The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
NC_019673	Saccharothrix espanaensis DSM 44229, complete genome	9360653	1398681	1444316	9360653	transposase,integrase,protease	Agrobacterium_phage(25.0%)	43	1427736:1427768	1437410:1437442
WP_015098773.1|1398681_1399686_-|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	33.5	3.3e-33
WP_015098774.1|1399983_1401249_-|transposase	IS4 family transposase	transposase	NA	NA	NA	NA
WP_148303248.1|1401811_1402603_-	mechanosensitive ion channel	NA	NA	NA	NA	NA
WP_041312154.1|1402725_1404975_-	S9 family peptidase	NA	NA	NA	NA	NA
WP_015098777.1|1405094_1405760_+	HNH endonuclease	NA	H6WG01	Cyanophage	35.5	8.0e-20
WP_015098778.1|1405761_1406442_-	DUF2345 domain-containing protein	NA	NA	NA	NA	NA
WP_015098779.1|1406706_1407909_+	MFS transporter	NA	NA	NA	NA	NA
WP_015098780.1|1407936_1408182_+	hypothetical protein	NA	NA	NA	NA	NA
WP_015098781.1|1408168_1408645_+	DUF5130 family protein	NA	NA	NA	NA	NA
WP_015098782.1|1408867_1411429_-	aminopeptidase N	NA	A0A0P0IY26	Acinetobacter_phage	29.8	1.3e-49
WP_015098783.1|1411649_1412252_+	DsbA family protein	NA	NA	NA	NA	NA
WP_015098784.1|1412334_1413690_+	aldehyde dehydrogenase family protein	NA	NA	NA	NA	NA
WP_015098785.1|1414028_1416425_+	LuxR family transcriptional regulator	NA	NA	NA	NA	NA
WP_041312160.1|1416536_1417250_-	2-phosphosulfolactate phosphatase	NA	NA	NA	NA	NA
WP_015098787.1|1417260_1417746_+	ribose-5-phosphate isomerase	NA	NA	NA	NA	NA
WP_015098788.1|1417745_1418402_+	hypothetical protein	NA	NA	NA	NA	NA
WP_015098789.1|1418394_1419198_+	Fpg/Nei family DNA glycosylase	NA	A0A1V0CNR6	Kaumoebavirus	25.9	2.6e-09
WP_015098790.1|1419391_1419883_+	YbaB/EbfC family nucleoid-associated protein	NA	NA	NA	NA	NA
WP_015098791.1|1419892_1420201_+	hypothetical protein	NA	NA	NA	NA	NA
WP_015098792.1|1420197_1421922_+	hypothetical protein	NA	NA	NA	NA	NA
WP_015098793.1|1421896_1422535_+	pentapeptide repeat-containing protein	NA	NA	NA	NA	NA
WP_015098794.1|1422602_1423376_-	hypothetical protein	NA	NA	NA	NA	NA
WP_041312163.1|1423451_1424660_-	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_015098796.1|1424931_1425270_-	histidine triad nucleotide-binding protein	NA	NA	NA	NA	NA
WP_015098798.1|1425568_1425919_-	VOC family protein	NA	NA	NA	NA	NA
WP_148302760.1|1426044_1426326_-	PLDc N-terminal domain-containing protein	NA	NA	NA	NA	NA
WP_015098800.1|1426455_1427088_+	hypothetical protein	NA	NA	NA	NA	NA
WP_041312168.1|1427110_1427581_-	NUDIX domain-containing protein	NA	NA	NA	NA	NA
1427736:1427768	attL	CGGGAATCGAACCCGCATGACCAGCTTGGAAGG	NA	NA	NA	NA
WP_015098803.1|1428895_1430104_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_015098804.1|1430242_1430479_+	hypothetical protein	NA	NA	NA	NA	NA
WP_015098805.1|1430628_1431012_-	winged helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_015098806.1|1431159_1431582_+	hypothetical protein	NA	NA	NA	NA	NA
WP_015098807.1|1431584_1431935_+	hypothetical protein	NA	NA	NA	NA	NA
WP_015098808.1|1431931_1432303_+	hypothetical protein	NA	NA	NA	NA	NA
WP_015098810.1|1432753_1434238_+	cell division protein FtsK	NA	NA	NA	NA	NA
WP_041312171.1|1434324_1435938_+	hypothetical protein	NA	NA	NA	NA	NA
WP_015098812.1|1435952_1436174_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_015098813.1|1436170_1437409_+|integrase	tyrosine-type recombinase/integrase	integrase	A0A249XVB5	Mycobacterium_phage	33.6	6.4e-47
WP_015098814.1|1437857_1438763_-	LysR family transcriptional regulator	NA	NA	NA	NA	NA
1437410:1437442	attR	CGGGAATCGAACCCGCATGACCAGCTTGGAAGG	NA	NA	NA	NA
WP_015098816.1|1440082_1441441_+	trigger factor	NA	NA	NA	NA	NA
WP_015098817.1|1441593_1442172_+|protease	ATP-dependent Clp protease proteolytic subunit	protease	A0A223W000	Agrobacterium_phage	50.0	2.4e-41
WP_015098818.1|1442201_1442828_+|protease	ATP-dependent Clp protease proteolytic subunit	protease	A0A223W000	Agrobacterium_phage	43.8	4.7e-38
WP_015098819.1|1443035_1444316_+|protease	ATP-dependent Clp protease ATP-binding subunit ClpX	protease	G3M9Z9	Bacillus_virus	59.7	2.4e-142
>prophage 2
NC_019673	Saccharothrix espanaensis DSM 44229, complete genome	9360653	2079011	2214152	9360653	transposase,integrase	Gordonia_phage(23.08%)	89	2096667:2096712	2143899:2143944
WP_041312465.1|2079011_2079578_+|transposase	transposase family protein	transposase	A9YX10	Burkholderia_phage	29.9	1.5e-06
WP_148302797.1|2082531_2083161_-	hypothetical protein	NA	NA	NA	NA	NA
WP_148302798.1|2083173_2083902_+	BBE domain-containing protein	NA	NA	NA	NA	NA
WP_015099449.1|2085059_2087294_+	CRISPR-associated helicase/endonuclease Cas3	NA	NA	NA	NA	NA
WP_015099450.1|2087290_2088007_+	type I-C CRISPR-associated protein Cas5	NA	NA	NA	NA	NA
WP_015099451.1|2088011_2089934_+	type I-C CRISPR-associated protein Cas8c/Csd1	NA	NA	NA	NA	NA
WP_015099452.1|2089951_2090824_+	type I-C CRISPR-associated protein Cas7/Csd2	NA	NA	NA	NA	NA
WP_015099453.1|2091139_2091430_+	CRISPR-associated endonuclease Cas2	NA	NA	NA	NA	NA
WP_051075959.1|2092149_2093052_+|integrase	tyrosine-type recombinase/integrase	integrase	A0A2H4JAA2	uncultured_Caudovirales_phage	23.9	1.6e-07
WP_041316419.1|2093083_2093332_+	hypothetical protein	NA	NA	NA	NA	NA
WP_015099457.1|2093374_2095258_-	hypothetical protein	NA	NA	NA	NA	NA
2096667:2096712	attL	CTGGGGGTCAAGGGGTCGCAGGTTCAAATCCTGTCGTCCCGACGGC	NA	NA	NA	NA
WP_158509358.1|2096763_2097975_-|integrase	tyrosine-type recombinase/integrase	integrase	A0A2R2ZGM9	Clostridioides_phage	26.2	1.4e-25
WP_158509359.1|2098264_2098414_+	hypothetical protein	NA	NA	NA	NA	NA
WP_015099459.1|2098888_2099392_+	YcxB family protein	NA	NA	NA	NA	NA
WP_015099461.1|2099730_2100624_-|integrase	tyrosine-type recombinase/integrase	integrase	A0A2K9VH72	Gordonia_phage	37.9	1.4e-43
WP_148302800.1|2100890_2102597_-	TIR domain-containing protein	NA	NA	NA	NA	NA
WP_084672882.1|2103287_2104211_-	amidohydrolase family protein	NA	NA	NA	NA	NA
WP_015099465.1|2104509_2105784_+|transposase	IS4 family transposase	transposase	NA	NA	NA	NA
WP_051075490.1|2106205_2106397_+	hypothetical protein	NA	NA	NA	NA	NA
WP_015099467.1|2106558_2107389_+	ALF repeat-containing protein	NA	NA	NA	NA	NA
WP_015099468.1|2107452_2109879_+	ALF repeat-containing protein	NA	NA	NA	NA	NA
WP_015099469.1|2109909_2110158_+	hypothetical protein	NA	NA	NA	NA	NA
WP_015099470.1|2110317_2111112_+	hypothetical protein	NA	NA	NA	NA	NA
WP_015099471.1|2111211_2111619_+	hypothetical protein	NA	NA	NA	NA	NA
WP_158509360.1|2112311_2113703_+	SIR2 family protein	NA	NA	NA	NA	NA
WP_015099474.1|2113677_2114070_+	hypothetical protein	NA	NA	NA	NA	NA
WP_084672883.1|2115165_2115807_-	hypothetical protein	NA	NA	NA	NA	NA
WP_148302801.1|2116471_2117332_-	hypothetical protein	NA	NA	NA	NA	NA
WP_084672607.1|2117501_2119442_-	SAVED domain-containing protein	NA	NA	NA	NA	NA
WP_015099480.1|2119438_2121007_-	ThiF family adenylyltransferase	NA	NA	NA	NA	NA
WP_015099481.1|2121015_2122113_-	nucleotidyltransferase	NA	NA	NA	NA	NA
WP_158509361.1|2122298_2123528_-	SAVED domain-containing protein	NA	NA	NA	NA	NA
WP_015099485.1|2124569_2126723_-	XRE family transcriptional regulator	NA	NA	NA	NA	NA
WP_015099486.1|2127034_2127961_+	toll/interleukin-1 receptor domain-containing protein	NA	NA	NA	NA	NA
WP_015099487.1|2127994_2131078_-	DEAD/DEAH box helicase	NA	NA	NA	NA	NA
WP_015099488.1|2131154_2132780_+	PD-(D/E)XK nuclease family protein	NA	NA	NA	NA	NA
WP_015099489.1|2132776_2133928_+	hypothetical protein	NA	NA	NA	NA	NA
WP_041316429.1|2133957_2137203_+	hypothetical protein	NA	NA	NA	NA	NA
WP_015099491.1|2137196_2139689_+	DUF3962 domain-containing protein	NA	NA	NA	NA	NA
WP_015099492.1|2139698_2140916_-|transposase	IS110 family transposase	transposase	NA	NA	NA	NA
WP_158509362.1|2141167_2142430_-	TIR domain-containing protein	NA	NA	NA	NA	NA
WP_015099494.1|2142682_2143450_+|transposase	IS5/IS1182 family transposase	transposase	NA	NA	NA	NA
WP_158509363.1|2144593_2145175_+	hypothetical protein	NA	NA	NA	NA	NA
2143899:2143944	attR	CTGGGGGTCAAGGGGTCGCAGGTTCAAATCCTGTCGTCCCGACGGC	NA	NA	NA	NA
WP_015099496.1|2145592_2149732_-	SIR2 family protein	NA	A0A076FHE1	Aureococcus_anophage	22.9	5.0e-11
WP_158509364.1|2150053_2150206_+	hypothetical protein	NA	NA	NA	NA	NA
WP_015099498.1|2150239_2150533_+	hypothetical protein	NA	NA	NA	NA	NA
WP_158509365.1|2150813_2152724_-	hypothetical protein	NA	NA	NA	NA	NA
WP_015099500.1|2152819_2153560_+	NUDIX hydrolase	NA	A0A0E3JJF3	Streptomyces_phage	44.3	1.5e-19
WP_085983591.1|2153703_2154324_+	NUDIX hydrolase	NA	A0A0E3JJF3	Streptomyces_phage	45.3	1.4e-15
WP_015099502.1|2154466_2155672_+	OmpA family protein	NA	NA	NA	NA	NA
WP_148302803.1|2155878_2157138_+	hypothetical protein	NA	NA	NA	NA	NA
WP_015099504.1|2157137_2157902_+	hypothetical protein	NA	NA	NA	NA	NA
WP_015099505.1|2157927_2159670_+	hypothetical protein	NA	NA	NA	NA	NA
WP_015099506.1|2159787_2160015_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_015099509.1|2162138_2162690_+	sigma-70 family RNA polymerase sigma factor	NA	NA	NA	NA	NA
WP_015099511.1|2164677_2165475_+	hypothetical protein	NA	NA	NA	NA	NA
WP_015099512.1|2165491_2169949_+	hypothetical protein	NA	NA	NA	NA	NA
WP_148303269.1|2170103_2171066_+	hypothetical protein	NA	NA	NA	NA	NA
WP_015099514.1|2171320_2171854_+	hypothetical protein	NA	NA	NA	NA	NA
WP_041312498.1|2171836_2172301_-	hypothetical protein	NA	A0A1D8EQ99	Mycobacterium_phage	41.9	6.4e-08
WP_015099516.1|2172585_2173287_+	7-cyano-7-deazaguanine synthase QueC	NA	A0A2I2L6M4	Escherichia_phage	35.8	8.4e-28
WP_015099517.1|2173283_2173919_+	7-carboxy-7-deazaguanine synthase	NA	NA	NA	NA	NA
WP_015099518.1|2173918_2174275_+	6-carboxytetrahydropterin synthase QueD	NA	NA	NA	NA	NA
WP_084672613.1|2174363_2175734_-	HNH endonuclease	NA	NA	NA	NA	NA
WP_015099520.1|2175790_2176123_+	hypothetical protein	NA	NA	NA	NA	NA
WP_041312502.1|2176234_2177629_+	hypothetical protein	NA	NA	NA	NA	NA
WP_015098774.1|2178380_2179646_-|transposase	IS4 family transposase	transposase	NA	NA	NA	NA
WP_148302805.1|2180901_2181147_+	hypothetical protein	NA	NA	NA	NA	NA
WP_148302807.1|2181540_2181657_-	hypothetical protein	NA	NA	NA	NA	NA
WP_015099524.1|2181707_2182289_-	hypothetical protein	NA	NA	NA	NA	NA
WP_148302808.1|2182380_2183280_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_015099527.1|2183770_2184286_+	hypothetical protein	NA	NA	NA	NA	NA
WP_148302809.1|2184818_2187200_+	tetratricopeptide repeat protein	NA	NA	NA	NA	NA
WP_015099529.1|2187578_2188907_+	hypothetical protein	NA	NA	NA	NA	NA
WP_084672615.1|2189273_2189501_+	hypothetical protein	NA	NA	NA	NA	NA
WP_051075493.1|2190022_2190562_-	hypothetical protein	NA	NA	NA	NA	NA
WP_015099533.1|2190851_2191538_+	response regulator transcription factor	NA	W8CYM9	Bacillus_phage	30.0	1.3e-25
WP_015099534.1|2191582_2193079_+	HAMP domain-containing histidine kinase	NA	NA	NA	NA	NA
WP_051075495.1|2193078_2194503_+	HAMP domain-containing histidine kinase	NA	NA	NA	NA	NA
WP_148302810.1|2194874_2200259_-	hypothetical protein	NA	NA	NA	NA	NA
WP_158509366.1|2200629_2206896_+	type IV secretion protein Rhs	NA	NA	NA	NA	NA
WP_041312514.1|2206892_2207186_+	hypothetical protein	NA	NA	NA	NA	NA
WP_041312516.1|2208298_2208661_-	hypothetical protein	NA	NA	NA	NA	NA
WP_158509367.1|2208707_2210216_+	hypothetical protein	NA	NA	NA	NA	NA
WP_148302812.1|2210455_2210803_+	hypothetical protein	NA	NA	NA	NA	NA
WP_015099543.1|2211357_2211669_+|transposase	transposase	transposase	A0A1B3AZF8	Gordonia_phage	50.9	2.9e-17
WP_015099544.1|2211665_2212025_+|transposase	IS3 family transposase	transposase	A0A1P8CWQ3	Bacillus_phage	41.9	6.4e-08
WP_015099545.1|2211973_2212570_+|transposase	IS3 family transposase	transposase	A0A1B3AZE5	Gordonia_phage	45.3	1.6e-27
WP_041316446.1|2212472_2214152_-|transposase	IS1182 family transposase	transposase	NA	NA	NA	NA
>prophage 3
NC_019673	Saccharothrix espanaensis DSM 44229, complete genome	9360653	3576426	3671932	9360653	transposase	Paenibacillus_phage(22.22%)	59	NA	NA
WP_015100737.1|3576426_3576732_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_015100739.1|3578441_3579398_+|transposase	IS3 family transposase	transposase	A0A1P8CWQ3	Bacillus_phage	34.2	5.5e-30
WP_158509387.1|3579419_3579587_-	hypothetical protein	NA	NA	NA	NA	NA
WP_015100740.1|3579692_3580067_+	hypothetical protein	NA	NA	NA	NA	NA
WP_015100741.1|3580072_3581794_-	amidase domain-containing protein	NA	NA	NA	NA	NA
WP_148302897.1|3582057_3588222_+	DNRLRE domain-containing protein	NA	NA	NA	NA	NA
WP_041312927.1|3588218_3588662_+	hypothetical protein	NA	NA	NA	NA	NA
WP_041316446.1|3589277_3590957_+|transposase	IS1182 family transposase	transposase	NA	NA	NA	NA
WP_015100746.1|3590859_3591459_-|transposase	IS3 family transposase	transposase	Q8W6R2	Burkholderia_virus	52.7	1.8e-34
WP_015100747.1|3591508_3592075_-|transposase	transposase	transposase	A0A1B3AZF8	Gordonia_phage	54.0	1.6e-16
WP_041312929.1|3593444_3594014_+	hypothetical protein	NA	NA	NA	NA	NA
WP_158509388.1|3594449_3594749_+	hypothetical protein	NA	NA	NA	NA	NA
WP_158509389.1|3595163_3595319_+	hypothetical protein	NA	NA	NA	NA	NA
WP_041312933.1|3595867_3596065_-	hypothetical protein	NA	NA	NA	NA	NA
WP_015100754.1|3596774_3597140_-	response regulator transcription factor	NA	NA	NA	NA	NA
WP_158509390.1|3598022_3599414_-	DUF1298 domain-containing protein	NA	NA	NA	NA	NA
WP_015100756.1|3600125_3600377_+	hypothetical protein	NA	NA	NA	NA	NA
WP_041312937.1|3600425_3600635_+	hypothetical protein	NA	NA	NA	NA	NA
WP_158509391.1|3600842_3602276_+	AarF/ABC1/UbiB kinase family protein	NA	G8DDN0	Micromonas_pusilla_virus	25.3	9.7e-23
WP_015100759.1|3602342_3602588_+	hypothetical protein	NA	NA	NA	NA	NA
WP_015100760.1|3602615_3603890_+	beta-ketoacyl-[acyl-carrier-protein] synthase family protein	NA	NA	NA	NA	NA
WP_015100761.1|3603883_3604876_+	acyltransferase domain-containing protein	NA	NA	NA	NA	NA
WP_015100762.1|3605015_3606311_+	putative 4-hydroxy-3-methylbut-2-enyl diphosphate reductase	NA	NA	NA	NA	NA
WP_015100763.1|3606288_3607605_-	hypothetical protein	NA	NA	NA	NA	NA
WP_015100765.1|3607957_3614350_+	type I polyketide synthase	NA	D0R7J2	Paenibacillus_phage	34.6	1.2e-27
WP_051075595.1|3614678_3616121_+	FAD-dependent monooxygenase	NA	NA	NA	NA	NA
WP_015100767.1|3616101_3617007_+	NAD(P)-dependent oxidoreductase	NA	NA	NA	NA	NA
WP_015100768.1|3617065_3617515_+	ester cyclase	NA	NA	NA	NA	NA
WP_015100769.1|3617711_3618974_-	FAD-dependent oxidoreductase	NA	NA	NA	NA	NA
WP_015100770.1|3619127_3620381_-	cytochrome P450	NA	NA	NA	NA	NA
WP_015100771.1|3620925_3622173_-	alpha/beta hydrolase	NA	A0A068F2G2	Mycobacterium_phage	26.5	3.8e-07
WP_158509392.1|3623401_3623545_-	hypothetical protein	NA	NA	NA	NA	NA
WP_015100773.1|3623662_3625021_-	hypothetical protein	NA	NA	NA	NA	NA
WP_015100774.1|3626340_3626880_+	response regulator transcription factor	NA	NA	NA	NA	NA
WP_084672673.1|3627482_3629120_+	PfaD family polyunsaturated fatty acid/polyketide biosynthesis protein	NA	NA	NA	NA	NA
WP_015100776.1|3629150_3635033_+	type I polyketide synthase	NA	D0R7J2	Paenibacillus_phage	30.4	2.7e-10
WP_015100778.1|3635430_3636978_+	GMC family oxidoreductase	NA	NA	NA	NA	NA
WP_158509393.1|3637518_3638736_-	alpha/beta fold hydrolase	NA	NA	NA	NA	NA
WP_015100780.1|3639040_3639949_-	alpha/beta hydrolase	NA	R4JP33	Mycobacterium_phage	34.2	3.3e-08
WP_015100782.1|3641694_3642705_+	beta-ketoacyl synthase	NA	NA	NA	NA	NA
WP_015100783.1|3642698_3649961_+	type I polyketide synthase	NA	NA	NA	NA	NA
WP_015100786.1|3650573_3651122_+	putative beta-ketoacyl synthase III	NA	NA	NA	NA	NA
WP_015100788.1|3652792_3653383_-	TetR/AcrR family transcriptional regulator	NA	NA	NA	NA	NA
WP_084672676.1|3653461_3654457_+	class I SAM-dependent methyltransferase	NA	NA	NA	NA	NA
WP_015100791.1|3655056_3656712_+	hypothetical protein	NA	NA	NA	NA	NA
WP_015100792.1|3656746_3657220_-	hypothetical protein	NA	NA	NA	NA	NA
WP_015100794.1|3658045_3658441_-	pa-i galactophilic lectin-like protein	NA	NA	NA	NA	NA
WP_015100795.1|3658617_3658818_+	hypothetical protein	NA	NA	NA	NA	NA
WP_158509394.1|3659376_3661971_-	tetratricopeptide repeat protein	NA	NA	NA	NA	NA
WP_015100797.1|3662298_3662571_+	hypothetical protein	NA	NA	NA	NA	NA
WP_051075599.1|3662806_3663067_+	ImmA/IrrE family metallo-endopeptidase	NA	NA	NA	NA	NA
WP_085983603.1|3663428_3665006_-	methyltransferase domain-containing protein	NA	A0A1J0MC50	Streptomyces_phage	45.0	3.3e-72
WP_015100800.1|3664902_3665259_+	hypothetical protein	NA	NA	NA	NA	NA
WP_085983505.1|3665174_3665690_+	hypothetical protein	NA	NA	NA	NA	NA
WP_051075601.1|3666012_3666714_+	pentapeptide repeat-containing protein	NA	NA	NA	NA	NA
WP_158509395.1|3667068_3667233_-	hypothetical protein	NA	NA	NA	NA	NA
WP_148302899.1|3667407_3667794_-	hypothetical protein	NA	NA	NA	NA	NA
WP_015100803.1|3668918_3670253_-	DUF11 domain-containing protein	NA	NA	NA	NA	NA
WP_041312955.1|3671239_3671932_-|transposase	transposase family protein	transposase	NA	NA	NA	NA
>prophage 4
NC_019673	Saccharothrix espanaensis DSM 44229, complete genome	9360653	5794494	5816548	9360653	tail,transposase,plate	Burkholderia_phage(50.0%)	17	NA	NA
WP_015102563.1|5794494_5794752_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_015102564.1|5794880_5798084_-	winged helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_015102566.1|5799182_5802578_+	AAA family ATPase	NA	NA	NA	NA	NA
WP_015102567.1|5802772_5803396_-	response regulator transcription factor	NA	NA	NA	NA	NA
WP_015102568.1|5803590_5804766_-	zinc ribbon domain-containing protein	NA	NA	NA	NA	NA
WP_015102569.1|5804762_5805308_-|tail	phage tail protein I	tail	NA	NA	NA	NA
WP_015102570.1|5805304_5807242_-|plate	putative baseplate assembly protein	plate	NA	NA	NA	NA
WP_173430538.1|5807241_5807583_-	GPW/gp25 family protein	NA	Q6QIA0	Burkholderia_phage	45.7	1.5e-06
WP_015102572.1|5807648_5807966_-	PAAR domain-containing protein	NA	NA	NA	NA	NA
WP_015102573.1|5808007_5809675_-	VgrG-related protein	NA	NA	NA	NA	NA
WP_051076035.1|5809671_5810385_-	LysM peptidoglycan-binding domain-containing protein	NA	NA	NA	NA	NA
WP_015102575.1|5810452_5810878_-|tail	phage tail protein	tail	NA	NA	NA	NA
WP_148303006.1|5810935_5811367_-	hypothetical protein	NA	NA	NA	NA	NA
WP_015102577.1|5813920_5814079_-	hypothetical protein	NA	NA	NA	NA	NA
WP_015102578.1|5814075_5814537_-	hypothetical protein	NA	NA	NA	NA	NA
WP_015102579.1|5814533_5814974_-|tail	phage tail protein	tail	NA	NA	NA	NA
WP_015102580.1|5815018_5816548_-|tail	phage tail sheath family protein	tail	J9PVC2	Bacillus_phage	33.9	9.6e-69
>prophage 5
NC_019673	Saccharothrix espanaensis DSM 44229, complete genome	9360653	6367184	6399610	9360653	transposase	Burkholderia_virus(28.57%)	21	NA	NA
WP_015103060.1|6367184_6368102_-|transposase	IS3 family transposase	transposase	Q8W6R2	Burkholderia_virus	42.3	1.9e-48
WP_015103061.1|6368098_6368410_-|transposase	transposase	transposase	A0A1B3AZF8	Gordonia_phage	51.9	2.9e-17
WP_148303037.1|6368571_6369630_-	hypothetical protein	NA	NA	NA	NA	NA
WP_041314235.1|6369695_6370043_-	hypothetical protein	NA	NA	NA	NA	NA
WP_015103064.1|6370654_6370918_-	hypothetical protein	NA	NA	NA	NA	NA
WP_041318322.1|6370918_6371233_-	hypothetical protein	NA	NA	NA	NA	NA
WP_148303039.1|6375348_6378567_-	hypothetical protein	NA	NA	NA	NA	NA
WP_148303040.1|6378713_6379037_-	hypothetical protein	NA	NA	NA	NA	NA
WP_015103075.1|6379172_6382871_-	hypothetical protein	NA	NA	NA	NA	NA
WP_148303041.1|6383780_6384266_+	DUF2690 domain-containing protein	NA	NA	NA	NA	NA
WP_015103078.1|6384331_6388255_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_015103079.1|6388403_6389462_+	ATP-grasp domain-containing protein	NA	NA	NA	NA	NA
WP_015103080.1|6389471_6390395_+	pyridoxal-phosphate dependent enzyme	NA	NA	NA	NA	NA
WP_015103081.1|6390404_6391022_+	C39 family peptidase	NA	NA	NA	NA	NA
WP_148303043.1|6392030_6393374_+	recombinase family protein	NA	A0A0K2CNN5	Brevibacillus_phage	22.9	7.5e-09
WP_158509446.1|6393818_6394421_-|transposase	IS3 family transposase	transposase	U5P429	Shigella_phage	41.2	5.3e-23
WP_158509447.1|6394318_6395965_-	pentapeptide repeat-containing protein	NA	NA	NA	NA	NA
WP_162164595.1|6395855_6396212_+	hypothetical protein	NA	NA	NA	NA	NA
WP_015103088.1|6396971_6397880_-|transposase	IS3 family transposase	transposase	Q8W6R2	Burkholderia_virus	43.0	1.1e-48
WP_015103089.1|6397885_6398197_-|transposase	transposase	transposase	A0A1B3AZF8	Gordonia_phage	43.4	2.0e-10
WP_084672789.1|6399205_6399610_+|transposase	Tn3 family transposase	transposase	Q1MVP5	Enterobacteria_phage	38.5	5.3e-19
>prophage 6
NC_019673	Saccharothrix espanaensis DSM 44229, complete genome	9360653	6405726	6434443	9360653	transposase,integrase	unidentified_phage(100.0%)	20	6420055:6420071	6440527:6440543
WP_015103101.1|6405726_6406704_+|transposase	IS30 family transposase	transposase	H7BWC8	unidentified_phage	29.0	9.0e-20
WP_148303033.1|6407118_6408357_-	hypothetical protein	NA	NA	NA	NA	NA
WP_015103102.1|6408652_6409621_+|integrase	site-specific integrase	integrase	NA	NA	NA	NA
WP_015103103.1|6409617_6411855_+|integrase	site-specific integrase	integrase	NA	NA	NA	NA
WP_148303045.1|6411918_6412764_-	hypothetical protein	NA	NA	NA	NA	NA
WP_015103105.1|6413077_6415573_-|integrase	site-specific integrase	integrase	NA	NA	NA	NA
WP_173430540.1|6415569_6416730_-|integrase	site-specific integrase	integrase	NA	NA	NA	NA
WP_015103108.1|6419617_6420457_-	hypothetical protein	NA	NA	NA	NA	NA
6420055:6420071	attL	CGTCGAGCAGCCGGAAC	NA	NA	NA	NA
WP_041314266.1|6420975_6421179_-	hypothetical protein	NA	NA	NA	NA	NA
WP_015103109.1|6421764_6421932_-	hypothetical protein	NA	NA	NA	NA	NA
WP_015103110.1|6422018_6422297_+	hypothetical protein	NA	NA	NA	NA	NA
WP_015103111.1|6422319_6423120_+	hypothetical protein	NA	NA	NA	NA	NA
WP_015103112.1|6423426_6423813_-	hypothetical protein	NA	NA	NA	NA	NA
WP_015103113.1|6423862_6425089_-	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_158509449.1|6425818_6426358_+	DUF4254 domain-containing protein	NA	NA	NA	NA	NA
WP_015103115.1|6426363_6426657_+	hypothetical protein	NA	NA	NA	NA	NA
WP_015103116.1|6426676_6427024_+	hypothetical protein	NA	NA	NA	NA	NA
WP_148303046.1|6428607_6431367_-	hypothetical protein	NA	NA	NA	NA	NA
WP_015103121.1|6432325_6433324_+|transposase	IS481 family transposase	transposase	NA	NA	NA	NA
WP_015103122.1|6433369_6434443_-|integrase	site-specific integrase	integrase	NA	NA	NA	NA
6440527:6440543	attR	CGTCGAGCAGCCGGAAC	NA	NA	NA	NA
