The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
NC_019908	Brachyspira pilosicoli P43/6/78, complete sequence	2555556	800781	827215	2555556	tail,head,integrase,protease,tRNA,capsid	Pseudomonas_phage(20.0%)	26	800930:800949	826604:826623
WP_014933039.1|800781_802029_-|tRNA	histidine--tRNA ligase	tRNA	NA	NA	NA	NA
800930:800949	attL	TGATTTTTAATAGATTTAAT	NA	NA	NA	NA
WP_013245138.1|802070_803351_-	hypothetical protein	NA	NA	NA	NA	NA
WP_015274179.1|803552_805367_+	family 10 glycosylhydrolase	NA	NA	NA	NA	NA
WP_015274180.1|805449_806595_+	SpoIID/LytB domain-containing protein	NA	Q2XU88	Pseudomonas_phage	31.8	1.2e-20
WP_015274182.1|807488_808652_-|integrase	tyrosine-type recombinase/integrase	integrase	NA	NA	NA	NA
WP_015274183.1|809303_809528_-	hypothetical protein	NA	NA	NA	NA	NA
WP_015274184.1|809553_809763_-	hypothetical protein	NA	NA	NA	NA	NA
WP_015274185.1|809774_811583_-	hypothetical protein	NA	NA	NA	NA	NA
WP_015274186.1|811620_812157_-	hypothetical protein	NA	NA	NA	NA	NA
WP_013244393.1|812181_812607_-	hypothetical protein	NA	NA	NA	NA	NA
WP_015274187.1|812627_813203_-	glycoside hydrolase family 19 protein	NA	A0A191ZC60	Erwinia_phage	45.6	1.5e-30
WP_014936421.1|813605_814001_-	RNA polymerase	NA	NA	NA	NA	NA
WP_015274188.1|813997_814195_-	hypothetical protein	NA	NA	NA	NA	NA
WP_015274189.1|814212_816132_-	hypothetical protein	NA	NA	NA	NA	NA
WP_015274190.1|816141_817230_-	hypothetical protein	NA	NA	NA	NA	NA
WP_015274191.1|817229_817682_-	hypothetical protein	NA	NA	NA	NA	NA
WP_015274192.1|818499_821973_-|tail	phage tail tape measure protein	tail	A0A1L6BY19	Clostridium_phage	39.3	6.1e-63
WP_041752809.1|822000_822183_-	hypothetical protein	NA	NA	NA	NA	NA
WP_015274194.1|822272_822590_-	hypothetical protein	NA	NA	NA	NA	NA
WP_015274195.1|822614_823703_-	hypothetical protein	NA	NA	NA	NA	NA
WP_014936431.1|823714_824083_-	hypothetical protein	NA	NA	NA	NA	NA
WP_015274196.1|824079_824550_-	hypothetical protein	NA	NA	NA	NA	NA
WP_015274197.1|824551_824893_-|head,tail	head-tail adaptor protein	head,tail	NA	NA	NA	NA
WP_014936434.1|824889_825255_-|head,tail	phage head-tail connector protein	head,tail	NA	NA	NA	NA
WP_015274198.1|825281_826583_-|capsid	phage major capsid protein	capsid	A0A142K632	Streptomyces_phage	35.4	4.3e-54
WP_015274199.1|826618_827215_-|head,protease	HK97 family phage prohead protease	head,protease	A0A2H4J6Z9	uncultured_Caudovirales_phage	42.8	6.0e-27
826604:826623	attR	TGATTTTTAATAGATTTAAT	NA	NA	NA	NA
