The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
NZ_CP007528	Salmonella enterica subsp. enterica serovar Enteritidis str. CDC_2010K_0968 isolate CDC_2010K-0968 chromosome, complete genome	4679662	1470095	1536920	4679662	portal,tail,capsid,tRNA,integrase,head,lysis,terminase,transposase,plate	Salmonella_phage(91.3%)	64	1470379:1470393	1506343:1506357
WP_089113803.1|1470095_1471206_+|transposase	IS3-like element IS1351 family transposase	transposase	A0A2I6AZV9	Macacine_betaherpesvirus	25.6	7.6e-07
1470379:1470393	attL	TGAGCTGGTCACTCA	NA	NA	NA	NA
WP_000445376.1|1472002_1472806_-	DUF3800 domain-containing protein	NA	Q19UP3	Mannheimia_phage	44.7	1.2e-62
WP_001142974.1|1473204_1473798_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000360326.1|1474059_1474722_-	hypothetical protein	NA	E5G6K9	Salmonella_phage	100.0	3.4e-124
WP_000218402.1|1475274_1476291_-|integrase	site-specific integrase	integrase	E5G6L0	Salmonella_phage	100.0	5.0e-199
WP_000932273.1|1476293_1476926_-	phage repressor protein CI	NA	A0A1S6KZZ7	Salmonella_phage	51.4	6.3e-59
WP_000102105.1|1477047_1477290_+	Rha family transcriptional regulator	NA	A0A1S6KZZ6	Salmonella_phage	97.5	6.8e-38
WP_000460848.1|1477323_1477833_+	phage regulatory CII family protein	NA	E5G6L3	Salmonella_phage	100.0	1.5e-87
WP_000956190.1|1477840_1478041_+	DUF2724 domain-containing protein	NA	E5G6L4	Salmonella_phage	100.0	2.4e-33
WP_000963474.1|1478004_1478346_+	DUF5347 domain-containing protein	NA	E5G6L5	Salmonella_phage	100.0	1.2e-56
WP_001244219.1|1478413_1478647_+	DUF2732 family protein	NA	E5G6L6	Salmonella_phage	100.0	1.7e-33
WP_000752613.1|1478646_1478874_+	TraR/DksA family transcriptional regulator	NA	E5G6L7	Salmonella_phage	100.0	2.7e-36
WP_000104187.1|1478870_1479728_+	DNA adenine methylase	NA	E5G6L8	Salmonella_phage	100.0	6.8e-165
WP_000017507.1|1479724_1482139_+	replication endonuclease	NA	E5G6L9	Salmonella_phage	100.0	0.0e+00
WP_001154433.1|1482291_1482480_+	hypothetical protein	NA	E5G6M0	Salmonella_phage	100.0	1.4e-27
WP_001217571.1|1482490_1482724_+	DinI family protein	NA	E5G6M1	Salmonella_phage	98.7	1.8e-35
WP_001673609.1|1482837_1483515_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001284991.1|1483828_1485493_+	AIPR family protein	NA	E5G6M2	Salmonella_phage	100.0	0.0e+00
WP_001542203.1|1485596_1486637_-|portal	phage portal protein	portal	E5G6M3	Salmonella_phage	100.0	5.5e-201
WP_001098395.1|1486636_1488403_-|terminase	terminase ATPase subunit family protein	terminase	A0A1S6KZW3	Salmonella_phage	97.1	0.0e+00
WP_000216276.1|1488545_1489379_+|capsid	GPO family capsid scaffolding protein	capsid	E5G6M5	Salmonella_phage	100.0	3.1e-130
WP_000730759.1|1489395_1490457_+|capsid	phage major capsid protein, P2 family	capsid	E5G6M6	Salmonella_phage	100.0	2.1e-195
WP_000059173.1|1490460_1491111_+|terminase	terminase endonuclease subunit	terminase	E5G6M7	Salmonella_phage	100.0	4.9e-115
WP_000673537.1|1491204_1491669_+|head	head completion/stabilization protein	head	E5G6M8	Salmonella_phage	100.0	9.9e-86
WP_000868184.1|1491668_1491872_+|tail	tail protein X	tail	E5G6M9	Salmonella_phage	100.0	3.8e-34
WP_000171565.1|1491875_1492091_+	hypothetical protein	NA	E5G6N0	Salmonella_phage	100.0	5.9e-33
WP_001069923.1|1492071_1492587_+	lysozyme	NA	E5G6N1	Salmonella_phage	100.0	5.3e-96
WP_000196199.1|1492583_1493012_+|lysis	LysB family phage lysis regulatory protein	lysis	E5G6N2	Salmonella_phage	100.0	2.3e-68
WP_001039958.1|1493107_1493539_+|tail	phage tail protein	tail	E5G6N3	Salmonella_phage	100.0	1.7e-76
WP_000343949.1|1493531_1493978_+	phage virion morphogenesis protein	NA	E5G6N4	Salmonella_phage	99.3	2.3e-71
WP_000958562.1|1493979_1494831_-	hypothetical protein	NA	E5G6N5	Salmonella_phage	100.0	2.8e-163
WP_001672413.1|1494908_1495487_+|plate	phage baseplate assembly protein V	plate	E5G6N6	Salmonella_phage	100.0	1.4e-108
WP_000189373.1|1495483_1495843_+	GPW/gp25 family protein	NA	E5G6N7	Salmonella_phage	100.0	1.1e-60
WP_000268332.1|1495829_1496738_+|plate	baseplate assembly protein	plate	E5G6N8	Salmonella_phage	100.0	5.4e-160
WP_001086804.1|1496730_1497336_+|tail	phage tail protein I	tail	E5G6N9	Salmonella_phage	100.0	1.3e-117
WP_001274649.1|1497332_1499186_+|tail	phage tail protein	tail	E5G6P0	Salmonella_phage	100.0	0.0e+00
WP_000143187.1|1499185_1499761_+|tail	tail fiber assembly protein	tail	E5G6P1	Salmonella_phage	100.0	4.3e-107
WP_000974843.1|1500630_1500855_+	helix-turn-helix domain-containing protein	NA	E5G6P5	Salmonella_phage	100.0	1.5e-34
WP_000046108.1|1500957_1502130_+|tail	phage tail sheath protein	tail	E5G6P7	Salmonella_phage	100.0	8.9e-224
WP_001207651.1|1502139_1502655_+|tail	phage major tail tube protein	tail	E5G6P8	Salmonella_phage	100.0	9.3e-93
WP_001280963.1|1502709_1503012_+|tail	phage tail assembly protein	tail	E5G6P9	Salmonella_phage	100.0	1.5e-45
WP_000763316.1|1503026_1503146_+|tail	GpE family phage tail protein	tail	E5G6Q0	Salmonella_phage	100.0	1.8e-15
WP_001282768.1|1503138_1505946_+|tail	phage tail tape measure protein	tail	E5G6Q1	Salmonella_phage	99.9	0.0e+00
WP_000980411.1|1505942_1506428_+|tail	phage tail protein	tail	E5G6Q2	Salmonella_phage	100.0	6.7e-77
1506343:1506357	attR	TGAGTGACCAGCTCA	NA	NA	NA	NA
WP_001102269.1|1506424_1507525_+	phage late control D family protein	NA	E5G6Q3	Salmonella_phage	100.0	2.6e-201
WP_000980500.1|1507593_1507812_+	ogr/Delta-like zinc finger family protein	NA	E5G6Q4	Salmonella_phage	100.0	2.1e-38
WP_012543392.1|1508363_1509527_-	HlyD family type I secretion periplasmic adaptor subunit	NA	NA	NA	NA	NA
WP_000196151.1|1509534_1511715_-	type I secretion system permease/ATPase	NA	F2Y302	Organic_Lake_phycodnavirus	34.0	1.3e-18
WP_000533863.1|1511711_1513121_-	TolC family outer membrane protein	NA	NA	NA	NA	NA
WP_001237694.1|1513185_1524660_-	biofilm-associated protein BapA	NA	NA	NA	NA	NA
WP_001518569.1|1525274_1525757_-	SsrA-binding protein SmpB	NA	W5RAM5	Staphylococcus_phage	47.4	5.2e-29
WP_000242603.1|1525906_1526383_+	type II toxin-antitoxin system RatA family toxin	NA	NA	NA	NA	NA
WP_001112990.1|1526372_1526663_+	RnfH family protein	NA	NA	NA	NA	NA
WP_001203445.1|1526828_1527167_-	outer membrane protein assembly factor BamE	NA	NA	NA	NA	NA
WP_000880965.1|1527315_1528977_-	DNA repair protein RecN	NA	NA	NA	NA	NA
WP_001059151.1|1529062_1529941_-	NAD(+) kinase	NA	NA	NA	NA	NA
WP_001518875.1|1530064_1530655_+	nucleotide exchange factor GrpE	NA	NA	NA	NA	NA
WP_001287926.1|1530689_1531295_-	hypothetical protein	NA	NA	NA	NA	NA
WP_127172650.1|1531415_1532702_-	HlyC/CorC family transporter	NA	NA	NA	NA	NA
WP_001537507.1|1532721_1533513_-	inner membrane protein YpjD	NA	NA	NA	NA	NA
WP_000460052.1|1533678_1535040_+	signal recognition particle protein	NA	NA	NA	NA	NA
WP_000256453.1|1535292_1535541_+	30S ribosomal protein S16	NA	NA	NA	NA	NA
WP_000043266.1|1535559_1536108_+	ribosome maturation factor RimM	NA	NA	NA	NA	NA
WP_000469804.1|1536152_1536920_+|tRNA	tRNA (guanosine(37)-N1)-methyltransferase TrmD	tRNA	NA	NA	NA	NA
>prophage 2
NZ_CP007528	Salmonella enterica subsp. enterica serovar Enteritidis str. CDC_2010K_0968 isolate CDC_2010K-0968 chromosome, complete genome	4679662	2041924	2051095	4679662	tRNA	Enterobacteria_phage(66.67%)	10	NA	NA
WP_000569168.1|2041924_2042872_+	ABC transporter ATP-binding protein	NA	F2Y1V5	Organic_Lake_phycodnavirus	27.8	2.8e-10
WP_000824854.1|2042855_2043587_+	ABC transporter permease	NA	NA	NA	NA	NA
WP_001261696.1|2043567_2043675_-	protein YohO	NA	NA	NA	NA	NA
WP_001240421.1|2043734_2044466_-	HTH-type transcriptional regulator MlrA	NA	Q9EYF2	Enterobacteria_phage	87.4	1.7e-100
WP_000272845.1|2044688_2046374_+	sensor histidine kinase	NA	Q9EYF3	Enterobacteria_phage	91.1	6.2e-279
WP_000598637.1|2046370_2047090_+	two-component system response regulator BtsR	NA	NA	NA	NA	NA
WP_000950414.1|2047136_2047604_+	DUF1456 family protein	NA	Q9EYF4	Enterobacteria_phage	89.7	4.3e-73
WP_001197951.1|2047660_2048191_-	YehR family lipoprotein	NA	NA	NA	NA	NA
WP_000703145.1|2048362_2048821_-	YehR family lipoprotein	NA	Q9EYF5	Enterobacteria_phage	72.5	6.4e-53
WP_000195340.1|2049061_2051095_-|tRNA	methionine--tRNA ligase	tRNA	A0A1V0SDF2	Indivirus	26.9	6.1e-55
>prophage 3
NZ_CP007528	Salmonella enterica subsp. enterica serovar Enteritidis str. CDC_2010K_0968 isolate CDC_2010K-0968 chromosome, complete genome	4679662	2118292	2128798	4679662		Enterobacteria_phage(37.5%)	10	NA	NA
WP_001144948.1|2118292_2119696_+	colanic acid biosynthesis protein WcaM	NA	A0A291LBB9	Klebsiella_phage	26.5	4.0e-21
WP_000981469.1|2119873_2120767_+	GalU regulator GalF	NA	A0A127AW70	Bacillus_phage	42.2	4.8e-44
WP_000697848.1|2121142_2122228_+	dTDP-glucose 4,6-dehydratase	NA	I7HTA3	Enterobacteria_phage	53.9	1.6e-102
WP_001023658.1|2122227_2123127_+	dTDP-4-dehydrorhamnose reductase	NA	A0A291LA50	Escherichia_phage	36.0	5.1e-30
WP_000857535.1|2123174_2124053_+	glucose-1-phosphate thymidylyltransferase RfbA	NA	I7I009	Enterobacteria_phage	65.5	2.1e-108
WP_000973709.1|2124053_2124605_+	dTDP-4-dehydrorhamnose 3,5-epimerase	NA	I7HJC4	Enterobacteria_phage	58.0	1.3e-52
WP_000018223.1|2124610_2125585_+	CDP-6-deoxy-delta-3,4-glucoseen reductase	NA	NA	NA	NA	NA
WP_000648783.1|2125600_2126374_+	glucose-1-phosphate cytidylyltransferase	NA	NA	NA	NA	NA
WP_000565913.1|2126378_2127458_+	CDP-glucose 4,6-dehydratase	NA	A0A222YY99	Synechococcus_phage	24.5	1.7e-16
WP_000126349.1|2127484_2128798_+	lipopolysaccharide biosynthesis protein RfbH	NA	H8ZJ36	Ostreococcus_tauri_virus	35.1	7.0e-52
>prophage 4
NZ_CP007528	Salmonella enterica subsp. enterica serovar Enteritidis str. CDC_2010K_0968 isolate CDC_2010K-0968 chromosome, complete genome	4679662	2782488	2796764	4679662	holin,tRNA	Escherichia_phage(66.67%)	19	NA	NA
WP_000802786.1|2782488_2783034_-	glycoside hydrolase family 108 protein	NA	A0A0U2S643	Escherichia_phage	83.4	2.3e-89
WP_000445513.1|2783030_2783312_-|holin	phage holin family protein	holin	K7PKN9	Enterobacterial_phage	49.4	1.3e-16
WP_001688615.1|2783301_2783490_-	hypothetical protein	NA	Q8W636	Enterobacteria_phage	57.4	9.4e-11
WP_000640113.1|2785977_2786514_-	DUF1133 family protein	NA	A0A0U2S606	Escherichia_phage	70.9	1.4e-70
WP_000774470.1|2786510_2786801_-	DUF1364 domain-containing protein	NA	A0A0U2KD41	Escherichia_phage	76.0	5.1e-40
WP_000940751.1|2786800_2787400_-	DUF1367 family protein	NA	A0A0U2RT94	Escherichia_phage	82.9	5.5e-97
WP_000734094.1|2787462_2787633_-	hypothetical protein	NA	A0A0U2I1S4	Escherichia_phage	61.8	8.5e-11
WP_000882662.1|2787923_2788136_-	type I toxin-antitoxin system Hok family toxin	NA	A0A0U2QV81	Escherichia_phage	95.7	2.5e-28
WP_000556389.1|2788505_2789438_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001033796.1|2789434_2789989_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001676916.1|2790150_2790480_-	DUF977 family protein	NA	A0A0U2QQN3	Escherichia_phage	51.7	6.5e-23
WP_001227859.1|2790752_2791220_+	helix-turn-helix domain-containing protein	NA	A0A0U2QW76	Escherichia_phage	66.9	1.0e-53
WP_085981757.1|2791604_2791760_+	DUF1391 family protein	NA	M4QQ57	Salicola_phage	48.9	2.6e-06
WP_000004762.1|2791867_2792389_-	super-infection exclusion protein B	NA	NA	NA	NA	NA
WP_000560208.1|2792826_2793048_+	cell division protein FtsZ	NA	A0A0U2RTC4	Escherichia_phage	83.6	7.9e-33
WP_000800272.1|2793132_2793450_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001676915.1|2793477_2794095_+	exodeoxyribonuclease	NA	A0A088CD28	Shigella_phage	41.9	2.5e-36
WP_001156217.1|2794411_2795347_+|tRNA	tRNA 2-thiocytidine(32) synthetase TtcA	tRNA	A0A0U2S5Z2	Escherichia_phage	97.3	7.2e-144
WP_000123686.1|2795390_2796764_-	ATP-dependent RNA helicase DbpA	NA	Q5GF26	Diachasmimorpha_longicaudata_entomopoxvirus	32.0	2.1e-51
>prophage 5
NZ_CP007528	Salmonella enterica subsp. enterica serovar Enteritidis str. CDC_2010K_0968 isolate CDC_2010K-0968 chromosome, complete genome	4679662	3021196	3037311	4679662	integrase,holin,tail,lysis	Salmonella_phage(30.77%)	16	3017826:3017855	3037447:3037476
3017826:3017855	attL	AAATAAAAAGAGACCGAATACGATTCCTGT	NA	NA	NA	NA
WP_072100756.1|3021196_3022060_-	DUF1983 domain-containing protein	NA	K7PKJ2	Enterobacteria_phage	78.9	9.0e-48
WP_001152416.1|3024700_3025396_-|tail	phage minor tail protein L	tail	A0A0K2FJ01	Enterobacteria_phage	66.7	1.0e-89
WP_000877926.1|3025485_3026019_+	superoxide dismutase [Cu-Zn]	NA	Q9MC02	Salmonella_phage	54.0	1.8e-46
WP_001541990.1|3026913_3027393_-|lysis	lysis protein	lysis	Q56118	Enterobacteria_phage	77.0	1.4e-55
WP_000984586.1|3027410_3027863_-	lysozyme	NA	A0A0M4R365	Salmonella_phage	97.3	2.3e-79
WP_001574216.1|3027846_3028176_-|holin	phage holin, lambda family	holin	A0A0M3ULK9	Salmonella_phage	100.0	5.8e-56
WP_001574215.1|3028451_3029138_+	PipA/GogA/GtgA family type III secretion system effector	NA	Q9MBM0	Phage_Gifsy-2	99.6	1.8e-131
WP_000798708.1|3029498_3029948_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001574213.1|3030321_3030846_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001097218.1|3030942_3031632_-	antitermination protein	NA	I6PDF8	Cronobacter_phage	54.9	2.1e-60
WP_000784710.1|3031761_3031989_-	recombination protein NinG	NA	A0A0M4RU10	Salmonella_phage	66.7	2.2e-14
WP_000940753.1|3031985_3032585_-	DUF1367 family protein	NA	A0A0U2RT94	Escherichia_phage	82.9	4.7e-96
WP_000911593.1|3032648_3032897_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001237395.1|3033585_3035565_-	MBL fold metallo-hydrolase	NA	A0A2P0VMX1	Tetraselmis_virus	46.3	1.9e-162
WP_001575998.1|3035978_3036257_+	excisionase	NA	A0A2H4J5E1	uncultured_Caudovirales_phage	37.5	1.4e-10
WP_000087636.1|3036231_3037311_+|integrase	tyrosine-type recombinase/integrase	integrase	A0A2H4IYC8	uncultured_Caudovirales_phage	52.5	3.0e-101
3037447:3037476	attR	AAATAAAAAGAGACCGAATACGATTCCTGT	NA	NA	NA	NA
>prophage 6
NZ_CP007528	Salmonella enterica subsp. enterica serovar Enteritidis str. CDC_2010K_0968 isolate CDC_2010K-0968 chromosome, complete genome	4679662	3239176	3249970	4679662	tail	Escherichia_phage(37.5%)	9	NA	NA
WP_000193790.1|3239176_3241789_-	aminopeptidase N	NA	A0A0P0IY26	Acinetobacter_phage	22.8	6.3e-20
WP_000497441.1|3242215_3242407_+	DinI-like family protein	NA	S4TNM0	Salmonella_phage	95.2	6.2e-26
WP_001525490.1|3242677_3243364_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000334547.1|3243723_3244350_+	SOS response-associated peptidase	NA	A0A2H4J5W2	uncultured_Caudovirales_phage	63.2	1.4e-66
WP_001674638.1|3244997_3245966_-	SPI-2 type III secretion system effector SseI	NA	Q9MBL9	Phage_Gifsy-2	99.4	3.0e-193
WP_000143167.1|3246443_3247025_-|tail	tail fiber assembly protein	tail	A0A0M4RTP2	Salmonella_phage	89.5	1.7e-95
WP_000583382.1|3247024_3248734_-|tail	tail fiber protein	tail	A0A0U2SAV1	Escherichia_phage	66.0	1.5e-91
WP_000729406.1|3248730_3249357_-	hypothetical protein	NA	A0A0U2RK03	Escherichia_phage	71.6	3.3e-92
WP_000274547.1|3249340_3249970_-	hypothetical protein	NA	A0A0U2RJZ0	Escherichia_phage	65.9	1.6e-75
>prophage 7
NZ_CP007528	Salmonella enterica subsp. enterica serovar Enteritidis str. CDC_2010K_0968 isolate CDC_2010K-0968 chromosome, complete genome	4679662	3321680	3328993	4679662	integrase,protease	Ralstonia_phage(16.67%)	7	3316477:3316491	3327729:3327743
3316477:3316491	attL	GGAAAATCAACGCTG	NA	NA	NA	NA
WP_001539594.1|3321680_3322058_+|integrase	integrase	integrase	A0A077KET4	Ralstonia_phage	41.0	1.2e-20
WP_001117984.1|3322219_3322417_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000934064.1|3322629_3324906_-|protease	ATP-dependent Clp protease ATP-binding subunit ClpA	protease	A0A223W0B1	Agrobacterium_phage	42.3	6.2e-165
WP_000520789.1|3324936_3325257_-|protease	ATP-dependent Clp protease adapter ClpS	protease	A0A1B1IT64	uncultured_Mediterranean_phage	45.7	4.5e-13
WP_000447499.1|3325580_3325802_+	cold shock-like protein CspD	NA	A0A2H4N7Y6	Lake_Baikal_phage	64.2	9.3e-18
WP_000125875.1|3325931_3327878_-	macrolide ABC transporter ATP-binding protein/permease MacB	NA	G9BWD6	Planktothrix_phage	43.1	2.0e-39
3327729:3327743	attR	CAGCGTTGATTTTCC	NA	NA	NA	NA
WP_001201751.1|3327874_3328993_-	macrolide transporter subunit MacA	NA	A0A140XAI1	Dickeya_phage	38.9	1.4e-08
>prophage 1
NZ_CP007529	Salmonella enterica subsp. enterica serovar Enteritidis str. CDC_2010K_0968 isolate CDC_2010K-0968 plasmid p00, complete sequence	59369	0	10161	59369		Enterobacteria_phage(100.0%)	11	NA	NA
WP_015059605.1|404_716_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000979451.1|744_1047_+	transcriptional regulator PefB	NA	NA	NA	NA	NA
WP_000748204.1|1321_1846_+	fimbrial protein	NA	NA	NA	NA	NA
WP_000007891.1|2072_4481_+	outer membrane usher protein PefC	NA	NA	NA	NA	NA
WP_001038509.1|4473_5166_+	fimbrial chaperone PefD	NA	NA	NA	NA	NA
WP_000085742.1|5162_5741_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001676641.1|5923_6778_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000135399.1|7232_7583_+	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_077907617.1|7826_8483_+	DsbA family protein	NA	NA	NA	NA	NA
WP_000490317.1|8668_9514_+	YjiK family protein	NA	NA	NA	NA	NA
WP_000725064.1|9603_10161_+	complement resistance protein Rck	NA	Q9EV15	Enterobacteria_phage	37.4	5.8e-24
>prophage 2
NZ_CP007529	Salmonella enterica subsp. enterica serovar Enteritidis str. CDC_2010K_0968 isolate CDC_2010K-0968 plasmid p00, complete sequence	59369	27345	34253	59369	transposase	Escherichia_phage(33.33%)	8	NA	NA
WP_000925628.1|27345_27768_+	translesion error-prone DNA polymerase V autoproteolytic subunit	NA	A0A1W6JNS2	Morganella_phage	52.4	2.0e-29
WP_000457542.1|27767_29042_+	Y-family DNA polymerase	NA	F1C5A5	Cronobacter_phage	64.5	3.9e-156
WP_000064277.1|29123_30098_-	ParB/RepB/Spo0J family partition protein	NA	A0A1B0V750	Salmonella_phage	53.5	5.1e-84
WP_000427676.1|30097_31303_-	AAA family ATPase	NA	A0A077SL49	Escherichia_phage	69.3	1.5e-162
WP_000728919.1|31717_32659_+|transposase	Rpn family recombination-promoting nuclease/putative transposase	transposase	Q2A0A7	Sodalis_phage	54.7	4.7e-74
WP_000176303.1|32655_33261_-	DUF2913 family protein	NA	NA	NA	NA	NA
WP_001527010.1|33317_33653_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001541564.1|33836_34253_-	hypothetical protein	NA	O64348	Escherichia_phage	42.9	8.2e-07
>prophage 3
NZ_CP007529	Salmonella enterica subsp. enterica serovar Enteritidis str. CDC_2010K_0968 isolate CDC_2010K-0968 plasmid p00, complete sequence	59369	37801	38362	59369		Ralstonia_phage(100.0%)	1	NA	NA
WP_001240330.1|37801_38362_+	recombinase family protein	NA	A0A1W5LU24	Ralstonia_phage	43.2	1.5e-32
>prophage 4
NZ_CP007529	Salmonella enterica subsp. enterica serovar Enteritidis str. CDC_2010K_0968 isolate CDC_2010K-0968 plasmid p00, complete sequence	59369	43868	44033	59369		Salmonella_phage(100.0%)	1	NA	NA
WP_001576629.1|43868_44033_+	glycoside hydrolase family protein	NA	A0A0M4R365	Salmonella_phage	63.0	3.3e-12
>prophage 5
NZ_CP007529	Salmonella enterica subsp. enterica serovar Enteritidis str. CDC_2010K_0968 isolate CDC_2010K-0968 plasmid p00, complete sequence	59369	48975	49808	59369	transposase	Helicobacter_phage(50.0%)	2	NA	NA
WP_000064919.1|48975_49401_-|transposase	IS200/IS605 family transposase	transposase	A0A1S5RHE3	Helicobacter_phage	50.4	3.4e-24
WP_001541541.1|49457_49808_+	helix-turn-helix domain-containing protein	NA	A0A077SLN2	Escherichia_phage	80.5	1.9e-44
>prophage 6
NZ_CP007529	Salmonella enterica subsp. enterica serovar Enteritidis str. CDC_2010K_0968 isolate CDC_2010K-0968 plasmid p00, complete sequence	59369	52868	53651	59369	integrase	Macacine_betaherpesvirus(100.0%)	1	49143:49154	55851:55862
49143:49154	attL	TATTTACCATCA	NA	NA	NA	NA
WP_000082169.1|52868_53651_-|integrase	phage integrase family protein	integrase	I3WFA4	Macacine_betaherpesvirus	91.1	1.6e-51
WP_000082169.1|52868_53651_-|integrase	phage integrase family protein	integrase	I3WFA4	Macacine_betaherpesvirus	91.1	1.6e-51
55851:55862	attR	TGATGGTAAATA	NA	NA	NA	NA
>prophage 7
NZ_CP007529	Salmonella enterica subsp. enterica serovar Enteritidis str. CDC_2010K_0968 isolate CDC_2010K-0968 plasmid p00, complete sequence	59369	57490	58480	59369		Salmonella_phage(100.0%)	1	NA	NA
WP_000461382.1|57490_58480_+	RepB family plasmid replication initiator protein	NA	J9Q7H0	Salmonella_phage	59.9	5.0e-103
