BUS5	Erwinia_phage	53.1	3.0e-06
WP_015379133.1|4613233_4613743_-	phage regulatory CII family protein	NA	A0A1S6L008	Salmonella_phage	53.6	4.2e-45
WP_071824299.1|4613773_4613992_-	regulator	NA	NA	NA	NA	NA
WP_041922286.1|4614101_4614686_+	phage repressor protein CI	NA	F1BUN8	Cronobacter_phage	31.1	5.3e-28
WP_041922287.1|4614690_4615707_+|integrase	tyrosine-type recombinase/integrase	integrase	F1BUS9	Erwinia_phage	64.0	2.0e-123
4616528:4616576	attR	CTCATAATCGCTTGGTCGTTGGTTCAAACCCAACAGGGGCCACCAAATT	NA	NA	NA	NA
