The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
NC_020163	Escherichia coli APEC O78, complete sequence	4798435	237703	250946	4798435	tail,transposase	Shigella_phage(50.0%)	12	NA	NA
WP_000287252.1|237703_238177_+	SocA family protein	NA	K4NZT7	Burkholderia_phage	31.8	2.4e-18
WP_000019186.1|238199_238748_+	hypothetical protein	NA	S5M7T3	Escherichia_phage	89.6	2.7e-82
WP_001093912.1|238781_239051_-	pyocin activator PrtN family protein	NA	S5MQM5	Escherichia_phage	97.8	2.5e-41
WP_001701368.1|239087_239840_-	hypothetical protein	NA	NA	NA	NA	NA
WP_015364383.1|240056_240881_-	DUF2303 family protein	NA	U5P439	Shigella_phage	98.9	1.9e-148
WP_000135682.1|240945_241308_-	hypothetical protein	NA	U5P4J6	Shigella_phage	100.0	3.3e-60
WP_000859462.1|241974_242649_-	LexA family transcriptional repressor	NA	Q8SBF6	Shigella_phage	100.0	1.2e-132
WP_000649475.1|242739_242961_+	helix-turn-helix domain-containing protein	NA	U5P445	Shigella_phage	100.0	6.9e-29
WP_001230372.1|243064_243664_+	Ail/Lom family outer membrane beta-barrel protein	NA	A0A291AWV3	Escherichia_phage	97.0	1.1e-108
WP_001701371.1|243722_247070_+|tail	prophage tail fiber N-terminal domain-containing protein	tail	K7PGT9	Enterobacteria_phage	58.9	2.8e-286
WP_000543834.1|248854_249406_-	SLATT domain-containing protein	NA	NA	NA	NA	NA
WP_088895425.1|249718_250946_+|transposase	IS3-like element IS2 family transposase	transposase	Q9ZXG3	Shigella_phage	99.3	1.3e-177
>prophage 2
NC_020163	Escherichia coli APEC O78, complete sequence	4798435	629173	701239	4798435	holin,integrase,plate,lysis,protease,tail,terminase,tRNA,transposase,portal,head,capsid	Shigella_phage(42.37%)	84	628448:628463	658393:658408
628448:628463	attL	TCGGCATCATCACCAA	NA	NA	NA	NA
WP_001218286.1|629173_630397_+|integrase	site-specific integrase	integrase	A0A291AWU1	Escherichia_phage	99.0	9.5e-237
WP_015364392.1|630581_631823_+	hypothetical protein	NA	NA	NA	NA	NA
WP_024179241.1|632299_632596_-	hypothetical protein	NA	U5P0J0	Shigella_phage	73.4	4.8e-25
WP_000335011.1|632643_633522_-	phosphoadenosine phosphosulfate reductase family protein	NA	A0A2R2Z314	Escherichia_phage	93.1	2.4e-165
WP_000008217.1|633512_634049_-	5'-deoxynucleotidase	NA	A0A291AX04	Escherichia_phage	98.9	6.3e-100
WP_015364393.1|634177_635002_-	DUF2303 family protein	NA	U5P439	Shigella_phage	98.9	5.6e-148
WP_000135682.1|635066_635429_-	hypothetical protein	NA	U5P4J6	Shigella_phage	100.0	3.3e-60
WP_000859460.1|636174_636849_-	LexA family transcriptional regulator	NA	Q8SBF6	Shigella_phage	99.1	1.7e-131
WP_000649477.1|636939_637140_+	helix-turn-helix domain-containing protein	NA	U5P445	Shigella_phage	100.0	7.9e-32
WP_000515860.1|637183_637735_+	hypothetical protein	NA	Q8SBF4	Shigella_phage	100.0	7.6e-101
WP_001087352.1|637731_638568_+	ash family protein	NA	Q8SBF3	Shigella_phage	98.9	5.1e-149
WP_000933949.1|638560_638797_+	hypothetical protein	NA	A0A291AX25	Escherichia_phage	93.6	2.8e-36
WP_000061519.1|638793_639612_+	helix-turn-helix domain-containing protein	NA	A0A291AWW0	Escherichia_phage	99.6	4.7e-123
WP_015364395.1|639608_640103_+	PerC family transcriptional regulator	NA	A0A291AWV6	Escherichia_phage	98.8	3.3e-87
WP_000066917.1|640102_640756_+	phage N-6-adenine-methyltransferase	NA	A5LH72	Enterobacteria_phage	99.5	1.9e-127
WP_000210187.1|640752_641079_+	LexA family transcriptional regulator	NA	A5LH73	Enterobacteria_phage	100.0	1.6e-53
WP_000767105.1|641075_641465_+	RusA family crossover junction endodeoxyribonuclease	NA	A5LH74	Enterobacteria_phage	99.2	2.1e-68
WP_015364396.1|641484_642294_+	KilA-N domain-containing protein	NA	Q8SBE6	Shigella_phage	99.6	2.3e-154
WP_001439745.1|642301_643291_+	DUF968 domain-containing protein	NA	A0A291AWV9	Escherichia_phage	99.4	9.5e-195
WP_001569329.1|643304_644057_+	antitermination protein	NA	Q8SBE4	Shigella_phage	99.6	1.1e-137
WP_001569330.1|644207_644465_+	hypothetical protein	NA	A0A1C9IHX4	Salmonella_phage	95.3	5.6e-38
WP_001283169.1|644544_644931_+|holin	phage holin family protein	holin	A0A192Y8P2	Salmonella_phage	100.0	7.0e-61
WP_000422366.1|644917_645199_+|holin	phage holin family protein	holin	K7PKN9	Enterobacterial_phage	45.2	9.7e-20
WP_001075795.1|645198_645813_+	glycoside hydrolase family 19 protein	NA	A0A192Y6G4	Salmonella_phage	98.0	8.2e-112
WP_000858463.1|645809_646271_+|lysis	lysis protein	lysis	K7P6Y5	Enterobacteria_phage	88.9	3.2e-68
WP_000877024.1|646473_647004_+	KilA-N domain-containing protein	NA	B8K1H1	Salmonella_phage	95.5	3.4e-90
WP_001135096.1|647319_647670_+	HNH endonuclease	NA	M1FQV2	Enterobacteria_phage	95.7	4.0e-63
WP_000929174.1|647795_648281_+|terminase	phage terminase small subunit P27 family	terminase	Q8SBI1	Shigella_phage	99.4	2.1e-86
WP_122792789.1|648531_650028_+|terminase	terminase large subunit	terminase	U5P0Q5	Shigella_phage	99.0	1.1e-290
WP_015364398.1|650024_650186_+	hypothetical protein	NA	NA	NA	NA	NA
WP_015364399.1|650175_651402_+|portal	phage portal protein	portal	Q8SBI0	Shigella_phage	99.3	4.9e-241
WP_000999805.1|651394_651997_+|head,protease	HK97 family phage prohead protease	head,protease	Q8SBH9	Shigella_phage	100.0	6.8e-111
WP_015364400.1|652007_653237_+|capsid	phage major capsid protein	capsid	Q8SBH8	Shigella_phage	99.0	1.9e-224
WP_000924829.1|653315_653639_+|head,tail	phage gp6-like head-tail connector protein	head,tail	Q8SBH7	Shigella_phage	99.1	1.7e-52
WP_000702394.1|653635_654046_+|head	phage head closure protein	head	M1FJ87	Enterobacteria_phage	94.9	8.0e-71
WP_000224835.1|654020_654527_+	hypothetical protein	NA	M1FPE2	Enterobacteria_phage	92.9	1.3e-83
WP_015364401.1|654523_655084_+	hypothetical protein	NA	M1FQV7	Enterobacteria_phage	98.9	6.8e-105
WP_000497751.1|655092_655263_+	DUF2635 domain-containing protein	NA	Q8SBH3	Shigella_phage	100.0	9.3e-26
WP_015364402.1|655246_656743_+|tail	phage tail sheath subtilisin-like domain-containing protein	tail	S5FKL0	Shigella_phage	99.0	2.0e-276
WP_000090995.1|656742_657099_+|tail	phage tail tube protein	tail	U5P076	Shigella_phage	98.3	5.9e-62
WP_000661054.1|657098_657368_+|tail	phage tail assembly protein	tail	M1FPE4	Enterobacteria_phage	100.0	3.5e-43
WP_000807177.1|657509_659345_+|tail	phage tail tape measure protein	tail	S5FM63	Shigella_phage	99.2	1.7e-306
658393:658408	attR	TTGGTGATGATGCCGA	NA	NA	NA	NA
WP_001368756.1|659405_660734_+	DNA circularization N-terminal domain-containing protein	NA	Q8SBG8	Shigella_phage	98.9	1.9e-246
WP_000999510.1|660730_661810_+|plate	baseplate protein	plate	U5P0H6	Shigella_phage	100.0	5.3e-207
WP_015364403.1|661809_662358_+|plate	phage baseplate assembly protein	plate	Q8SBG6	Shigella_phage	98.9	5.6e-96
WP_000424732.1|662357_662783_+	phage GP46 family protein	NA	U5P0R9	Shigella_phage	100.0	2.3e-81
WP_015364404.1|662769_663828_+|plate	baseplate J/gp47 family protein	plate	M1FQW3	Enterobacteria_phage	98.9	5.6e-201
WP_000383559.1|663818_664403_+	YmfQ family protein	NA	O22003	Shigella_phage	99.5	2.4e-113
WP_015364405.1|664406_665057_+	hypothetical protein	NA	M1FN94	Enterobacteria_phage	65.1	7.9e-65
WP_000376436.1|665060_665480_+|tail	tail assembly chaperone	tail	A0A0F7LDZ0	Escherichia_phage	55.8	1.7e-36
WP_015364406.1|665451_666045_-|tail	tail assembly chaperone	tail	Q9MCR5	Enterobacteria_phage	65.5	4.9e-61
WP_015364407.1|666044_666539_-|tail	tail fiber protein	tail	K7PH60	Enterobacterial_phage	92.8	1.5e-79
WP_088895425.1|666568_667797_-|transposase	IS3-like element IS2 family transposase	transposase	Q9ZXG3	Shigella_phage	99.3	1.3e-177
WP_001766808.1|668474_669479_-|protease	Clp protease	protease	NA	NA	NA	NA
WP_001217553.1|669787_670036_-	DinI-like family protein	NA	K7PLW4	Enterobacteria_phage	100.0	1.8e-38
WP_000202566.1|670255_671842_+	peptide chain release factor 3	NA	D0R0F5	Streptococcus_phage	24.9	5.3e-30
WP_001295748.1|672234_672840_+	molecular chaperone OsmY	NA	NA	NA	NA	NA
WP_000490275.1|672966_673128_+	DUF1328 domain-containing protein	NA	A0A0N7CBR2	Salmonella_phage	64.2	1.8e-10
WP_001299799.1|673249_674323_+	patatin family protein	NA	NA	NA	NA	NA
WP_000563058.1|674319_675102_+	metal-dependent hydrolase	NA	NA	NA	NA	NA
WP_001088379.1|675416_676280_-	YjjW family glycine radical enzyme activase	NA	NA	NA	NA	NA
WP_001143244.1|676251_677802_-	YjjI family glycine radical enzyme	NA	NA	NA	NA	NA
WP_001295412.1|678059_678839_+	deoxyribose-phosphate aldolase	NA	NA	NA	NA	NA
WP_000816471.1|680339_681563_+	phosphopentomutase	NA	NA	NA	NA	NA
WP_000224877.1|681642_682362_+	purine-nucleoside phosphorylase	NA	NA	NA	NA	NA
WP_000566153.1|682636_682786_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000105889.1|682817_683834_-	lipoate--protein ligase LplA	NA	NA	NA	NA	NA
WP_000124615.1|683861_684506_-	YtjB family periplasmic protein	NA	NA	NA	NA	NA
WP_001132956.1|684611_685580_+	phosphoserine phosphatase	NA	NA	NA	NA	NA
WP_001029698.1|685628_687011_+	DNA repair protein RadA	NA	NA	NA	NA	NA
WP_000093810.1|687031_688264_+	multifunctional transcriptional regulator/nicotinamide-nucleotide adenylyltransferase/ribosylnicotinamide kinase NadR	NA	A0A0C5K935	Enterococcus_phage	42.6	1.6e-82
WP_000046749.1|688570_690238_-	energy-dependent translational throttle protein EttA	NA	A0A1V0SKJ1	Klosneuvirus	26.4	3.7e-42
WP_000409451.1|690448_692386_+	murein transglycosylase	NA	A0A1P8CWQ1	Bacillus_phage	34.8	4.0e-11
WP_000068679.1|692475_692802_+	trp operon repressor	NA	NA	NA	NA	NA
WP_001346116.1|692844_693357_-	inosine/xanthosine triphosphatase	NA	NA	NA	NA	NA
WP_000942344.1|693408_694056_+	2,3-diphosphoglycerate-dependent phosphoglycerate mutase GpmB	NA	NA	NA	NA	NA
WP_000371666.1|694052_694922_-	MDR efflux pump AcrAB transcriptional activator RobA	NA	NA	NA	NA	NA
WP_000875487.1|695132_695606_+	protein CreA	NA	NA	NA	NA	NA
WP_001188666.1|695618_696308_+	two-component system response regulator CreB	NA	W8CYM9	Bacillus_phage	35.3	2.0e-29
WP_015364410.1|696307_697732_+	two-component system sensor histidine kinase CreC	NA	Q8QKV7	Ectocarpus_siliculosus_virus	20.4	1.6e-09
WP_000920307.1|697789_699142_+	cell envelope integrity protein CreD	NA	NA	NA	NA	NA
WP_001194358.1|699200_699917_-	two-component system response regulator ArcA	NA	NA	NA	NA	NA
WP_001303782.1|700012_700153_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001223186.1|700552_701239_+|tRNA	tRNA/rRNA methyltransferase	tRNA	NA	NA	NA	NA
>prophage 3
NC_020163	Escherichia coli APEC O78, complete sequence	4798435	953490	1046092	4798435	holin,integrase,plate,protease,tail,terminase,transposase,portal,head,capsid	Shigella_phage(51.67%)	101	967145:967203	1009356:1009414
WP_000006256.1|953490_953988_+|transposase	REP-associated tyrosine transposase RayT	transposase	NA	NA	NA	NA
WP_015364413.1|954305_956045_-	flagellar biosynthesis protein FlhA	NA	NA	NA	NA	NA
WP_000207589.1|955989_956775_+	putative lateral flagellar export/assembly protein LafU	NA	NA	NA	NA	NA
WP_001226155.1|956845_957901_+	DNA polymerase IV	NA	NA	NA	NA	NA
WP_001059874.1|957897_958350_+	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_001295204.1|959082_959223_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001293003.1|959279_960737_-	cytosol nonspecific dipeptidase	NA	NA	NA	NA	NA
WP_001291992.1|960997_961456_+	xanthine phosphoribosyltransferase	NA	NA	NA	NA	NA
WP_000189539.1|961547_962792_+	esterase FrsA	NA	NA	NA	NA	NA
WP_000749881.1|963288_964344_-	phosphoporin PhoE	NA	Q1MVN1	Enterobacteria_phage	60.9	7.7e-118
WP_001285288.1|964631_965735_+	glutamate 5-kinase	NA	A0A1X9I5D0	Streptococcus_phage	40.4	1.1e-61
WP_000893260.1|965746_967000_+	glutamate-5-semialdehyde dehydrogenase	NA	A0A1X9I5D4	Streptococcus_phage	47.0	1.7e-95
967145:967203	attL	ATTCGTAATGCGAAGGTCGTAGGTTCGACTCCTATTATCGGCACCATTTAAATCAATAA	NA	NA	NA	NA
WP_000051887.1|967204_968368_-|integrase	site-specific integrase	integrase	U5P434	Shigella_phage	100.0	2.4e-229
WP_000206732.1|968594_968900_-	hypothetical protein	NA	U5P0J0	Shigella_phage	100.0	6.8e-51
WP_001242748.1|968899_969262_-	hypothetical protein	NA	U5P092	Shigella_phage	99.2	1.0e-66
WP_015364415.1|969252_969789_-	5'-deoxynucleotidase	NA	U5P0T3	Shigella_phage	99.4	1.6e-100
WP_000081308.1|969916_970741_-	DUF2303 family protein	NA	U5P439	Shigella_phage	99.6	5.0e-149
WP_000135682.1|970805_971168_-	hypothetical protein	NA	U5P4J6	Shigella_phage	100.0	3.3e-60
WP_000016389.1|971636_972071_+	hypothetical protein	NA	U5P096	Shigella_phage	100.0	8.4e-79
WP_000549623.1|972042_972249_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000450735.1|972496_973123_-	LexA family transcriptional regulator	NA	K7PM82	Enterobacteria_phage	48.8	5.5e-47
WP_000205494.1|973220_973421_+	cell division protein	NA	NA	NA	NA	NA
WP_001434539.1|973458_974010_+	hypothetical protein	NA	S5FXP0	Shigella_phage	98.9	7.6e-101
WP_001250269.1|974185_974365_+	DUF4222 domain-containing protein	NA	S5M7S5	Escherichia_phage	68.5	7.8e-15
WP_015364416.1|974354_975296_+	helix-turn-helix domain-containing protein	NA	U5P0A0	Shigella_phage	93.0	4.9e-140
WP_001619134.1|975292_975787_+	PerC family transcriptional regulator	NA	A0A291AWV6	Escherichia_phage	98.1	1.2e-86
WP_015364417.1|975786_976440_+	phage N-6-adenine-methyltransferase	NA	A5LH72	Enterobacteria_phage	99.1	5.6e-127
WP_000210164.1|976436_976763_+	LexA family transcriptional regulator	NA	A0A0N7KZF7	Stx2-converting_phage	100.0	9.2e-54
WP_000767113.1|976759_977149_+	RusA family crossover junction endodeoxyribonuclease	NA	A0A0P0ZD39	Stx2-converting_phage	100.0	7.1e-69
WP_001061445.1|977168_977978_+	KilA-N domain-containing protein	NA	A0A291AWU7	Escherichia_phage	99.6	4.0e-151
WP_024179287.1|977985_978975_+	DUF968 domain-containing protein	NA	S5FV02	Shigella_phage	99.1	1.6e-194
WP_089614357.1|978989_979358_+	antitermination protein Q	NA	A5LH77	Enterobacteria_phage	88.3	3.2e-55
WP_001208502.1|979393_979843_-	hypothetical protein	NA	A5LH78	Enterobacteria_phage	43.8	8.0e-24
WP_001446998.1|979864_980806_-	hypothetical protein	NA	A5LH79	Enterobacteria_phage	44.2	5.0e-68
WP_000917724.1|981073_981277_+	hypothetical protein	NA	A0A291AWX6	Escherichia_phage	100.0	6.1e-32
WP_001583196.1|981427_982480_+	site-specific DNA-methyltransferase	NA	A5LH81	Enterobacteria_phage	98.9	4.4e-206
WP_001120490.1|982556_982883_+|holin	phage holin, lambda family	holin	U5P0K7	Shigella_phage	98.1	2.6e-56
WP_001524097.1|982886_983363_+	glycoside hydrolase family protein	NA	S5FV07	Shigella_phage	96.2	1.2e-86
WP_024179288.1|983346_983727_+	DUF2570 domain-containing protein	NA	U5P0U9	Shigella_phage	88.8	7.7e-52
WP_024179289.1|983990_984173_-	DUF2158 domain-containing protein	NA	NA	NA	NA	NA
WP_015364421.1|984452_984803_+	HNH endonuclease	NA	M1FQV2	Enterobacteria_phage	96.6	2.3e-63
WP_000929182.1|984928_985423_+|terminase	phage terminase small subunit P27 family	terminase	A0A1B3B2F4	Salmonella_phage	98.8	5.6e-87
WP_123008656.1|985656_987153_+|terminase	terminase large subunit	terminase	A0A1C9IIA1	Salmonella_phage	100.0	2.0e-300
WP_000605606.1|987164_987347_+	hypothetical protein	NA	S5FXQ9	Shigella_phage	100.0	1.7e-25
WP_000466255.1|987346_988588_+|portal	phage portal protein	portal	U5P411	Shigella_phage	99.8	2.0e-242
WP_001193633.1|988565_989216_+|head,protease	HK97 family phage prohead protease	head,protease	U5P4H2	Shigella_phage	99.5	7.3e-119
WP_001676465.1|989230_990436_+|capsid	phage major capsid protein	capsid	U5P0G9	Shigella_phage	98.8	1.0e-222
WP_000601360.1|990485_990686_+	hypothetical protein	NA	S5FNU1	Shigella_phage	97.0	3.8e-26
WP_001676466.1|990688_991012_+|head,tail	phage gp6-like head-tail connector protein	head,tail	U5P072	Shigella_phage	98.1	5.7e-56
WP_001676467.1|991008_991419_+|head	phage head closure protein	head	M1FJ87	Enterobacteria_phage	94.1	6.7e-70
WP_015364423.1|991393_991900_+	hypothetical protein	NA	M1FPE2	Enterobacteria_phage	94.0	1.2e-84
WP_000779297.1|991896_992457_+	hypothetical protein	NA	Q8SBH4	Shigella_phage	97.8	4.4e-104
WP_000497751.1|992465_992636_+	DUF2635 domain-containing protein	NA	Q8SBH3	Shigella_phage	100.0	9.3e-26
WP_015364424.1|992619_994116_+|tail	phage tail sheath subtilisin-like domain-containing protein	tail	S5FKL0	Shigella_phage	99.0	1.5e-276
WP_001526906.1|994115_994472_+|tail	phage tail tube protein	tail	U5P076	Shigella_phage	99.2	9.0e-63
WP_000661047.1|994471_994741_+|tail	phage tail assembly protein	tail	S5FNR3	Shigella_phage	100.0	3.5e-43
WP_000807193.1|994882_996718_+|tail	phage tail tape measure protein	tail	S5FM63	Shigella_phage	99.0	1.4e-305
WP_015364425.1|996778_998107_+	DNA circularization N-terminal domain-containing protein	NA	Q8SBG8	Shigella_phage	98.4	2.7e-245
WP_000999527.1|998103_999183_+|plate	baseplate protein	plate	U5P0H6	Shigella_phage	99.7	6.9e-207
WP_000643710.1|999182_999731_+|plate	phage baseplate assembly protein	plate	U5P081	Shigella_phage	96.7	1.1e-94
WP_000424727.1|999730_1000156_+	phage GP46 family protein	NA	U5P0R9	Shigella_phage	98.6	4.4e-80
WP_000785308.1|1000142_1001201_+|plate	baseplate J/gp47 family protein	plate	U5P424	Shigella_phage	98.9	1.6e-200
WP_000383554.1|1001191_1001776_+	YmfQ family protein	NA	O22003	Shigella_phage	99.0	1.6e-112
WP_015364427.1|1001779_1002541_+|tail	tail fiber protein	tail	Q9MCR6	Enterobacteria_phage	66.9	6.9e-52
WP_024179290.1|1002540_1003143_+|tail	tail fiber assembly protein	tail	Q9MCR5	Enterobacteria_phage	92.3	1.2e-96
WP_015364429.1|1003706_1004216_-|tail	tail fiber protein	tail	Q9MCR6	Enterobacteria_phage	66.9	6.0e-52
WP_015364430.1|1004245_1004800_+	site-specific DNA recombinase	NA	A0A0F7LA37	Escherichia_phage	86.7	1.8e-86
WP_015364431.1|1005142_1005640_-	hypothetical protein	NA	NA	NA	NA	NA
WP_015364432.1|1006028_1006133_+	hypothetical protein	NA	NA	NA	NA	NA
WP_015364433.1|1006239_1008993_-	hypothetical protein	NA	A0A1B1IUG5	uncultured_Mediterranean_phage	26.0	9.6e-27
WP_001111345.1|1009527_1009938_-	hypothetical protein	NA	NA	NA	NA	NA
1009356:1009414	attR	ATTCGTAATGCGAAGGTCGTAGGTTCGACTCCTATTATCGGCACCATTTAAATCAATAA	NA	NA	NA	NA
WP_000121355.1|1009916_1010873_-	molybdenum cofactor insertion chaperone PaoD	NA	NA	NA	NA	NA
WP_000667031.1|1010882_1013081_-	aldehyde oxidoreductase molybdenum-binding subunit PaoC	NA	A0A0P0I429	Acinetobacter_phage	25.8	1.1e-38
WP_000643336.1|1013077_1014034_-	aldehyde oxidoreductase FAD-binding subunit PaoB	NA	NA	NA	NA	NA
WP_000070694.1|1014030_1014720_-	aldehyde dehydrogenase iron-sulfur subunit	NA	NA	NA	NA	NA
WP_001019920.1|1015137_1015752_+	YagU family protein	NA	NA	NA	NA	NA
WP_001303809.1|1015999_1016329_-	YkgJ family cysteine cluster protein	NA	NA	NA	NA	NA
WP_001305432.1|1016641_1017352_-	fimbrial chaperone EcpE	NA	NA	NA	NA	NA
WP_001323478.1|1017320_1018964_-	fimbrial adhesin EcpD	NA	NA	NA	NA	NA
WP_001131091.1|1018953_1021479_-	fimbrial usher EcpC	NA	NA	NA	NA	NA
WP_000716398.1|1021490_1022159_-	fimbrial chaperone EcpB	NA	NA	NA	NA	NA
WP_000730974.1|1022216_1022804_-	common pilus major fimbrillin subunit EcpA	NA	NA	NA	NA	NA
WP_024179291.1|1022878_1023421_-	ECP biosynthesis operon DNA-binding transcriptional regulator EcpR	NA	NA	NA	NA	NA
WP_001147279.1|1024243_1024471_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000866436.1|1024505_1024646_-	50S ribosomal protein L36	NA	NA	NA	NA	NA
WP_000803998.1|1024645_1024909_-	type B 50S ribosomal protein L31	NA	NA	NA	NA	NA
WP_000662258.1|1025272_1025374_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000020228.1|1026488_1030739_+	intimin-like adhesin FdeC	NA	NA	NA	NA	NA
WP_000621009.1|1030878_1031730_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_001306921.1|1032320_1032914_-	reactive chlorine species resistance protein RclC	NA	NA	NA	NA	NA
WP_000474091.1|1032925_1033162_-	DUF1471 domain-containing protein	NA	NA	NA	NA	NA
WP_001046317.1|1033270_1034596_-	pyridine nucleotide-disulfide oxidoreductase	NA	A0A2K5B2C5	Erysipelothrix_phage	47.6	2.5e-113
WP_000339586.1|1034821_1035676_+	DNA-binding transcriptional regulator RclR	NA	NA	NA	NA	NA
WP_001102099.1|1036203_1036923_+	(Fe-S)-binding protein	NA	NA	NA	NA	NA
WP_000023927.1|1036933_1038361_+	iron-sulfur cluster-binding protein	NA	NA	NA	NA	NA
WP_001323770.1|1038353_1039049_+	lactate utilization protein C	NA	NA	NA	NA	NA
WP_001209100.1|1039291_1039960_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001159094.1|1040172_1041843_-|holin	choline dehydrogenase	holin	A0A1V0S9M4	Catovirus	31.2	4.7e-61
WP_015364434.1|1041856_1043329_-	betaine-aldehyde dehydrogenase	NA	NA	NA	NA	NA
WP_001299022.1|1043342_1043930_-	transcriptional regulator BetI	NA	NA	NA	NA	NA
WP_000131044.1|1044058_1046092_+|holin	choline BCCT transporter BetT	holin	A0A2I7QNT1	Vibrio_phage	27.4	3.4e-21
>prophage 4
NC_020163	Escherichia coli APEC O78, complete sequence	4798435	1259510	1305817	4798435	holin,integrase,lysis,protease,tail,tRNA,transposase	Enterobacteria_phage(41.38%)	45	1269661:1269707	1297291:1297337
WP_000912345.1|1259510_1260896_+|tRNA	cysteine--tRNA ligase	tRNA	M1PG92	Moumouvirus	34.8	3.9e-45
WP_001143558.1|1260931_1261453_-	metal-dependent hydrolase	NA	NA	NA	NA	NA
WP_000190288.1|1261560_1261773_-	ribosome-associated protein YbcJ	NA	NA	NA	NA	NA
WP_000729160.1|1261774_1262641_-	bifunctional methylenetetrahydrofolate dehydrogenase/methenyltetrahydrofolate cyclohydrolase FolD	NA	A0A249XZQ2	Enterococcus_phage	37.5	1.7e-30
WP_000776555.1|1263111_1263654_+	type 1 fimbrial protein subunit FimA	NA	NA	NA	NA	NA
WP_000988366.1|1263873_1264566_+	type 1 fimbria chaperone FimC	NA	NA	NA	NA	NA
WP_000691050.1|1267217_1268225_+	type 1 fimbrin D-mannose specific adhesin FimH	NA	NA	NA	NA	NA
WP_001323731.1|1268235_1268751_+	fimbria assembly protein	NA	NA	NA	NA	NA
WP_000805432.1|1268753_1269386_-	fimbria biosynthesis transcriptional regulator FimZ	NA	NA	NA	NA	NA
1269661:1269707	attL	CTTCTAAGTCGTGGGCCGCAGGTTCGAATCCTGCAGGGCGCGCCATT	NA	NA	NA	NA
WP_001298992.1|1269720_1270884_-|integrase	site-specific integrase	integrase	A0A088CD23	Shigella_phage	86.6	3.0e-200
WP_015364439.1|1271110_1271416_-	hypothetical protein	NA	U5P0J0	Shigella_phage	99.0	2.0e-50
WP_001242748.1|1271415_1271778_-	hypothetical protein	NA	U5P092	Shigella_phage	99.2	1.0e-66
WP_000008200.1|1271768_1272305_-	5'-deoxynucleotidase	NA	U5P0T3	Shigella_phage	100.0	4.3e-101
WP_000081308.1|1272432_1273257_-	DUF2303 family protein	NA	U5P439	Shigella_phage	99.6	5.0e-149
WP_000135682.1|1273321_1273684_-	hypothetical protein	NA	U5P4J6	Shigella_phage	100.0	3.3e-60
WP_000453587.1|1273781_1274327_-	DNA-packaging protein	NA	A0A0K2FIG2	Enterobacteria_phage	98.9	1.4e-94
WP_000881608.1|1274891_1275074_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000830178.1|1275280_1275607_-	TonB family protein	NA	H6WZK5	Escherichia_phage	72.2	3.7e-39
WP_000738425.1|1276087_1276381_+	increased serum survival lipoprotein Iss	NA	C6ZCX3	Enterobacteria_phage	91.8	1.6e-44
WP_001228695.1|1276471_1276654_-|lysis	prophage lysis lipoprotein RzoD	lysis	K7PHU6	Enterobacteria_phage	98.3	2.9e-17
WP_000992107.1|1276870_1277404_-	lysozyme	NA	K7PLY1	Enterobacteria_phage	95.5	1.1e-99
WP_000370549.1|1277509_1277782_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000250557.1|1277747_1278092_-	YdfR family protein	NA	K7PGU6	Enterobacteria_phage	90.5	3.5e-35
WP_000284486.1|1278096_1278312_-|holin	class II holin family protein	holin	M1FN85	Enterobacteria_phage	95.8	1.0e-32
WP_077249175.1|1279405_1280470_-	site-specific DNA-methyltransferase	NA	A5LH81	Enterobacteria_phage	98.0	1.0e-202
WP_000917724.1|1280616_1280820_-	hypothetical protein	NA	A0A291AWX6	Escherichia_phage	100.0	6.1e-32
WP_000357056.1|1281139_1282159_+	hypothetical protein	NA	A0A0R6PIZ6	Moraxella_phage	32.5	2.4e-39
WP_080086273.1|1282173_1282554_-	antitermination protein Q	NA	A5LH77	Enterobacteria_phage	90.0	6.1e-57
WP_021530631.1|1282568_1283558_-	DUF968 domain-containing protein	NA	A0A291AWV9	Escherichia_phage	99.7	2.5e-195
WP_001061397.1|1283565_1284363_-	KilA-N domain-containing protein	NA	A0A0P0ZCS0	Stx2-converting_phage	99.6	4.4e-150
WP_000767085.1|1284382_1284772_-	RusA family crossover junction endodeoxyribonuclease	NA	A0A0P0ZD39	Stx2-converting_phage	98.4	2.5e-66
WP_000210190.1|1284768_1285095_-	LexA repressor	NA	A5LH73	Enterobacteria_phage	99.1	1.0e-52
WP_000066917.1|1285091_1285745_-	phage N-6-adenine-methyltransferase	NA	A5LH72	Enterobacteria_phage	99.5	1.9e-127
WP_001300314.1|1285744_1286239_-	PerC family transcriptional regulator	NA	A0A0P0ZCF0	Stx2-converting_phage	98.1	3.6e-86
WP_015364442.1|1287409_1291012_+|tail	prophage tail fiber N-terminal domain-containing protein	tail	K7PGT9	Enterobacteria_phage	98.9	0.0e+00
WP_000086522.1|1291283_1291874_-	recombinase family protein	NA	A0A0A7NPV4	Enterobacteria_phage	39.3	1.5e-25
WP_000836769.1|1292248_1292482_-	cold shock protein YdfK	NA	A0A192Y6D5	Salmonella_phage	88.3	6.4e-33
WP_001372053.1|1292550_1292664_-	hypothetical protein	NA	A0A1C9IHU6	Salmonella_phage	77.8	1.4e-06
WP_000239874.1|1293029_1293698_-	class I SAM-dependent methyltransferase	NA	NA	NA	NA	NA
WP_001226375.1|1294243_1295728_-	alpha/beta hydrolase	NA	NA	NA	NA	NA
WP_001201825.1|1295914_1296868_-|protease	omptin family outer membrane protease OmpT	protease	NA	NA	NA	NA
WP_001177453.1|1297380_1298142_-	DNA-binding transcriptional regulator EnvY	NA	NA	NA	NA	NA
1297291:1297337	attR	CTTCTAAGTCGTGGGCCGCAGGTTCGAATCCTGCAGGGCGCGCCATT	NA	NA	NA	NA
WP_001224569.1|1298324_1299215_-	DUF4434 family protein	NA	NA	NA	NA	NA
WP_000383951.1|1302174_1304412_-	phage adsorption protein NrfB	NA	NA	NA	NA	NA
WP_000420922.1|1304680_1305817_-|transposase	ISAs1 family transposase	transposase	NA	NA	NA	NA
>prophage 5
NC_020163	Escherichia coli APEC O78, complete sequence	4798435	1525399	1542390	4798435	integrase,lysis,protease,terminase,transposase	Enterobacteria_phage(59.26%)	27	1516900:1516914	1555466:1555480
1516900:1516914	attL	CTGGAAGATGGCCTG	NA	NA	NA	NA
WP_000533642.1|1525399_1526470_-|integrase	tyrosine-type recombinase/integrase	integrase	Q9MCR4	Enterobacteria_phage	100.0	5.1e-202
WP_001303849.1|1526447_1526666_-	excisionase	NA	Q77WA4	Escherichia_phage	100.0	3.7e-35
WP_000545745.1|1526705_1526873_-	hypothetical protein	NA	A5VWB7	Enterobacteria_phage	98.2	2.9e-27
WP_088895425.1|1527145_1528373_+|transposase	IS3-like element IS2 family transposase	transposase	Q9ZXG3	Shigella_phage	99.3	1.3e-177
WP_000208005.1|1528693_1529491_-	DUF550 domain-containing protein	NA	A0A075B8H2	Enterobacteria_phage	41.1	5.7e-49
WP_000582229.1|1529501_1530257_-	hypothetical protein	NA	A0A1R3Y5Q7	Salmonella_virus	92.4	5.5e-142
WP_001289862.1|1530258_1530666_-	ead/Ea22-like family protein	NA	A0A125RPT9	Escherichia_phage	97.0	3.1e-67
WP_000763386.1|1530662_1530884_-	TraR/DksA family transcriptional regulator	NA	A0A1I9LJM6	Stx_converting_phage	98.6	6.4e-35
WP_000188870.1|1530982_1531198_-	hypothetical protein	NA	A0A1I9LJM7	Stx_converting_phage	100.0	1.0e-32
WP_000548531.1|1531274_1531466_-	DUF1382 family protein	NA	A0A0P0ZC67	Stx2-converting_phage	100.0	7.3e-27
WP_072216179.1|1531438_1531624_-	DUF1317 domain-containing protein	NA	A0A0N7CHV0	Escherichia_phage	95.1	1.6e-26
WP_000186798.1|1531620_1532301_-	YqaJ viral recombinase family protein	NA	B6DZ61	Enterobacteria_phage	98.2	1.3e-131
WP_000372938.1|1532490_1532643_-	host cell division inhibitory peptide Kil	NA	A0A0P0ZC96	Stx2-converting_phage	98.0	2.4e-20
WP_001198861.1|1532611_1532776_-|protease	protease FtsH-inhibitory lysogeny factor CIII	protease	Q776Q5	Enterobacteria_phage	100.0	1.1e-26
WP_000065371.1|1532848_1533217_-	DUF2528 family protein	NA	M1FPD2	Enterobacteria_phage	99.2	4.5e-65
WP_000213968.1|1533399_1533600_-	antirestriction Ral family protein	NA	A0A0K2FJE6	Enterobacteria_phage	98.5	2.4e-33
WP_000737263.1|1534115_1535198_-	porin OmpD	NA	Q1MVN1	Enterobacteria_phage	78.7	4.4e-161
WP_000839596.1|1535787_1536003_+|lysis	phage lysis protein EssD	lysis	A5LH82	Enterobacteria_phage	100.0	9.0e-34
WP_001135294.1|1536002_1536500_+	lysozyme RrrD	NA	M1FJA0	Enterobacteria_phage	97.6	1.9e-90
WP_012738274.1|1536716_1536899_+|lysis	prophage lysis lipoprotein RzoD	lysis	K7PHU6	Enterobacteria_phage	100.0	1.7e-17
WP_000738492.1|1536989_1537283_-	serum resistance lipoprotein Bor	NA	K7PL54	Enterobacteria_phage	100.0	4.0e-48
WP_001403557.1|1537573_1537984_-	DUF1398 domain-containing protein	NA	C6ZCX4	Enterobacteria_phage	99.3	9.4e-72
WP_001031427.1|1538269_1538476_+	hypothetical protein	NA	A0A0K2FJ18	Enterobacteria_phage	100.0	5.8e-30
WP_001421937.1|1538640_1538835_-	YlcI/YnfO family protein	NA	A0A0K2FIR8	Escherichia_phage	100.0	8.7e-28
WP_000453576.1|1539223_1539769_+	DNA-packaging protein	NA	A0A0K2FIG2	Enterobacteria_phage	99.4	4.7e-95
WP_001700483.1|1539743_1540847_+|terminase	phage terminase large subunit family protein	terminase	A0A0K2FJ14	Enterobacteria_phage	99.1	7.8e-214
WP_001230359.1|1541790_1542390_+	Ail/Lom family outer membrane beta-barrel protein	NA	A0A0P0ZCF6	Stx2-converting_phage	98.5	2.6e-110
1555466:1555480	attR	CTGGAAGATGGCCTG	NA	NA	NA	NA
>prophage 6
NC_020163	Escherichia coli APEC O78, complete sequence	4798435	1629922	1638504	4798435	integrase	Salmonella_phage(84.62%)	14	1624942:1624954	1631798:1631810
1624942:1624954	attL	TGGGAATGAGTCA	NA	NA	NA	NA
WP_000290933.1|1629922_1630975_-|integrase	tyrosine-type recombinase/integrase	integrase	A0A218M4I3	Erwinia_phage	57.3	3.6e-107
WP_001321204.1|1631161_1631353_-	hypothetical protein	NA	A0A0R6PIH8	Moraxella_phage	68.2	4.0e-09
WP_001047324.1|1631368_1631938_-	phage repressor protein CI	NA	A0A1S6KZZ7	Salmonella_phage	42.9	4.2e-38
1631798:1631810	attR	TGGGAATGAGTCA	NA	NA	NA	NA
WP_001247707.1|1632063_1632285_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000460893.1|1632317_1632827_+	phage regulatory CII family protein	NA	E5G6L3	Salmonella_phage	98.8	5.8e-87
WP_000956182.1|1632834_1633035_+	DUF2724 domain-containing protein	NA	E5G6L4	Salmonella_phage	98.5	7.1e-33
WP_000963472.1|1632998_1633340_+	DUF5347 domain-containing protein	NA	E5G6L5	Salmonella_phage	98.2	1.3e-55
WP_001244230.1|1633407_1633641_+	DUF2732 family protein	NA	E5G6L6	Salmonella_phage	97.4	1.1e-32
WP_000752619.1|1633640_1633868_+	TraR/DksA family transcriptional regulator	NA	E5G6L7	Salmonella_phage	98.7	3.5e-36
WP_000104150.1|1633864_1634719_+	DNA adenine methylase	NA	E5G6L8	Salmonella_phage	90.5	7.5e-148
WP_001420002.1|1634724_1635546_+	hypothetical protein	NA	A0A0M4RCP6	Salmonella_phage	75.7	1.1e-122
WP_001109970.1|1635545_1637918_+	replication endonuclease	NA	E5G6L9	Salmonella_phage	97.2	0.0e+00
WP_001154433.1|1638071_1638260_+	hypothetical protein	NA	E5G6M0	Salmonella_phage	100.0	1.4e-27
WP_001217579.1|1638270_1638504_+	DinI family protein	NA	E5G6M1	Salmonella_phage	98.7	1.0e-35
>prophage 7
NC_020163	Escherichia coli APEC O78, complete sequence	4798435	1678079	1776050	4798435	integrase,plate,lysis,protease,tail,tRNA,terminase,portal,capsid	Escherichia_phage(29.63%)	90	1697950:1697967	1723235:1723252
WP_000520781.1|1678079_1678400_+|protease	ATP-dependent Clp protease adapter ClpS	protease	A0A1B1IT64	uncultured_Mediterranean_phage	44.4	1.6e-13
WP_000934041.1|1678430_1680707_+|protease	ATP-dependent Clp protease ATP-binding subunit ClpA	protease	A0A223W0B1	Agrobacterium_phage	42.5	1.9e-166
WP_001040187.1|1681391_1681610_-	translation initiation factor IF-1	NA	NA	NA	NA	NA
WP_001241678.1|1681894_1682599_-|tRNA	leucyl/phenylalanyl-tRNA--protein transferase	tRNA	NA	NA	NA	NA
WP_001202188.1|1682640_1684362_-	cysteine/glutathione ABC transporter ATP-binding protein/permease CydC	NA	W8CYL7	Bacillus_phage	25.2	1.9e-20
WP_001043619.1|1684362_1686129_-	cysteine/glutathione ABC transporter permease/ATP-binding protein CydD	NA	W8CYL7	Bacillus_phage	24.3	5.4e-23
WP_000537418.1|1686251_1687217_-	thioredoxin-disulfide reductase	NA	A0A2I2L5E1	Orpheovirus	44.6	8.5e-63
WP_000228473.1|1687760_1688255_+	leucine-responsive transcriptional regulator Lrp	NA	NA	NA	NA	NA
WP_000077063.1|1688389_1692496_+	DNA translocase FtsK	NA	A0A218M9A2	Mycobacterium_phage	48.7	1.2e-86
WP_001295343.1|1692650_1693262_+	outer membrane lipoprotein chaperone LolA	NA	NA	NA	NA	NA
WP_000067755.1|1693272_1694616_+	replication-associated recombination protein RarA	NA	G3MBE0	Bacillus_virus	40.8	2.1e-80
WP_000886683.1|1694706_1695999_+|tRNA	serine--tRNA ligase	tRNA	A0A1B1IVT2	uncultured_Mediterranean_phage	48.2	1.5e-94
WP_000850315.1|1696237_1698682_+	dimethylsulfoxide reductase subunit A	NA	A0A077SK27	Escherichia_phage	49.9	3.9e-221
1697950:1697967	attL	CGAACTGGCAAAACGTCT	NA	NA	NA	NA
WP_000213098.1|1698692_1699310_+	dimethylsulfoxide reductase subunit B	NA	A0A077SL61	Escherichia_phage	60.6	5.0e-77
WP_000534637.1|1699311_1700175_+	dimethyl sulfoxide reductase anchor subunit DmsC	NA	NA	NA	NA	NA
WP_000165880.1|1700210_1700837_-	hydrolase	NA	NA	NA	NA	NA
WP_000109295.1|1701150_1702299_+	MFS transporter	NA	NA	NA	NA	NA
WP_000918536.1|1702508_1703939_+	amino acid permease	NA	NA	NA	NA	NA
WP_001242675.1|1703939_1704848_-	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_001190363.1|1704947_1705538_+	NAD(P)H oxidoreductase	NA	NA	NA	NA	NA
WP_000067979.1|1705619_1706417_-	pyruvate formate lyase 1-activating protein	NA	A0A2P0VNQ0	Tetraselmis_virus	26.6	1.3e-21
WP_000023391.1|1706448_1707444_-|integrase	tyrosine-type recombinase/integrase	integrase	A0A0F7LBR0	Escherichia_phage	99.7	7.1e-190
WP_000072552.1|1707537_1707849_-	helix-turn-helix transcriptional regulator	NA	Q1JS25	Enterobacteria_phage	100.0	4.3e-53
WP_000022051.1|1707953_1708310_+	hypothetical protein	NA	A0A0F7LDH4	Escherichia_phage	100.0	1.1e-63
WP_001005162.1|1708320_1708491_+	hypothetical protein	NA	S4TNZ7	Salmonella_phage	100.0	6.1e-25
WP_000217684.1|1708487_1708988_+	hypothetical protein	NA	S4TTB7	Salmonella_phage	99.4	3.8e-91
WP_000557709.1|1709051_1709264_+	DUF2732 family protein	NA	S4TP68	Salmonella_phage	92.9	8.6e-29
WP_000185625.1|1709278_1709524_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000789843.1|1709520_1709811_+	DUF5405 family protein	NA	M1RZ07	Escherichia_phage	81.7	5.5e-34
WP_001113268.1|1709810_1710035_+	TraR/DksA family transcriptional regulator	NA	A0A0F7LDG9	Escherichia_phage	95.9	1.2e-33
WP_000027664.1|1710031_1710307_+	DUF5405 family protein	NA	U5N3W1	Enterobacteria_phage	100.0	3.8e-45
WP_000268596.1|1710296_1712582_+	replication endonuclease	NA	Q858T4	Yersinia_virus	97.4	0.0e+00
WP_015364456.1|1712581_1713034_+	DUF3850 domain-containing protein	NA	Q2P9X4	Enterobacteria_phage	96.0	7.9e-80
WP_000554772.1|1713033_1713240_+	hypothetical protein	NA	Q2P9X3	Enterobacteria_phage	95.5	5.3e-31
WP_000379684.1|1713463_1714195_+	hypothetical protein	NA	A0A218M4H5	Erwinia_phage	77.4	4.2e-107
WP_015364457.1|1714305_1715088_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000038155.1|1715436_1716471_-|portal	phage portal protein	portal	M1SV64	Escherichia_phage	99.4	5.5e-201
WP_000156843.1|1716470_1718243_-|terminase	terminase ATPase subunit family protein	terminase	A0A0F7LCM8	Escherichia_phage	99.3	0.0e+00
WP_001085970.1|1718416_1719271_+|capsid	GPO family capsid scaffolding protein	capsid	Q94MH0	Enterobacteria_phage	97.2	3.8e-131
WP_001248537.1|1719329_1720403_+|capsid	phage major capsid protein, P2 family	capsid	Q94MC7	Enterobacteria_phage	99.2	1.5e-201
WP_001700524.1|1720406_1721150_+|terminase	terminase endonuclease subunit	terminase	Q94MJ2	Enterobacteria_phage	97.6	1.4e-126
WP_000736564.1|1721745_1722171_+	hypothetical protein	NA	A0A0F7LDU9	Escherichia_phage	97.2	5.0e-60
WP_000040656.1|1722158_1722584_+|lysis	LysB family phage lysis regulatory protein	lysis	U5N3W5	Enterobacteria_phage	95.7	1.8e-65
WP_001300730.1|1722555_1722729_+	hypothetical protein	NA	Q7Y4E1	Escherichia_virus	94.7	5.2e-24
WP_000917152.1|1722691_1723159_+|tail	phage tail protein	tail	A0A0F7LA33	Escherichia_phage	99.4	2.3e-82
WP_001001798.1|1723151_1723604_+	phage virion morphogenesis protein	NA	A0A0F7LDR6	Escherichia_phage	98.7	5.3e-76
1723235:1723252	attR	CGAACTGGCAAAACGTCT	NA	NA	NA	NA
WP_000490545.1|1723675_1724461_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001093717.1|1724544_1725174_+|plate	phage baseplate assembly protein V	plate	U5N3F0	Enterobacteria_phage	95.1	3.5e-102
WP_001285325.1|1725920_1726451_+|tail	phage tail protein I	tail	U5N0U8	Enterobacteria_phage	100.0	2.3e-102
WP_000104680.1|1726461_1728708_+|tail	tail fiber protein	tail	U5N099	Enterobacteria_phage	57.0	7.3e-166
WP_001164157.1|1728711_1729239_+|tail	tail fiber assembly protein	tail	U5N0T1	Enterobacteria_phage	94.3	2.2e-89
WP_000002748.1|1729462_1729741_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001406733.1|1729793_1729973_-	DUF3606 domain-containing protein	NA	NA	NA	NA	NA
WP_000569052.1|1730464_1731157_+	hypothetical protein	NA	Q858R9	Enterobacteria_phage	98.3	8.0e-124
WP_001286743.1|1731417_1732608_+|tail	phage tail sheath protein	tail	A0A0F7LBW9	Escherichia_phage	99.5	1.1e-224
WP_001251408.1|1732620_1733139_+|tail	phage major tail tube protein	tail	A0A0F7LDZ1	Escherichia_phage	100.0	1.4e-93
WP_001031307.1|1733195_1733471_+|tail	phage tail assembly protein	tail	A0A0F7LDQ8	Escherichia_phage	98.9	2.2e-40
WP_000785970.1|1733503_1733623_+|tail	GpE family phage tail protein	tail	A0A0F7LCR6	Escherichia_phage	100.0	1.0e-15
WP_000069941.1|1733615_1736063_+|tail	phage tail tape measure protein	tail	Q7Y4C8	Escherichia_virus	95.1	0.0e+00
WP_000978896.1|1736077_1736557_+|tail	phage tail protein	tail	A0A0F7LDE8	Escherichia_phage	100.0	6.6e-85
WP_000882981.1|1736556_1737720_+	phage late control D family protein	NA	U5N3V4	Enterobacteria_phage	99.2	1.4e-205
WP_000468310.1|1737801_1738020_+	prophage transcriptional regulator OgrK	NA	Q6DW12	Phage_TP	100.0	4.7e-38
WP_001292815.1|1738338_1740621_-	formate C-acetyltransferase	NA	A0A2P0VNR5	Tetraselmis_virus	41.4	1.3e-162
WP_000642546.1|1740675_1741533_-	formate transporter FocA	NA	NA	NA	NA	NA
WP_001297197.1|1741938_1743699_-	30S ribosomal protein S12 methylthiotransferase accessory protein YcaO	NA	NA	NA	NA	NA
WP_000642849.1|1743828_1744521_+	DUF421 domain-containing protein	NA	NA	NA	NA	NA
WP_015364460.1|1744719_1745808_+	3-phosphoserine/phosphohydroxythreonine transaminase	NA	M1Q1P2	Streptococcus_phage	46.8	1.6e-81
WP_000445231.1|1745878_1747162_+	3-phosphoshikimate 1-carboxyvinyltransferase	NA	NA	NA	NA	NA
WP_001295345.1|1747330_1748095_+	metallopeptidase YcaL	NA	NA	NA	NA	NA
WP_000125016.1|1748267_1748951_+	(d)CMP kinase	NA	NA	NA	NA	NA
WP_000140327.1|1749061_1750735_+	30S ribosomal protein S1	NA	NA	NA	NA	NA
WP_000167336.1|1750894_1751179_+	integration host factor subunit beta	NA	A7KV42	Bacillus_phage	40.2	3.2e-10
WP_000705679.1|1751385_1753650_+	ComEC family protein	NA	NA	NA	NA	NA
WP_000551270.1|1753686_1755435_+	lipid A ABC transporter ATP-binding protein/permease MsbA	NA	W8CYL7	Bacillus_phage	29.8	2.5e-57
WP_000570540.1|1755431_1756418_+	tetraacyldisaccharide 4'-kinase	NA	NA	NA	NA	NA
WP_000056529.1|1756454_1757687_+	YcaQ family DNA glycosylase	NA	NA	NA	NA	NA
WP_000350058.1|1757738_1757921_+	protein YcaR	NA	NA	NA	NA	NA
WP_000011616.1|1757917_1758664_+	3-deoxy-manno-octulosonate cytidylyltransferase	NA	NA	NA	NA	NA
WP_000436922.1|1758817_1759711_+	YcbJ family phosphotransferase	NA	NA	NA	NA	NA
WP_000899599.1|1759687_1760467_-	envelope biogenesis factor ElyC	NA	NA	NA	NA	NA
WP_001297198.1|1760602_1761388_+|tRNA	tRNA uridine 5-oxyacetic acid(34) methyltransferase CmoM	tRNA	NA	NA	NA	NA
WP_001288850.1|1761384_1762707_+	chromosome partition protein MukF	NA	NA	NA	NA	NA
WP_001295347.1|1762687_1763392_+	chromosome partition protein MukE	NA	NA	NA	NA	NA
WP_000572668.1|1763391_1767852_+	chromosome partition protein MukB	NA	NA	NA	NA	NA
WP_000925972.1|1768112_1769960_+	L,D-transpeptidase	NA	NA	NA	NA	NA
WP_001362150.1|1770140_1770689_+	YcbK family protein	NA	A0A0K1LKR7	Rhodobacter_phage	33.7	7.0e-06
WP_001109487.1|1770715_1771363_+	hydroxyacylglutathione hydrolase GloC	NA	NA	NA	NA	NA
WP_000462687.1|1771584_1772775_-	aspartate transaminase	NA	NA	NA	NA	NA
WP_000977920.1|1772959_1774048_-	porin OmpF	NA	Q1MVN1	Enterobacteria_phage	54.3	1.8e-98
WP_000117881.1|1774649_1776050_-|tRNA	asparagine--tRNA ligase	tRNA	A0A2K9V902	Bandra_megavirus	36.1	5.3e-82
>prophage 8
NC_020163	Escherichia coli APEC O78, complete sequence	4798435	2378318	2418740	4798435	lysis,tail,terminase,transposase,portal	Enterobacteria_phage(42.86%)	52	NA	NA
WP_000527753.1|2378318_2379779_-	mannitol dehydrogenase family protein	NA	G8DCZ3	Micromonas_pusilla_virus	29.8	4.3e-42
WP_120795384.1|2381752_2381866_+	hypothetical protein	NA	A0A1C9IHU6	Salmonella_phage	80.6	8.4e-07
WP_000836768.1|2381934_2382168_+	cold shock protein YdfK	NA	A0A192Y6D5	Salmonella_phage	88.3	1.1e-32
WP_000086527.1|2382485_2383076_+	recombinase family protein	NA	A0A0A7NPV4	Enterobacteria_phage	38.8	1.6e-24
WP_001296766.1|2383173_2383749_-|tail	tail fiber assembly protein	tail	K7PMH7	Enterobacteria_phage	94.8	7.2e-102
WP_072216207.1|2383748_2384648_-|tail	tail fiber protein	tail	K7PHC9	Enterobacteria_phage	90.6	1.8e-38
WP_074442114.1|2385434_2387015_-|portal	phage portal protein	portal	A5LH29	Enterobacteria_phage	99.6	4.0e-288
WP_001072975.1|2386942_2387155_-	hypothetical protein	NA	A5LH28	Enterobacteria_phage	100.0	1.1e-31
WP_001700682.1|2387151_2389251_-|terminase	phage terminase large subunit family protein	terminase	A5LH27	Enterobacteria_phage	96.1	0.0e+00
WP_000421825.1|2389259_2389799_-	DUF1441 family protein	NA	A5LH26	Enterobacteria_phage	100.0	1.8e-94
WP_001031431.1|2390351_2390558_-	hypothetical protein	NA	A0A0K2FJ18	Enterobacteria_phage	91.2	6.7e-26
WP_000035578.1|2390858_2391269_+	DUF1398 domain-containing protein	NA	C6ZCX4	Enterobacteria_phage	87.5	6.8e-62
WP_001019606.1|2391420_2391594_-	addiction module toxin, GnsA/GnsB family	NA	NA	NA	NA	NA
WP_001309517.1|2391765_2391921_-	hypothetical protein	NA	NA	NA	NA	NA
WP_122134696.1|2392000_2392066_-	hypothetical protein	NA	NA	NA	NA	NA
WP_071524604.1|2392068_2392257_-	cold-shock protein	NA	NA	NA	NA	NA
WP_000066495.1|2392267_2392480_-	cold shock protein CspI	NA	A0A1W6JNX5	Morganella_phage	74.3	1.2e-22
WP_001071769.1|2392843_2393341_-	DUF2514 domain-containing protein	NA	A0A291LBG9	Klebsiella_phage	29.5	2.9e-06
WP_001092971.1|2393337_2393871_-	lysozyme	NA	K7PLY1	Enterobacteria_phage	93.2	6.4e-97
WP_001309518.1|2393867_2394200_-	DUF1327 domain-containing protein	NA	K7PGU6	Enterobacteria_phage	64.3	1.1e-25
WP_000839590.1|2394183_2394399_-|lysis	phage lysis protein EssD	lysis	A5LH82	Enterobacteria_phage	94.4	1.1e-31
WP_000066484.1|2395152_2395368_-	cold shock-like protein CspB	NA	A0A1W6JNX5	Morganella_phage	76.5	3.4e-25
WP_000087756.1|2395668_2395881_+	cold shock-like protein CspF	NA	NA	NA	NA	NA
WP_120795389.1|2395935_2396025_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001047135.1|2396302_2397055_-	antitermination protein	NA	A0A192Y5X6	Salmonella_phage	92.8	7.1e-134
WP_001265035.1|2397068_2398118_-	DUF968 domain-containing protein	NA	A0A291AWV9	Escherichia_phage	57.3	1.7e-112
WP_001332495.1|2398119_2398398_-	hypothetical protein	NA	I6PCV7	Cronobacter_phage	46.9	1.3e-11
WP_000813256.1|2398856_2399012_-	type I toxin-antitoxin system toxin HokD	NA	A0A0U2QV81	Escherichia_phage	98.0	5.0e-18
WP_000379313.1|2399598_2400624_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000627167.1|2400851_2401271_-	DUF977 family protein	NA	A0A0U2QQN3	Escherichia_phage	88.2	5.9e-53
WP_088895425.1|2401245_2402474_-|transposase	IS3-like element IS2 family transposase	transposase	Q9ZXG3	Shigella_phage	99.3	1.3e-177
WP_001262375.1|2402653_2403724_-	hypothetical protein	NA	A0A088CD36	Shigella_phage	65.7	1.1e-63
WP_000693832.1|2403795_2404221_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000391950.1|2404204_2404486_-	helix-turn-helix domain-containing protein	NA	K7PHA1	Enterobacteria_phage	72.6	6.5e-24
WP_000362155.1|2404586_2405006_+	hypothetical protein	NA	K7PK07	Enterobacteria_phage	65.1	8.8e-25
WP_000379593.1|2405271_2405427_+	DUF1391 family protein	NA	M4QQ57	Salicola_phage	51.1	8.8e-07
WP_001171971.1|2405586_2405805_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001700701.1|2405808_2405973_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000449192.1|2406373_2406562_+	cell division inhibition protein DicB	NA	NA	NA	NA	NA
WP_001090200.1|2406558_2406750_+	DUF1482 family protein	NA	NA	NA	NA	NA
WP_000048464.1|2406842_2409314_+	exonuclease	NA	A0A192Y6E0	Salmonella_phage	57.5	8.5e-59
WP_000005552.1|2409386_2409638_+	excisionase family protein	NA	S4TND0	Salmonella_phage	50.0	2.2e-15
WP_000876976.1|2409672_2410953_+	DUF3596 domain-containing protein	NA	B6DZ48	Enterobacteria_phage	62.6	1.0e-156
WP_001513307.1|2410972_2411083_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000836058.1|2411140_2412160_-	Zn-dependent oxidoreductase	NA	E3SJ82	Synechococcus_phage	26.2	4.3e-17
WP_001295394.1|2412171_2413386_-	starvation-sensing protein RspA	NA	Q6A202	Oenococcus_phage	29.0	1.4e-46
WP_000598292.1|2413591_2413918_-	YnfA family protein	NA	A0A218MNG8	uncultured_virus	55.6	9.9e-24
WP_000705211.1|2414052_2414394_+	DUF1283 family protein	NA	NA	NA	NA	NA
WP_001138581.1|2414428_2414989_+	spermidine N1-acetyltransferase	NA	NA	NA	NA	NA
WP_001321287.1|2414991_2415702_-	YnfC family lipoprotein	NA	NA	NA	NA	NA
WP_001307224.1|2415809_2416115_+	DUF1161 domain-containing protein	NA	NA	NA	NA	NA
WP_000041556.1|2416313_2418740_+	dimethyl sulfoxide reductase subunit A	NA	A0A077SK27	Escherichia_phage	49.0	7.7e-214
>prophage 9
NC_020163	Escherichia coli APEC O78, complete sequence	4798435	2959679	2969121	4798435		Enterobacteria_phage(85.71%)	10	NA	NA
WP_001292773.1|2959679_2960816_+	VWA domain-containing protein	NA	Q9EYF7	Enterobacteria_phage	97.4	3.2e-162
WP_001374182.1|2960812_2962813_+	SWIM zinc finger family protein	NA	Q9EYF6	Enterobacteria_phage	96.3	0.0e+00
WP_001295429.1|2962937_2963399_+	YehR family lipoprotein	NA	Q9EYF5	Enterobacteria_phage	100.0	1.9e-76
WP_001295430.1|2963439_2963910_-	DUF1456 family protein	NA	Q9EYF4	Enterobacteria_phage	100.0	1.8e-82
WP_000598641.1|2963956_2964676_-	two-component system response regulator BtsR	NA	NA	NA	NA	NA
WP_001295431.1|2964672_2966358_-	two-component regulatory system sensor histidine kinase BtsS	NA	Q9EYF3	Enterobacteria_phage	99.6	2.5e-304
WP_001240401.1|2966579_2967311_+	HTH-type transcriptional regulator MlrA	NA	Q9EYF2	Enterobacteria_phage	99.5	9.7e-112
WP_001216963.1|2967370_2967478_+	protein YohO	NA	NA	NA	NA	NA
WP_000783120.1|2967458_2968190_-	glycine betaine ABC transporter permease YehW	NA	NA	NA	NA	NA
WP_000569361.1|2968194_2969121_-	glycine betaine ABC transporter ATP binding protein YehX	NA	G3M9Y6	Bacillus_virus	30.8	1.7e-23
>prophage 10
NC_020163	Escherichia coli APEC O78, complete sequence	4798435	2981150	3053604	4798435	holin,lysis,tail,tRNA,transposase	Shigella_phage(29.63%)	70	NA	NA
WP_001264866.1|2981150_2982098_-|tRNA	tRNA dihydrouridine(16) synthase DusC	tRNA	NA	NA	NA	NA
WP_001295452.1|2982336_2982735_+	CidA/LrgA family protein	NA	NA	NA	NA	NA
WP_000968208.1|2982731_2983427_+|lysis	CidB/LrgB family autolysis modulator	lysis	NA	NA	NA	NA
WP_000553564.1|2983556_2984441_+	cytidine deaminase	NA	NA	NA	NA	NA
WP_000920064.1|2984590_2985310_+	outer membrane permeability protein SanA	NA	NA	NA	NA	NA
WP_000383096.1|2985312_2985552_+	DUF2542 family protein	NA	NA	NA	NA	NA
WP_001136359.1|2985870_2987109_+	NAD-dependent dihydropyrimidine dehydrogenase subunit PreT	NA	NA	NA	NA	NA
WP_000956045.1|2987102_2988338_+	NAD-dependent dihydropyrimidine dehydrogenase subunit PreA	NA	NA	NA	NA	NA
WP_001275118.1|2988408_2989419_-	galactose/methyl galactoside ABC transporter permease MglC	NA	NA	NA	NA	NA
WP_000255039.1|2989434_2990955_-	galactose/methyl galactoside ABC transporter ATP-binding protein MglA	NA	F2Y2R6	Organic_Lake_phycodnavirus	33.0	2.6e-10
WP_001036964.1|2991015_2992014_-	galactose/glucose ABC transporter substrate-binding protein MglB	NA	NA	NA	NA	NA
WP_000628659.1|2992293_2993334_-	HTH-type transcriptional regulator GalS	NA	NA	NA	NA	NA
WP_000440921.1|2993475_2994633_-	DUF418 family protein	NA	NA	NA	NA	NA
WP_001139613.1|2994649_2995318_-	GTP cyclohydrolase I FolE	NA	M1Q6X8	Cellulophaga_phage	56.3	9.0e-56
WP_000425460.1|2995575_2996412_+	S-formylglutathione hydrolase	NA	NA	NA	NA	NA
WP_000253273.1|2998727_3000197_-	lysine-specific permease	NA	NA	NA	NA	NA
WP_000548294.1|3000401_3001283_-	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_000182053.1|3001381_3002431_+	YeiH family protein	NA	NA	NA	NA	NA
WP_000873890.1|3002504_3003362_+	deoxyribonuclease IV	NA	A0A1V0SBL9	Catovirus	34.0	1.4e-24
WP_001064972.1|3003364_3004453_+	sugar kinase	NA	NA	NA	NA	NA
WP_000382944.1|3004508_3005759_-	NupC/NupG family nucleoside CNT transporter	NA	NA	NA	NA	NA
WP_000415455.1|3005858_3006800_-	ribosylpyrimidine nucleosidase	NA	NA	NA	NA	NA
WP_000658565.1|3006929_3007628_+	transcriptional regulator YeiL	NA	NA	NA	NA	NA
WP_000353883.1|3007824_3009075_-	NupC/NupG family nucleoside CNT transporter	NA	NA	NA	NA	NA
WP_015364505.1|3009168_3010089_-	pseudouridine-5'-phosphate glycosidase	NA	NA	NA	NA	NA
WP_001208134.1|3010076_3011018_-	pseudouridine kinase	NA	NA	NA	NA	NA
WP_000854467.1|3011441_3013133_-	PTS fructose transporter subunit IIBC	NA	NA	NA	NA	NA
WP_000091263.1|3013149_3014088_-	1-phosphofructokinase	NA	NA	NA	NA	NA
WP_000487247.1|3014087_3015218_-	fused PTS fructose transporter subunit IIA/HPr protein	NA	NA	NA	NA	NA
WP_000551977.1|3015585_3016767_+	sugar efflux transporter SetB	NA	NA	NA	NA	NA
WP_000389030.1|3016763_3017018_-	YkgJ family cysteine cluster protein	NA	NA	NA	NA	NA
WP_001136827.1|3017172_3017745_+	elongation factor P-like protein YeiP	NA	NA	NA	NA	NA
WP_000848216.1|3017967_3019434_+	mannitol dehydrogenase family protein	NA	H8ZJP8	Ostreococcus_tauri_virus	29.3	3.9e-43
WP_015364506.1|3019551_3020538_+	zinc-binding GTPase YeiR	NA	NA	NA	NA	NA
WP_001296828.1|3020576_3021290_+	Kdo(2)-lipid A phosphotransferase	NA	NA	NA	NA	NA
WP_000241011.1|3021701_3022268_+	bifunctional murein DD-endopeptidase/murein LD-carboxypeptidase	NA	A0A1V0DZX6	Clostridioides_phage	40.7	4.2e-14
WP_000470609.1|3022448_3024005_+	cyclic di-GMP phosphodiesterase	NA	NA	NA	NA	NA
WP_000637053.1|3024086_3025901_+	ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_000501604.1|3025901_3026996_+	microcin C ABC transporter permease YejB	NA	NA	NA	NA	NA
WP_000088916.1|3026995_3028021_+	ABC transporter permease	NA	NA	NA	NA	NA
WP_000194914.1|3028022_3029612_+	microcin C ABC transporter ATP-binding protein YejF	NA	G9BWD6	Planktothrix_phage	34.0	1.1e-19
WP_000202791.1|3029615_3029960_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000213385.1|3030292_3031483_-	multidrug efflux MFS transporter Bcr	NA	S4TR35	Salmonella_phage	23.7	2.9e-20
WP_001234850.1|3031510_3032206_-	16S rRNA pseudouridine(516) synthase RsuA	NA	NA	NA	NA	NA
WP_000578079.1|3032355_3034116_+	DEAD/DEAH box helicase	NA	M4Q3N1	Vibrio_phage	41.8	3.2e-100
WP_000494183.1|3034240_3034525_+	50S ribosomal protein L25	NA	NA	NA	NA	NA
WP_000050784.1|3034663_3035671_-	nucleoid-associated protein YejK	NA	A0A1V0E8C0	Vibrio_phage	48.3	7.7e-83
WP_001135668.1|3035852_3036080_+	YejL family protein	NA	NA	NA	NA	NA
WP_000256203.1|3036099_3037860_+	cardiolipin transport protein PbgA	NA	NA	NA	NA	NA
WP_088895425.1|3038784_3040012_+|transposase	IS3-like element IS2 family transposase	transposase	Q9ZXG3	Shigella_phage	99.3	1.3e-177
WP_000834400.1|3040190_3042080_+	DUF262 domain-containing protein	NA	NA	NA	NA	NA
WP_001700849.1|3042333_3042723_+	hypothetical protein	NA	F1BUP1	Erwinia_phage	43.8	7.2e-13
WP_001106825.1|3042744_3043185_+|tail	tail fiber assembly protein	tail	A0A0F7LDZ0	Escherichia_phage	70.3	6.2e-53
WP_000994390.1|3043156_3043567_-|tail	tail fiber assembly protein	tail	U5P0S4	Shigella_phage	80.3	8.6e-25
WP_000184049.1|3043920_3044310_+	hypothetical protein	NA	A0A1L5C299	Pseudoalteromonas_phage	65.5	1.7e-38
WP_000522147.1|3044491_3044761_-	hypothetical protein	NA	G8C7W1	Escherichia_phage	72.4	5.3e-23
WP_001076627.1|3044768_3045383_-	glycoside hydrolase family 19 protein	NA	Q8HA86	Salmonella_phage	81.9	5.0e-93
WP_000422365.1|3045382_3045664_-|holin	phage holin family protein	holin	K7PKN9	Enterobacterial_phage	46.2	9.7e-20
WP_001283162.1|3045650_3046037_-|holin	phage holin family protein	holin	A0A192Y8P2	Salmonella_phage	99.2	9.2e-61
WP_000779379.1|3047148_3047418_-	hypothetical protein	NA	NA	NA	NA	NA
WP_103773428.1|3047632_3047974_-	antitermination protein	NA	Q8SBE4	Shigella_phage	97.2	1.2e-51
WP_001700853.1|3047924_3048305_-	phage N-6-adenine-methyltransferase	NA	Q8SBE9	Shigella_phage	99.1	2.7e-65
WP_000135682.1|3048809_3049172_+	hypothetical protein	NA	U5P4J6	Shigella_phage	100.0	3.3e-60
WP_015364510.1|3049237_3050062_+	DUF2303 family protein	NA	U5P439	Shigella_phage	98.5	1.9e-148
WP_015364511.1|3050189_3050726_+	5'-deoxynucleotidase	NA	U5P0T3	Shigella_phage	98.9	2.2e-100
WP_001242758.1|3050716_3051079_+	hypothetical protein	NA	K7PH61	Enterobacteria_phage	95.8	5.8e-65
WP_162861703.1|3051134_3051293_+	hypothetical protein	NA	A0A0H4J3C0	Shigella_phage	50.0	4.5e-06
WP_001096409.1|3051354_3051564_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000741303.1|3051566_3052769_+	hypothetical protein	NA	A0A2D1GN00	Marinobacter_phage	30.2	6.2e-31
WP_000561018.1|3052752_3053604_-	hypothetical protein	NA	I6PD67	Cronobacter_phage	36.2	4.6e-36
>prophage 11
NC_020163	Escherichia coli APEC O78, complete sequence	4798435	3589200	3602383	4798435		Escherichia_phage(50.0%)	12	NA	NA
WP_001272924.1|3589200_3591762_+	DNA mismatch repair protein MutS	NA	E3T5Q7	Cafeteria_roenbergensis_virus	20.6	1.7e-30
WP_001141340.1|3591867_3592524_+	protein-serine/threonine phosphatase	NA	A0A222YWF0	Escherichia_phage	46.3	8.0e-49
WP_001297141.1|3592574_3593342_-	DeoR/GlpR transcriptional regulator	NA	A0A077SK06	Escherichia_phage	56.7	3.3e-70
WP_000847985.1|3593537_3594446_+	NAD(P)-dependent oxidoreductase	NA	A0A077SLF7	Escherichia_phage	76.9	3.0e-118
WP_000590392.1|3594442_3595705_+	3-oxo-tetronate kinase	NA	A0A077SLJ7	Escherichia_phage	61.4	1.3e-135
WP_001278994.1|3595701_3596340_+	aldolase	NA	A0A077SK32	Escherichia_phage	75.0	1.4e-82
WP_001136918.1|3596344_3597121_+	HPr family phosphocarrier protein	NA	NA	NA	NA	NA
WP_000104456.1|3597209_3598574_+	GntP family transporter	NA	NA	NA	NA	NA
WP_000081550.1|3598667_3599660_-	RNA polymerase sigma factor RpoS	NA	G8CLC7	Synechococcus_phage	37.6	6.1e-32
WP_001272592.1|3599722_3600862_-	murein hydrolase activator NlpD	NA	D7RWE0	Brochothrix_phage	35.6	1.7e-06
WP_000254708.1|3601001_3601628_-	protein-L-isoaspartate O-methyltransferase	NA	A0A1B1IU40	uncultured_Mediterranean_phage	49.7	5.7e-36
WP_001295182.1|3601621_3602383_-	5'/3'-nucleotidase SurE	NA	A0A1B1ITZ2	uncultured_Mediterranean_phage	48.0	3.4e-59
