The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
NC_019954	Tepidanaerobacter acetatoxydans Re1, complete genome	2761252	937832	990453	2761252	tRNA,transposase,protease	Erysipelothrix_phage(18.18%)	54	NA	NA
WP_015295119.1|937832_938315_+|tRNA	tRNA (uridine(34)/cytosine(34)/5- carboxymethylaminomethyluridine(34)-2'-O)- methyltransferase TrmL	tRNA	NA	NA	NA	NA
WP_013777964.1|938383_940432_-	methyl-accepting chemotaxis protein	NA	A0A2H4J162	uncultured_Caudovirales_phage	36.0	5.3e-14
WP_013777965.1|940792_940939_+	TRAM domain-containing protein	NA	NA	NA	NA	NA
WP_013777966.1|941086_942796_+|transposase	IS1634 family transposase	transposase	NA	NA	NA	NA
WP_013777967.1|942951_944334_+	23S rRNA (uracil(1939)-C(5))-methyltransferase RlmD	NA	A0A2K5B251	Erysipelothrix_phage	42.2	3.4e-105
WP_013777968.1|944811_945117_+	AbrB/MazE/SpoVT family DNA-binding domain-containing protein	NA	NA	NA	NA	NA
WP_013777969.1|945113_945848_+	ABC transporter ATP-binding protein	NA	W6JKT0	Anomala_cuprea_entomopoxvirus	35.4	2.2e-23
WP_013777970.1|945844_946582_+	ABC transporter permease	NA	NA	NA	NA	NA
WP_013777971.1|946705_947503_+	class I SAM-dependent methyltransferase	NA	NA	NA	NA	NA
WP_013777972.1|947590_948670_+	ribosome small subunit-dependent GTPase A	NA	NA	NA	NA	NA
WP_013777973.1|948837_949116_+	hypothetical protein	NA	NA	NA	NA	NA
WP_013777974.1|949294_950062_+	class I SAM-dependent methyltransferase	NA	NA	NA	NA	NA
WP_013777975.1|950498_950894_+	HEPN domain-containing protein	NA	NA	NA	NA	NA
WP_013777976.1|950863_951184_+	nucleotidyltransferase domain-containing protein	NA	NA	NA	NA	NA
WP_013777978.1|952266_953514_+	nucleotidyltransferase	NA	NA	NA	NA	NA
WP_013777979.1|953517_954174_+	SEC-C domain-containing protein	NA	NA	NA	NA	NA
WP_013777980.1|954188_955310_+	SAVED domain-containing protein	NA	Q858S3	Enterobacteria_phage	31.4	1.0e-06
WP_013777982.1|956475_956757_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_013777983.1|957763_960769_+	DEAD/DEAH box helicase family protein	NA	U6E9C9	Streptococcus_phage	23.1	4.7e-11
WP_013777984.1|961176_962313_+	Abi family protein	NA	NA	NA	NA	NA
WP_013777985.1|962345_963101_-	ABC transporter permease	NA	NA	NA	NA	NA
WP_013777986.1|963075_964050_-	ABC transporter ATP-binding protein	NA	W6JKT0	Anomala_cuprea_entomopoxvirus	26.8	9.8e-27
WP_013777987.1|964052_964508_-	GyrI-like domain-containing protein	NA	NA	NA	NA	NA
WP_013777988.1|964511_965375_-	AraC family transcriptional regulator	NA	D0R0F8	Streptococcus_phage	29.0	4.5e-23
WP_015295135.1|965635_966148_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_048894704.1|966249_967011_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_048894705.1|967109_967391_-	hypothetical protein	NA	NA	NA	NA	NA
WP_015295138.1|967342_968485_-	relaxase/mobilization nuclease domain-containing protein	NA	NA	NA	NA	NA
WP_144312818.1|968445_968592_-	plasmid mobilization relaxosome protein MobC	NA	NA	NA	NA	NA
WP_013777991.1|970603_971251_+	hypothetical protein	NA	NA	NA	NA	NA
WP_013777992.1|971254_971566_+	hypothetical protein	NA	NA	NA	NA	NA
WP_013777993.1|971770_972568_+|protease	CPBP family intramembrane metalloprotease	protease	NA	NA	NA	NA
WP_013777994.1|972760_973435_+	response regulator transcription factor	NA	W8CYM9	Bacillus_phage	36.4	2.6e-34
WP_013777995.1|973422_974607_+	HAMP domain-containing histidine kinase	NA	NA	NA	NA	NA
WP_013777996.1|974666_975542_+	ABC transporter ATP-binding protein	NA	A0A2H4PQG7	Staphylococcus_phage	28.9	1.4e-19
WP_013777997.1|975544_976624_+	ABC transporter permease	NA	NA	NA	NA	NA
WP_013777998.1|976620_977292_+	hypothetical protein	NA	NA	NA	NA	NA
WP_013777999.1|978190_979687_+	ABC-F type ribosomal protection protein Lsa(E)	NA	A0A2H4UUX5	Bodo_saltans_virus	26.8	1.7e-25
WP_013778000.1|979680_980175_+	nucleotidyltransferase family protein	NA	A0A2K5B286	Erysipelothrix_phage	84.8	7.8e-81
WP_015295145.1|980649_981183_+	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_013778002.1|981363_981915_+	hypothetical protein	NA	NA	NA	NA	NA
WP_013778003.1|982023_982197_+	DUF4177 domain-containing protein	NA	NA	NA	NA	NA
WP_015295146.1|982481_983249_+	hypothetical protein	NA	NA	NA	NA	NA
WP_013778004.1|983567_984152_-	accessory gene regulator B family protein	NA	NA	NA	NA	NA
WP_023211414.1|984171_984636_-	sensor histidine kinase	NA	NA	NA	NA	NA
WP_015295148.1|984632_985451_-	hypothetical protein	NA	NA	NA	NA	NA
WP_013778005.1|985466_986171_-	response regulator transcription factor	NA	NA	NA	NA	NA
WP_013778006.1|986440_986584_+	cyclic lactone autoinducer peptide	NA	NA	NA	NA	NA
WP_013778007.1|986643_987300_+	hypothetical protein	NA	NA	NA	NA	NA
WP_013778008.1|987617_988004_+	hypothetical protein	NA	NA	NA	NA	NA
WP_013778009.1|988070_988202_+	cyclic lactone autoinducer peptide	NA	NA	NA	NA	NA
WP_013778010.1|988317_989136_+	hypothetical protein	NA	NA	NA	NA	NA
WP_013778011.1|989201_989426_-	hypothetical protein	NA	NA	NA	NA	NA
WP_013778012.1|989502_990453_+|transposase	IS256 family transposase	transposase	NA	NA	NA	NA
>prophage 2
NC_019954	Tepidanaerobacter acetatoxydans Re1, complete genome	2761252	1081288	1111233	2761252	capsid,head,integrase,tail,portal,transposase,terminase	Paenibacillus_phage(10.71%)	47	1084543:1084602	1111324:1111410
WP_013778088.1|1081288_1081993_-	N-acetylmuramoyl-L-alanine amidase	NA	A0A0N9SGH1	Paenibacillus_phage	31.0	6.1e-10
WP_015295215.1|1082305_1084426_+	ribonuclease R	NA	Q0GXV6	Lactococcus_phage	38.0	1.4e-73
1084543:1084602	attL	TTTGGTAGCCATAGGGGGATTCGAACCCCCGTTACCGCCGTGAGAGGGCGGCGTCCTGAA	NA	NA	NA	NA
WP_013778090.1|1084694_1085093_-	ImmA/IrrE family metallo-endopeptidase	NA	Q0H245	Geobacillus_phage	43.8	9.3e-16
WP_144312819.1|1085409_1086294_-	DUF3644 domain-containing protein	NA	A0A0N9RUA4	Staphylococcus_phage	43.4	3.1e-56
WP_013778092.1|1086441_1086837_-	helix-turn-helix transcriptional regulator	NA	A0A139ZPJ2	Marinitoga_camini_virus	34.3	3.1e-11
WP_013778093.1|1087021_1087279_+	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_013778094.1|1087379_1087586_+	hypothetical protein	NA	NA	NA	NA	NA
WP_013778095.1|1087577_1087751_-	hypothetical protein	NA	A0A090DBW4	Clostridium_phage	44.6	8.4e-06
WP_013778096.1|1087850_1088084_+	hypothetical protein	NA	NA	NA	NA	NA
WP_013778097.1|1088076_1088232_+	hypothetical protein	NA	NA	NA	NA	NA
WP_013778098.1|1088297_1088954_+	ERF family protein	NA	A0A0M3ULL1	Bacillus_phage	40.2	1.1e-32
WP_013778099.1|1089030_1089390_+	hypothetical protein	NA	NA	NA	NA	NA
WP_013778100.1|1089390_1089768_+	hypothetical protein	NA	NA	NA	NA	NA
WP_013778101.1|1089867_1090668_+	phage replisome organizer N-terminal domain-containing protein	NA	D2JGK4	Staphylococcus_phage	60.8	3.9e-37
WP_013778102.1|1090664_1091963_+	AAA family ATPase	NA	A0A097BYG3	Leuconostoc_phage	31.0	2.7e-40
WP_013778103.1|1092007_1092232_+	hypothetical protein	NA	NA	NA	NA	NA
WP_013778104.1|1092269_1092455_+	hypothetical protein	NA	NA	NA	NA	NA
WP_013778105.1|1092484_1092658_+	hypothetical protein	NA	NA	NA	NA	NA
WP_013778106.1|1092657_1092903_+	DUF370 domain-containing protein	NA	NA	NA	NA	NA
WP_013778107.1|1092895_1093285_+	single-stranded DNA-binding protein	NA	A0A0K2CYR2	Paenibacillus_phage	64.0	6.7e-35
WP_154646181.1|1093286_1093436_+	hypothetical protein	NA	NA	NA	NA	NA
WP_013778109.1|1093563_1093920_+	hypothetical protein	NA	E5DV93	Deep-sea_thermophilic_phage	42.1	1.2e-09
WP_013778110.1|1094026_1094215_+	hypothetical protein	NA	NA	NA	NA	NA
WP_013778111.1|1094211_1094391_+	hypothetical protein	NA	NA	NA	NA	NA
WP_013778113.1|1095101_1095506_-	type II toxin-antitoxin system HicB family antitoxin	NA	A0A0C5AN56	Paenibacillus_phage	47.8	2.2e-25
WP_013778114.1|1095542_1095722_-	type II toxin-antitoxin system HicA family toxin	NA	NA	NA	NA	NA
WP_013778115.1|1095910_1096240_+	hypothetical protein	NA	NA	NA	NA	NA
WP_013778116.1|1096314_1097037_+	hypothetical protein	NA	A0A0A8WFS6	Clostridium_phage	53.9	5.7e-56
WP_013778117.1|1097026_1098280_+|terminase	PBSX family phage terminase large subunit	terminase	S6AVV7	Thermus_phage	47.4	4.9e-103
WP_013778118.1|1098293_1099736_+|portal	phage portal protein	portal	A0A0A7S074	Clostridium_phage	47.2	1.5e-116
WP_013778119.1|1099767_1101309_+|capsid	minor capsid protein	capsid	A0A1X9I626	Streptococcus_phage	33.0	1.8e-70
WP_013778120.1|1101295_1101508_+	hypothetical protein	NA	NA	NA	NA	NA
WP_013778121.1|1101571_1102306_+	hypothetical protein	NA	Q9AYX4	Lactococcus_phage	30.7	5.7e-19
WP_013778122.1|1102433_1102721_+	hypothetical protein	NA	A0A1J1JCG1	Escherichia_phage	45.4	1.8e-13
WP_013778123.1|1102832_1103399_+	phage scaffolding protein	NA	S5MUG0	Brevibacillus_phage	42.0	9.1e-25
WP_013778124.1|1103418_1104363_+	hypothetical protein	NA	A0A1V0DZW0	Clostridioides_phage	56.9	5.5e-91
WP_013778126.1|1104537_1104840_+|head,tail	phage head-tail connector protein	head,tail	A0A2H4JD74	uncultured_Caudovirales_phage	35.8	4.3e-05
WP_013778127.1|1104844_1105177_+	hypothetical protein	NA	A0A2H4J6Q5	uncultured_Caudovirales_phage	37.6	5.2e-12
WP_013778128.1|1105173_1105701_+	HK97 gp10 family phage protein	NA	A0A059NT55	Lactococcus_phage	36.0	6.1e-23
WP_013778129.1|1105700_1106054_+	hypothetical protein	NA	M1NSH7	Streptococcus_phage	39.5	7.4e-17
WP_013778130.1|1106071_1106497_+|tail	tail protein	tail	Q6SE73	Lactobacillus_prophage	31.2	4.2e-06
WP_013778131.1|1106916_1107405_+	hypothetical protein	NA	A0A290GDU0	Caldibacillus_phage	45.8	9.9e-20
WP_173391429.1|1107432_1108341_-|transposase	IS3 family transposase	transposase	A0A1P8CWQ3	Bacillus_phage	34.5	8.6e-33
WP_013778132.1|1108349_1108634_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_144312820.1|1108727_1108901_+	hypothetical protein	NA	NA	NA	NA	NA
WP_013778133.1|1108932_1109826_+	hypothetical protein	NA	NA	NA	NA	NA
WP_013778134.1|1110339_1111233_-|integrase	tyrosine-type recombinase/integrase	integrase	A0A142F1N9	Bacillus_phage	31.9	4.1e-19
1111324:1111410	attR	TTTGGTAGCCATAGGGGGATTCGAACCCCCGTTACCGCCGTGAGAGGGCGGCGTCCTGAACCCCTAGACGATATGGCCGTGGCTGCG	NA	NA	NA	NA
>prophage 3
NC_019954	Tepidanaerobacter acetatoxydans Re1, complete genome	2761252	2466860	2556934	2761252	capsid,head,integrase,protease,holin,tail,bacteriocin,portal,tRNA,transposase,terminase	Erysipelothrix_phage(20.93%)	95	2494794:2494817	2527294:2527317
WP_013779391.1|2466860_2467649_-|bacteriocin	bacteriocin family protein	bacteriocin	NA	NA	NA	NA
WP_013779392.1|2467665_2468007_-	hypothetical protein	NA	NA	NA	NA	NA
WP_081697910.1|2468528_2468687_-	hypothetical protein	NA	NA	NA	NA	NA
WP_015295890.1|2468662_2468986_-	RNA polymerase sigma factor SigV	NA	NA	NA	NA	NA
WP_015295892.1|2469797_2470763_+	ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_013779395.1|2470796_2471645_+	ABC transporter permease subunit	NA	NA	NA	NA	NA
WP_013779396.1|2471669_2472848_+	glycine betaine/L-proline ABC transporter ATP-binding protein	NA	G3M9Y6	Bacillus_virus	33.6	2.2e-28
WP_013779397.1|2473265_2474564_-	hypothetical protein	NA	NA	NA	NA	NA
WP_013779398.1|2474886_2475483_+	DUF3298 and DUF4163 domain-containing protein	NA	NA	NA	NA	NA
WP_013779399.1|2475878_2477216_-	amino acid permease	NA	NA	NA	NA	NA
WP_013779400.1|2477299_2478490_-	pyridoxal phosphate-dependent aminotransferase	NA	NA	NA	NA	NA
WP_013779401.1|2478601_2478802_-	helix-turn-helix transcriptional regulator	NA	B5LPU7	Bacillus_virus	41.7	6.3e-05
WP_013779402.1|2478997_2479309_+	helix-turn-helix transcriptional regulator	NA	S5MTZ5	Brevibacillus_phage	40.7	9.8e-13
WP_023211625.1|2479906_2481217_-	methyl-accepting chemotaxis protein	NA	A0A2H4J162	uncultured_Caudovirales_phage	68.3	9.9e-06
WP_023211628.1|2482777_2483359_-	PDC sensor domain-containing protein	NA	NA	NA	NA	NA
WP_081460128.1|2483969_2485739_-	M56 family metallopeptidase	NA	NA	NA	NA	NA
WP_015295905.1|2485741_2486299_-	Regulatory sensor-transducer, BlaR1/MecR1 family	NA	NA	NA	NA	NA
WP_015295906.1|2486327_2486717_-	BlaI/MecI/CopY family transcriptional regulator	NA	NA	NA	NA	NA
WP_013779405.1|2487676_2487904_-	hypothetical protein	NA	NA	NA	NA	NA
WP_013779407.1|2488024_2488300_-	hypothetical protein	NA	NA	NA	NA	NA
WP_015295909.1|2488402_2488711_-|head,tail	phage gp6-like head-tail connector protein	head,tail	M1PSE8	Streptococcus_phage	45.8	2.9e-09
WP_013779409.1|2489224_2489557_-	type II toxin-antitoxin system RelE/ParE family toxin	NA	NA	NA	NA	NA
WP_013779410.1|2489546_2489858_-	type II toxin-antitoxin system RelB/DinJ family antitoxin	NA	NA	NA	NA	NA
WP_013779411.1|2490526_2492104_+	copper amine oxidase N-terminal domain-containing protein	NA	NA	NA	NA	NA
WP_023211631.1|2492372_2492621_-	hypothetical protein	NA	NA	NA	NA	NA
WP_013779412.1|2493361_2493730_+	AbrB/MazE/SpoVT family DNA-binding domain-containing protein	NA	NA	NA	NA	NA
WP_013779413.1|2493732_2494023_+	type II toxin-antitoxin system RelE/ParE family toxin	NA	NA	NA	NA	NA
WP_013779414.1|2494286_2494565_+	type II toxin-antitoxin system RelB/DinJ family antitoxin	NA	NA	NA	NA	NA
WP_013779415.1|2494657_2495038_-	HNH endonuclease	NA	M1PLL8	Streptococcus_phage	46.1	6.1e-25
2494794:2494817	attL	ATATGGTCCACCACTGTTGCCGGG	NA	NA	NA	NA
WP_048894750.1|2495619_2497338_+|transposase	IS1634 family transposase	transposase	NA	NA	NA	NA
WP_013779416.1|2497844_2498402_-	type II toxin-antitoxin system PemK/MazF family toxin	NA	NA	NA	NA	NA
WP_013779417.1|2498566_2498749_-	hypothetical protein	NA	NA	NA	NA	NA
WP_023211634.1|2498860_2499124_-	DUF1492 domain-containing protein	NA	NA	NA	NA	NA
WP_013779418.1|2499234_2499465_-	type II toxin-antitoxin system MqsA family antitoxin	NA	NA	NA	NA	NA
WP_013779419.1|2499470_2499785_-	DUF4258 domain-containing protein	NA	NA	NA	NA	NA
WP_013779420.1|2500102_2501971_-	Ig-like domain-containing protein	NA	NA	NA	NA	NA
WP_013779421.1|2502332_2503385_-|transposase	Rpn family recombination-promoting nuclease/putative transposase	transposase	NA	NA	NA	NA
WP_013779422.1|2503461_2504205_-	hypothetical protein	NA	NA	NA	NA	NA
WP_013779423.1|2504216_2505074_-|integrase	tyrosine-type recombinase/integrase	integrase	S5M9V8	Brevibacillus_phage	25.0	5.8e-15
WP_013779424.1|2505213_2505876_-	N-acetylmuramoyl-L-alanine amidase	NA	A0A0N9SGH1	Paenibacillus_phage	43.0	3.0e-27
WP_013779425.1|2505868_2506279_-|holin	phage holin family protein	holin	A0A2K5B2A2	Erysipelothrix_phage	58.5	5.2e-38
WP_013779426.1|2506312_2507410_-	siphovirus ReqiPepy6 Gp37-like family protein	NA	A0A0K2CZQ1	Paenibacillus_phage	42.6	4.1e-82
WP_013779427.1|2507426_2507558_-	XkdX family protein	NA	NA	NA	NA	NA
WP_013779428.1|2507559_2507937_-	hypothetical protein	NA	NA	NA	NA	NA
WP_013779429.1|2507951_2509028_-	hypothetical protein	NA	NA	NA	NA	NA
WP_013779430.1|2509027_2509975_-	hypothetical protein	NA	A0A2I7SC02	Paenibacillus_phage	56.3	4.1e-62
WP_013779431.1|2509989_2510841_-|tail	phage tail family protein	tail	A0A0K2CZA8	Paenibacillus_phage	45.7	1.8e-64
WP_013779432.1|2510851_2513164_-|tail	phage tail tape measure protein	tail	A0A1J0MFP9	Staphylococcus_phage	53.6	1.3e-40
WP_013779433.1|2513344_2514304_-	DUF2726 domain-containing protein	NA	Q4Z8X8	Staphylococcus_phage	35.4	1.8e-49
WP_013779434.1|2514382_2515399_-|tail	phage tail tape measure protein	tail	A0A2H4J669	uncultured_Caudovirales_phage	46.1	2.0e-54
WP_013779435.1|2515446_2515602_-	hypothetical protein	NA	NA	NA	NA	NA
WP_013779436.1|2515613_2515913_-	hypothetical protein	NA	H0USX2	Bacillus_phage	32.6	6.3e-09
WP_013779437.1|2515930_2516503_-|tail	tail protein	tail	E2ELJ1	Clostridium_phage	44.6	6.4e-34
WP_013779438.1|2516504_2516831_-	hypothetical protein	NA	A0A2I7SC10	Paenibacillus_phage	39.8	1.4e-17
WP_013779439.1|2516827_2517199_-	HK97 gp10 family phage protein	NA	H0USW9	Bacillus_phage	40.8	4.7e-14
WP_013779440.1|2517191_2517518_-|head	phage head closure protein	head	A0A0A7RUH8	Clostridium_phage	52.8	2.9e-23
WP_013779441.1|2517514_2517802_-|head,tail	phage gp6-like head-tail connector protein	head,tail	A6M953	Geobacillus_virus	56.7	1.0e-24
WP_013779442.1|2517845_2519027_-|capsid	phage major capsid protein	capsid	A0A2I7SBY4	Paenibacillus_phage	57.2	2.5e-101
WP_013779443.1|2519062_2519752_-|protease	Clp protease ClpP	protease	A0A0K2CYC6	Paenibacillus_phage	51.4	1.9e-56
WP_013779444.1|2519741_2520998_-|portal	phage portal protein	portal	Q2I8F9	Bacillus_phage	55.6	4.0e-137
WP_013779445.1|2521009_2522575_-|terminase	terminase large subunit	terminase	A0A2K5B285	Erysipelothrix_phage	74.4	1.2e-228
WP_013779446.1|2522574_2523048_-|terminase	phage terminase small subunit P27 family	terminase	Q6DMU4	Streptococcus_phage	72.7	8.1e-59
WP_013779447.1|2523087_2523381_-	hypothetical protein	NA	NA	NA	NA	NA
WP_015295921.1|2523598_2523787_-	hypothetical protein	NA	A0A127AWS3	Bacillus_phage	60.7	1.6e-10
WP_013779448.1|2523779_2524541_-	hypothetical protein	NA	A0A2K5B280	Erysipelothrix_phage	32.3	1.9e-17
WP_013779449.1|2524627_2524927_-	hypothetical protein	NA	A0A2K5B282	Erysipelothrix_phage	59.4	3.3e-26
WP_041591602.1|2525036_2526269_-	DNA modification methylase	NA	A0A2I4R670	Erysipelothrix_phage	60.6	2.8e-143
WP_013779451.1|2526571_2526850_+	type II toxin-antitoxin system RelB/DinJ family antitoxin	NA	NA	NA	NA	NA
WP_013779452.1|2526846_2527122_+	type II toxin-antitoxin system YafQ family toxin	NA	NA	NA	NA	NA
WP_013779453.1|2527151_2527538_-	HNH endonuclease	NA	Q38456	Bacillus_phage	51.7	1.6e-25
2527294:2527317	attR	ATATGGTCCACCACTGTTGCCGGG	NA	NA	NA	NA
WP_013779454.1|2527500_2527737_-	hypothetical protein	NA	NA	NA	NA	NA
WP_013779455.1|2527982_2528414_-	DUF1492 domain-containing protein	NA	NA	NA	NA	NA
WP_013779456.1|2528403_2528619_-	hypothetical protein	NA	NA	NA	NA	NA
WP_013779457.1|2528621_2529977_-	DEAD/DEAH box helicase	NA	S5MA26	Brevibacillus_phage	60.8	1.7e-162
WP_013779458.1|2529973_2530252_-	VRR-NUC domain-containing protein	NA	A0A2K5B272	Erysipelothrix_phage	61.1	2.5e-23
WP_013779459.1|2530536_2532942_-	virulence-associated E family protein	NA	A0A1S7FZ15	Listeria_phage	51.2	1.7e-237
WP_013779460.1|2532925_2533480_-	DUF3310 domain-containing protein	NA	A0A2K9V2W4	Faecalibacterium_phage	52.5	1.9e-22
WP_013779461.1|2533495_2534164_-	Rha family transcriptional regulator	NA	A0A2K5B268	Erysipelothrix_phage	71.4	8.1e-89
WP_013779462.1|2534163_2534358_-	hypothetical protein	NA	A0A2K5B269	Erysipelothrix_phage	59.3	3.8e-15
WP_013779463.1|2534373_2536332_-	DNA polymerase	NA	S5M5X4	Brevibacillus_phage	63.3	1.6e-238
WP_013779464.1|2536331_2536865_-	DUF2815 family protein	NA	A0A0A7RVM4	Clostridium_phage	67.0	2.1e-63
WP_013779466.1|2538024_2538306_-	hypothetical protein	NA	A0A2K5B2A7	Erysipelothrix_phage	46.1	4.4e-12
WP_013779467.1|2538320_2538572_-	hypothetical protein	NA	NA	NA	NA	NA
WP_013779468.1|2538590_2538914_-	HTH domain-containing protein	NA	NA	NA	NA	NA
WP_013779469.1|2539367_2540090_-	ImmA/IrrE family metallo-endopeptidase	NA	E4ZFJ9	Streptococcus_phage	35.3	7.3e-27
WP_013779470.1|2540104_2540473_-	hypothetical protein	NA	NA	NA	NA	NA
WP_013779471.1|2540476_2540863_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_013779472.1|2540877_2541669_-	ImmA/IrrE family metallo-endopeptidase	NA	NA	NA	NA	NA
WP_013779473.1|2541904_2544163_-	Ig-like domain-containing protein	NA	NA	NA	NA	NA
WP_013779474.1|2544246_2547246_-	S-layer homology domain-containing protein	NA	NA	NA	NA	NA
WP_013779475.1|2550092_2551175_-	peptidoglycan bridge formation glycyltransferase FemA/FemB family protein	NA	NA	NA	NA	NA
WP_013779476.1|2551305_2552562_-	methyl-accepting chemotaxis protein	NA	A0A2H4J162	uncultured_Caudovirales_phage	43.1	1.0e-12
WP_013779477.1|2552625_2554233_-	CTP synthase	NA	A0A1J0FA14	Only_Syngen_Nebraska_virus	52.4	8.3e-156
WP_013779478.1|2554432_2555071_-	MBL fold metallo-hydrolase	NA	NA	NA	NA	NA
WP_013779479.1|2555224_2556934_-|tRNA	arginine--tRNA ligase	tRNA	NA	NA	NA	NA
