The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
NC_019842	Bacillus velezensis AS43.3, complete sequence	3961368	649028	658919	3961368		Synechococcus_phage(50.0%)	9	NA	NA
WP_007408896.1|649028_650321_+	adenylosuccinate lyase	NA	A0A2H4UUU6	Bodo_saltans_virus	27.3	4.5e-19
WP_007408897.1|650396_651116_+	phosphoribosylaminoimidazolesuccinocarboxamide synthase	NA	A0A0E3G7P8	Synechococcus_phage	44.7	5.7e-48
WP_015239316.1|651115_651370_+	phosphoribosylformylglycinamidine synthase subunit PurS	NA	M4QPE7	Synechococcus_phage	33.3	2.7e-05
WP_007408898.1|651366_652050_+	phosphoribosylformylglycinamidine synthase subunit PurQ	NA	NA	NA	NA	NA
WP_007408899.1|652033_654262_+	phosphoribosylformylglycinamidine synthase subunit PurL	NA	A6N228	Microbacterium_phage	40.7	5.5e-158
WP_007408900.1|654237_655668_+	amidophosphoribosyltransferase	NA	A0A0M3SGR2	Mollivirus	32.7	6.2e-54
WP_015239317.1|655759_656800_+	phosphoribosylformylglycinamidine cyclo-ligase	NA	A0A0E3F760	Synechococcus_phage	41.9	3.7e-64
WP_007408902.1|656796_657384_+	phosphoribosylglycinamide formyltransferase	NA	M4QRX9	Synechococcus_phage	38.8	1.3e-26
WP_007408903.1|657380_658919_+	bifunctional phosphoribosylaminoimidazolecarboxamide formyltransferase/IMP cyclohydrolase	NA	Q58MG4	Prochlorococcus_phage	50.5	2.5e-77
>prophage 2
NC_019842	Bacillus velezensis AS43.3, complete sequence	3961368	1127515	1219167	3961368	integrase,terminase,tail,portal,tRNA,coat,head,holin	Bacillus_phage(27.08%)	114	1172766:1172814	1216166:1216214
WP_014304785.1|1127515_1128508_-|tRNA	tryptophan--tRNA ligase	tRNA	NA	NA	NA	NA
WP_015239566.1|1129251_1130886_+	peptide ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_015239567.1|1130992_1131928_+	ABC transporter permease	NA	NA	NA	NA	NA
WP_007409113.1|1131931_1132849_+	oligopeptide ABC transporter permease OppC	NA	NA	NA	NA	NA
WP_003155039.1|1132861_1133938_+	ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	29.9	1.7e-16
WP_015239568.1|1133930_1134848_+	oligopeptide ABC transporter ATP-binding protein OppF	NA	M1HP82	Acanthocystis_turfacea_Chlorella_virus	24.6	1.5e-05
WP_015239569.1|1134954_1136142_+	putative glycoside hydrolase	NA	NA	NA	NA	NA
WP_007409110.1|1136259_1136838_+	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_003155034.1|1137016_1137412_+	transcriptional regulator Spx	NA	NA	NA	NA	NA
WP_015239570.1|1137469_1138126_-	TerC family protein	NA	A0A0S4KZH7	Pseudomonas_phage	41.0	7.6e-31
WP_003155032.1|1138401_1139058_+	adaptor protein MecA	NA	NA	NA	NA	NA
WP_007409107.1|1140595_1142425_+	oligoendopeptidase F	NA	NA	NA	NA	NA
WP_003155026.1|1142463_1142631_-	hypothetical protein	NA	NA	NA	NA	NA
WP_015239573.1|1142916_1143819_-	DsbA family protein	NA	NA	NA	NA	NA
WP_003155023.1|1143815_1144214_-	thiol management oxidoreductase	NA	NA	NA	NA	NA
WP_015239574.1|1144442_1145129_-	lytic transglycosylase domain-containing protein	NA	A0A1P8CWQ1	Bacillus_phage	71.2	7.9e-39
WP_014417426.1|1145133_1145706_-	CYTH domain-containing protein	NA	NA	NA	NA	NA
WP_012117290.1|1145830_1146196_+	hypothetical protein	NA	NA	NA	NA	NA
WP_007610625.1|1146223_1146859_+	GTP diphosphokinase	NA	NA	NA	NA	NA
WP_003155018.1|1146876_1147677_+	NAD kinase	NA	NA	NA	NA	NA
WP_015239575.1|1147691_1148585_+	RluA family pseudouridine synthase	NA	A0A2H4UV25	Bodo_saltans_virus	29.3	1.4e-06
WP_007409101.1|1148618_1149368_-	bis(5'-nucleosyl)-tetraphosphatase PrpE	NA	A0A1V0SJW2	Klosneuvirus	26.4	9.9e-11
WP_007610641.1|1149597_1151442_+	monovalent cation:proton antiporter family protein	NA	NA	NA	NA	NA
WP_007409099.1|1151691_1152399_+	thiaminase II	NA	NA	NA	NA	NA
WP_015239576.1|1152376_1152994_+	thiazole tautomerase TenI	NA	NA	NA	NA	NA
WP_015239577.1|1152977_1154087_+	glycine oxidase ThiO	NA	NA	NA	NA	NA
WP_015239578.1|1154083_1154287_+	sulfur carrier protein ThiS	NA	NA	NA	NA	NA
WP_007610655.1|1154283_1155054_+	thiazole synthase	NA	NA	NA	NA	NA
WP_015239579.1|1155050_1156061_+	thiazole biosynthesis adenylyltransferase ThiF	NA	NA	NA	NA	NA
WP_015239580.1|1156083_1156896_+	bifunctional hydroxymethylpyrimidine kinase/phosphomethylpyrimidine kinase	NA	NA	NA	NA	NA
WP_012117300.1|1157026_1157803_+	enoyl-ACP reductase FabI	NA	NA	NA	NA	NA
WP_164461505.1|1157894_1158509_+|coat	spore coat protein	coat	NA	NA	NA	NA
WP_015239582.1|1158566_1159010_-|coat	Spore coat protein Z	coat	NA	NA	NA	NA
WP_003154995.1|1159155_1159638_-|coat	spore coat protein	coat	NA	NA	NA	NA
WP_015239583.1|1159788_1160289_-|coat	spore coat protein	coat	NA	NA	NA	NA
WP_015239584.1|1160381_1160696_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003154992.1|1160733_1161120_-|coat	spore coat protein	coat	NA	NA	NA	NA
WP_015239585.1|1161290_1161647_+	DUF1360 domain-containing protein	NA	NA	NA	NA	NA
WP_012117306.1|1161933_1162131_+	hypothetical protein	NA	NA	NA	NA	NA
WP_007610678.1|1162222_1162384_+	YjcZ family sporulation protein	NA	NA	NA	NA	NA
WP_003154986.1|1162550_1162805_+	stage VI sporulation protein F	NA	NA	NA	NA	NA
WP_015239586.1|1162873_1165159_-	ATP-dependent helicase	NA	A0A068EQC7	Bacillus_phage	33.3	1.4e-84
WP_007409082.1|1165279_1165534_+	hypothetical protein	NA	NA	NA	NA	NA
WP_015239587.1|1165603_1166353_+	subclass B1 metallo-beta-lactamase	NA	NA	NA	NA	NA
WP_015239588.1|1166394_1167117_-	ABC transporter permease	NA	NA	NA	NA	NA
WP_007409079.1|1167109_1167847_-	ABC transporter ATP-binding protein	NA	W6JKT0	Anomala_cuprea_entomopoxvirus	33.8	2.6e-27
WP_007409078.1|1167847_1168081_-	AbrB/MazE/SpoVT family DNA-binding domain-containing protein	NA	NA	NA	NA	NA
WP_012117312.1|1168241_1168673_-	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_007409076.1|1168677_1169193_-	2'-5' RNA ligase family protein	NA	NA	NA	NA	NA
WP_012117313.1|1169218_1169941_-	esterase family protein	NA	NA	NA	NA	NA
WP_012117314.1|1170309_1171431_+	methionine biosynthesis PLP-dependent protein	NA	A0A0B5JD48	Pandoravirus	26.7	3.3e-18
WP_015239589.1|1171423_1172599_+	cystathionine beta-lyase	NA	NA	NA	NA	NA
1172766:1172814	attL	CTACCTTGACAGGGTAGAGGTCGCTGGTTCGAGCCCAGTCGGAATCATA	NA	NA	NA	NA
WP_015239590.1|1172943_1174173_-|integrase	site-specific integrase	integrase	A0A0K2CZ62	Paenibacillus_phage	49.3	4.6e-106
WP_015239591.1|1174177_1174699_-	ImmA/IrrE family metallo-endopeptidase	NA	A0A2H4JA43	uncultured_Caudovirales_phage	63.4	7.8e-55
WP_007408625.1|1174771_1175749_-	SHOCT domain-containing protein	NA	NA	NA	NA	NA
WP_015239592.1|1175965_1176340_-	helix-turn-helix transcriptional regulator	NA	A0A2H4J6F9	uncultured_Caudovirales_phage	65.9	1.2e-33
WP_015239593.1|1176498_1176723_+	helix-turn-helix transcriptional regulator	NA	A0A2H4J4N8	uncultured_Caudovirales_phage	79.7	1.2e-25
WP_007408621.1|1176733_1176928_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_003155916.1|1177709_1178282_+	helix-turn-helix transcriptional regulator	NA	A0A2H4J884	uncultured_Caudovirales_phage	55.0	1.3e-58
WP_015239595.1|1178278_1178539_+	hypothetical protein	NA	A0A2H4J4M9	uncultured_Caudovirales_phage	39.2	1.2e-08
WP_015239596.1|1178535_1178739_+	hypothetical protein	NA	NA	NA	NA	NA
WP_015239597.1|1178841_1179030_+	hypothetical protein	NA	NA	NA	NA	NA
WP_015239598.1|1179026_1179944_+	hypothetical protein	NA	A0A0A7RUE9	Clostridium_phage	61.4	9.4e-88
WP_082186550.1|1179963_1180701_+	PD-(D/E)XK nuclease-like domain-containing protein	NA	A0A0A7RUC1	Clostridium_phage	44.9	6.7e-52
WP_015239600.1|1180898_1181600_+	DnaD domain protein	NA	A0A2H4J6G9	uncultured_Caudovirales_phage	33.3	9.0e-06
WP_015239601.1|1181690_1182431_+	ATP-binding protein	NA	A0A0K2CPA5	Brevibacillus_phage	51.1	6.9e-57
WP_015239602.1|1182427_1182571_+	hypothetical protein	NA	NA	NA	NA	NA
WP_015239603.1|1182716_1183154_+	hypothetical protein	NA	A0A0A7RWK2	Clostridium_phage	36.7	3.4e-11
WP_015239604.1|1183140_1183599_+	DUF1064 domain-containing protein	NA	A0A2H4J891	uncultured_Caudovirales_phage	78.7	5.1e-58
WP_015239605.1|1183718_1183871_+	hypothetical protein	NA	A0A2H4J4N7	uncultured_Caudovirales_phage	70.7	2.4e-09
WP_003155894.1|1183951_1184155_+	hypothetical protein	NA	A0A2H4J4M6	uncultured_Caudovirales_phage	75.4	3.4e-22
WP_015239606.1|1184186_1184597_+	hypothetical protein	NA	NA	NA	NA	NA
WP_015239607.1|1184593_1184839_+	hypothetical protein	NA	F8WQ54	Bacillus_phage	38.2	2.6e-05
WP_015239609.1|1185617_1186442_+	DNA adenine methylase	NA	U5P0W8	Brevibacillus_phage	58.3	2.2e-88
WP_015239610.1|1186585_1186936_-	Ig-like domain-containing protein	NA	NA	NA	NA	NA
WP_015239611.1|1187044_1187479_+	hypothetical protein	NA	A0A2H4J8A0	uncultured_Caudovirales_phage	70.7	4.1e-49
WP_015239612.1|1187489_1187660_+	hypothetical protein	NA	NA	NA	NA	NA
WP_015239613.1|1187786_1188560_+	hypothetical protein	NA	NA	NA	NA	NA
WP_015239614.1|1188698_1188827_+	hypothetical protein	NA	NA	NA	NA	NA
WP_015239615.1|1188842_1189358_+	sigma-70 family RNA polymerase sigma factor	NA	A0A1L2JY33	Aeribacillus_phage	43.2	4.0e-27
WP_172635560.1|1189462_1189600_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003155868.1|1189898_1190111_+	helix-turn-helix domain-containing protein	NA	A0A1Z1LZP5	Bacillus_phage	52.9	9.6e-12
WP_015239617.1|1190449_1190821_+	YrdB family protein	NA	NA	NA	NA	NA
WP_015239618.1|1191092_1191851_-	DUF4393 domain-containing protein	NA	A0A1S5S9V3	Streptococcus_phage	35.9	1.5e-35
WP_015239619.1|1192147_1192897_+	DNA-binding protein	NA	A0A2P1JTW4	Anoxybacillus_phage	53.9	1.0e-47
WP_015239620.1|1192883_1194158_+|terminase	PBSX family phage terminase large subunit	terminase	S5MC58	Brevibacillus_phage	72.1	1.9e-179
WP_015239621.1|1194179_1195628_+|portal	phage portal protein	portal	A0A1Q1PVT0	Bacillus_phage	48.1	6.0e-121
WP_015239622.1|1195614_1196532_+|head	Minor head structural component GP7	head	A0A1Q1PVS0	Bacillus_phage	50.8	1.5e-80
WP_015239623.1|1196692_1197358_+	phage scaffolding protein	NA	I1TLE1	Bacillus_phage	48.6	1.0e-22
WP_015239624.1|1197370_1198351_+	hypothetical protein	NA	D2J006	Enterococcus_phage	37.1	1.7e-47
WP_015239625.1|1198613_1198805_+	hypothetical protein	NA	NA	NA	NA	NA
WP_015239626.1|1198809_1199106_+|head,tail	phage head-tail connector protein	head,tail	Q4ZBR3	Staphylococcus_phage	40.4	5.6e-10
WP_015239627.1|1199102_1199441_+|head	phage head closure protein	head	NA	NA	NA	NA
WP_015239629.1|1199797_1200478_+	hypothetical protein	NA	Q4ZBR0	Staphylococcus_phage	63.0	4.8e-81
WP_015239630.1|1200852_1201251_+	DUF3168 domain-containing protein	NA	W8EK61	Geobacillus_phage	44.6	4.9e-25
WP_015239631.1|1201264_1201777_+|tail	phage major tail protein, TP901-1 family	tail	Q0PDK9	Bacillus_phage	46.5	2.0e-31
WP_051025514.1|1201718_1202033_+	fibronectin type III domain-containing protein	NA	Q0PDK9	Bacillus_phage	74.1	1.9e-24
WP_082186561.1|1202046_1202289_+	fibronectin type III domain-containing protein	NA	NA	NA	NA	NA
WP_015239634.1|1202345_1202852_+	hypothetical protein	NA	I6T7F0	Staphylococcus_virus	33.3	3.9e-11
WP_003155844.1|1202899_1203208_+	hypothetical protein	NA	NA	NA	NA	NA
WP_041482009.1|1203212_1208093_+	membrane protein	NA	M9NRJ5	Staphylococcus_phage	25.5	2.7e-40
WP_015239637.1|1208089_1208854_+|tail	phage tail family protein	tail	NA	NA	NA	NA
WP_015239638.1|1208866_1212064_+|tail	phage tail protein	tail	Q5YA57	Bacillus_phage	45.9	1.7e-131
WP_007408580.1|1212075_1212363_+	hypothetical protein	NA	NA	NA	NA	NA
WP_014304515.1|1212381_1212549_+	XkdX family protein	NA	NA	NA	NA	NA
WP_015239639.1|1212562_1212784_+	hypothetical protein	NA	NA	NA	NA	NA
WP_015239640.1|1212818_1213241_+|holin	phage holin family protein	holin	D6R405	Bacillus_phage	89.5	3.8e-60
WP_015239641.1|1213288_1214452_+	N-acetylmuramoyl-L-alanine amidase	NA	A0A1P8CWN6	Bacillus_phage	49.5	1.9e-69
WP_015239642.1|1214496_1215120_-	hypothetical protein	NA	A0A0A8WFI2	Clostridium_phage	36.5	1.3e-24
WP_172635561.1|1215162_1215339_-	hypothetical protein	NA	NA	NA	NA	NA
WP_015239643.1|1215750_1215963_-	hypothetical protein	NA	A0A2H4J4T3	uncultured_Caudovirales_phage	74.1	8.4e-16
WP_015239644.1|1216358_1216763_+	hypothetical protein	NA	NA	NA	NA	NA
1216166:1216214	attR	CTACCTTGACAGGGTAGAGGTCGCTGGTTCGAGCCCAGTCGGAATCATA	NA	NA	NA	NA
WP_015239645.1|1216976_1217267_-	hypothetical protein	NA	NA	NA	NA	NA
WP_015239646.1|1217283_1219167_-	ribonuclease YeeF family protein	NA	A0A1P8CWI7	Bacillus_phage	59.9	2.1e-126
>prophage 3
NC_019842	Bacillus velezensis AS43.3, complete sequence	3961368	1259769	1291675	3961368	capsid,plate,terminase,tail,portal,holin	Bacillus_phage(29.03%)	43	NA	NA
WP_087920760.1|1259769_1260906_+	S9 family peptidase	NA	A0A1P8CWN8	Bacillus_phage	47.9	1.3e-94
WP_003154881.1|1260895_1261030_+	PhrA family phosphatase inhibitor	NA	NA	NA	NA	NA
WP_003154880.1|1261172_1262126_+	N-acetylmuramoyl-L-alanine amidase	NA	A0A218KC88	Bacillus_phage	69.3	1.1e-62
WP_007610770.1|1262163_1262541_-	PH domain-containing protein	NA	A5GYQ0	Lactococcus_phage	41.4	1.5e-15
WP_015239671.1|1262652_1263258_+	poly-gamma-glutamate hydrolase family protein	NA	A0A0Y0AJU6	Bacillus_phage	48.3	6.1e-43
WP_007610775.1|1263396_1263987_-	ImmA/IrrE family metallo-endopeptidase	NA	A0A2H4JA43	uncultured_Caudovirales_phage	51.7	3.0e-39
WP_015239672.1|1264135_1264474_-	helix-turn-helix transcriptional regulator	NA	A0A2H4J6F9	uncultured_Caudovirales_phage	44.9	1.9e-17
WP_007407285.1|1264664_1264844_+	hypothetical protein	NA	NA	NA	NA	NA
WP_015239673.1|1264833_1265661_+	hypothetical protein	NA	S6BFM4	Thermus_phage	49.0	2.2e-19
WP_015239674.1|1265560_1266361_+	ATP-binding protein	NA	A6XMI1	Bacillus_virus	45.7	1.0e-58
WP_015239675.1|1266360_1266528_+	hypothetical protein	NA	NA	NA	NA	NA
WP_015239676.1|1266625_1266967_+	hypothetical protein	NA	NA	NA	NA	NA
WP_007407280.1|1266956_1267160_+	hypothetical protein	NA	A0A2H4J4M6	uncultured_Caudovirales_phage	50.0	1.9e-12
WP_007407279.1|1267273_1267786_+	sigma-70 family RNA polymerase sigma factor	NA	A0A0K2CNQ1	Brevibacillus_phage	44.6	3.8e-22
WP_007407278.1|1267898_1268696_+|terminase	terminase small subunit	terminase	A0A0S2MVB6	Bacillus_phage	49.8	4.0e-58
WP_015239677.1|1268692_1269991_+|terminase	PBSX family phage terminase large subunit	terminase	M4ZRM5	Bacillus_phage	59.2	1.6e-149
WP_094031916.1|1270039_1271431_+|portal	phage portal protein	portal	A0A1B1P7C8	Bacillus_phage	55.8	3.0e-138
WP_015239679.1|1271450_1272296_+	hypothetical protein	NA	A0A1B1P7E4	Bacillus_phage	58.1	5.7e-55
WP_007407274.1|1272322_1273258_+|capsid	phage major capsid protein	capsid	A0A1B1P7E3	Bacillus_phage	62.8	3.3e-104
WP_015239680.1|1273274_1273658_+	DUF3199 family protein	NA	NA	NA	NA	NA
WP_007407272.1|1273654_1274011_+	DUF3599 family protein	NA	NA	NA	NA	NA
WP_015239681.1|1274007_1274511_+	HK97 gp10 family phage protein	NA	A0A249XXA4	Clostridium_phage	41.1	2.1e-36
WP_015239682.1|1274507_1274954_+	hypothetical protein	NA	NA	NA	NA	NA
WP_007610809.1|1274950_1275160_+	hypothetical protein	NA	NA	NA	NA	NA
WP_015239683.1|1275159_1276557_+|tail	phage tail sheath subtilisin-like domain-containing protein	tail	A0A0A7RTT5	Clostridium_phage	40.4	9.0e-82
WP_003154837.1|1276558_1277002_+|tail	phage tail tube protein	tail	A0A0K2CNG3	Brevibacillus_phage	45.2	8.4e-26
WP_003154836.1|1277078_1277525_+|portal	phage portal protein	portal	A0A0A7RTY8	Clostridium_phage	35.8	1.0e-10
WP_015239684.1|1277566_1277719_+	hypothetical protein	NA	NA	NA	NA	NA
WP_015239685.1|1277706_1282833_+	transglycosylase SLT domain-containing protein	NA	A0A1L2JY60	Aeribacillus_phage	46.6	2.0e-41
WP_015239686.1|1282825_1283485_+	LysM peptidoglycan-binding domain-containing protein	NA	A0A090DBR9	Clostridium_phage	34.0	1.3e-22
WP_015239687.1|1283498_1284476_+	hypothetical protein	NA	A0A1L6BY20	Clostridium_phage	30.6	3.7e-34
WP_007610818.1|1284475_1284742_+	DUF2577 family protein	NA	S6C459	Thermus_phage	38.6	1.2e-06
WP_003154825.1|1284845_1285271_+	DUF2634 domain-containing protein	NA	A0A2H4J6K5	uncultured_Caudovirales_phage	35.9	1.5e-11
WP_015239688.1|1285263_1286310_+|plate	baseplate J/gp47 family protein	plate	S6AVU3	Thermus_phage	44.1	1.3e-69
WP_015239689.1|1286293_1286872_+	YmfQ family protein	NA	A0A0A7RTT8	Clostridium_phage	28.9	3.1e-12
WP_015239690.1|1286868_1287141_+	hypothetical protein	NA	NA	NA	NA	NA
WP_015239691.1|1287143_1288733_+	hypothetical protein	NA	A0A2H4J4R1	uncultured_Caudovirales_phage	54.1	2.4e-14
WP_041482010.1|1288739_1289171_+	hypothetical protein	NA	NA	NA	NA	NA
WP_007610833.1|1289175_1289373_+	XkdX family protein	NA	A0A2H4JAA1	uncultured_Caudovirales_phage	61.8	7.3e-14
WP_015239693.1|1289429_1290191_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003154815.1|1290242_1290506_+	hemolysin XhlA family protein	NA	A0A2H4JD40	uncultured_Caudovirales_phage	63.1	8.8e-23
WP_003154813.1|1290519_1290783_+|holin	phage holin	holin	A0A2H4J6M0	uncultured_Caudovirales_phage	65.5	2.3e-23
WP_007407257.1|1290796_1291675_+	N-acetylmuramoyl-L-alanine amidase	NA	Q9ZXD7	Bacillus_phage	60.5	3.7e-81
>prophage 4
NC_019842	Bacillus velezensis AS43.3, complete sequence	3961368	1841832	1848046	3961368		Bacillus_phage(50.0%)	6	NA	NA
WP_003154061.1|1841832_1842225_+	class Ib ribonucleoside-diphosphate reductase assembly flavoprotein NrdI	NA	G3MBF1	Bacillus_virus	59.1	3.8e-30
WP_007611605.1|1842184_1844287_+	class 1b ribonucleoside-diphosphate reductase subunit alpha	NA	U5PY35	Bacillus_phage	85.7	0.0e+00
WP_012117608.1|1844304_1845294_+	class 1b ribonucleoside-diphosphate reductase subunit beta	NA	F8WQ21	Bacillus_phage	83.0	1.1e-155
WP_015239902.1|1845342_1845963_+	hypothetical protein	NA	A0A127AYS1	Bacillus_phage	48.8	6.0e-46
WP_015239903.1|1846012_1846771_-	N-acetylmuramoyl-L-alanine amidase	NA	E5DV68	Deep-sea_thermophilic_phage	50.4	4.8e-53
WP_015417523.1|1847077_1848046_+	stage V sporulation protein K	NA	G3MAX6	Bacillus_virus	40.9	8.0e-53
>prophage 5
NC_019842	Bacillus velezensis AS43.3, complete sequence	3961368	2286995	2293248	3961368		Staphylococcus_phage(66.67%)	9	NA	NA
WP_015240121.1|2286995_2287568_-	SMC-Scp complex subunit ScpB	NA	A0A1B1IVT7	uncultured_Mediterranean_phage	34.5	9.6e-14
WP_007409427.1|2287577_2288333_-	segregation/condensation protein A	NA	A0A1B1IVW1	uncultured_Mediterranean_phage	25.7	2.9e-10
WP_072589349.1|2288540_2288630_+	YjcZ family sporulation protein	NA	NA	NA	NA	NA
WP_007612304.1|2288718_2289240_+	DUF309 domain-containing protein	NA	NA	NA	NA	NA
WP_015240122.1|2289305_2289680_-	GNAT family N-acetyltransferase RibT	NA	NA	NA	NA	NA
WP_015240123.1|2289796_2290261_-	6,7-dimethyl-8-ribityllumazine synthase	NA	A0A2H4PQS3	Staphylococcus_phage	58.7	1.6e-43
WP_015240124.1|2290293_2291490_-	bifunctional 3,4-dihydroxy-2-butanone-4-phosphate synthase/GTP cyclohydrolase II	NA	A0A2H4PQS2	Staphylococcus_phage	54.9	3.7e-116
WP_007409425.1|2291504_2292152_-	riboflavin synthase	NA	A0A2H4PQS5	Staphylococcus_phage	44.3	1.5e-39
WP_015240125.1|2292132_2293248_-	bifunctional diaminohydroxyphosphoribosylaminopyrimidine deaminase/5-amino-6-(5-phosphoribosylamino)uracil reductase RibD	NA	A0A2H4PQS8	Staphylococcus_phage	36.6	5.7e-55
>prophage 6
NC_019842	Bacillus velezensis AS43.3, complete sequence	3961368	2638375	2704613	3961368	coat,tRNA,protease	Klosneuvirus(15.38%)	60	NA	NA
WP_015240289.1|2638375_2639140_-|tRNA	tRNA threonylcarbamoyladenosine dehydratase	tRNA	A0A291ATS8	Pandoravirus	33.0	1.1e-20
WP_015240290.1|2639466_2641245_-|tRNA	aspartate--tRNA ligase	tRNA	A0A1V0SIS0	Klosneuvirus	29.1	8.7e-13
WP_012118082.1|2641259_2642534_-|tRNA	histidine--tRNA ligase	tRNA	NA	NA	NA	NA
WP_003152722.1|2642896_2643067_-	YrzK family protein	NA	NA	NA	NA	NA
WP_015240291.1|2643197_2644760_+	SH3 domain-containing protein	NA	E5DV68	Deep-sea_thermophilic_phage	33.3	2.0e-13
WP_007408194.1|2644786_2645230_-|tRNA	D-tyrosyl-tRNA(Tyr) deacylase	tRNA	NA	NA	NA	NA
WP_003152716.1|2645242_2647447_-	GTP diphosphokinase	NA	A0A2I2L310	Orpheovirus	34.8	1.5e-09
WP_003152714.1|2647603_2648116_-	adenine phosphoribosyltransferase	NA	A0A1V0SKE5	Klosneuvirus	47.2	5.5e-29
WP_015240292.1|2648121_2650482_-	single-stranded-DNA-specific exonuclease RecJ	NA	A7KV88	Bacillus_phage	34.8	8.1e-91
WP_014418528.1|2650537_2650864_-	DUF1049 domain-containing protein	NA	NA	NA	NA	NA
WP_007408189.1|2653810_2654107_-	post-transcriptional regulator	NA	NA	NA	NA	NA
WP_007408188.1|2654222_2655779_+	stage V sporulation protein B	NA	NA	NA	NA	NA
WP_003152699.1|2655786_2656443_-	DUF421 domain-containing protein	NA	NA	NA	NA	NA
WP_015240296.1|2656609_2656996_+	TIGR04086 family membrane protein	NA	NA	NA	NA	NA
WP_003152695.1|2657047_2657308_-	preprotein translocase subunit YajC	NA	A0A1B1IVR5	uncultured_Mediterranean_phage	46.9	1.5e-06
WP_007408186.1|2657338_2658484_-|tRNA	tRNA guanosine(34) transglycosylase Tgt	tRNA	A0A1B1IVQ4	uncultured_Mediterranean_phage	44.8	8.1e-89
WP_015240297.1|2658511_2659540_-|tRNA	tRNA preQ1(34) S-adenosylmethionine ribosyltransferase-isomerase QueA	tRNA	NA	NA	NA	NA
WP_003152687.1|2659565_2659766_-	DUF2905 domain-containing protein	NA	NA	NA	NA	NA
WP_003152683.1|2660772_2661378_-	Holliday junction branch migration protein RuvA	NA	NA	NA	NA	NA
WP_012118093.1|2661512_2662022_-	BofC C-terminal domain-containing protein	NA	NA	NA	NA	NA
WP_007408183.1|2662153_2662393_-	hypothetical protein	NA	NA	NA	NA	NA
WP_014721606.1|2662406_2663000_-	YhcN/YlaJ family sporulation lipoprotein	NA	NA	NA	NA	NA
WP_015240299.1|2663147_2664353_-|coat	SafA/ExsA family spore coat assembly protein	coat	NA	NA	NA	NA
WP_015240300.1|2664479_2665583_-	quinolinate synthase NadA	NA	NA	NA	NA	NA
WP_015240301.1|2665584_2666433_-	carboxylating nicotinate-nucleotide diphosphorylase	NA	NA	NA	NA	NA
WP_015240302.1|2666414_2667980_-	L-aspartate oxidase	NA	NA	NA	NA	NA
WP_015240303.1|2668085_2669237_+	IscS subfamily cysteine desulfurase	NA	A0A141ZJV0	Faustovirus	29.6	2.3e-30
WP_015240304.1|2669233_2669776_+	transcription repressor NadR	NA	NA	NA	NA	NA
WP_015240305.1|2669803_2670661_-	prephenate dehydratase	NA	NA	NA	NA	NA
WP_007408173.1|2670674_2671118_-	transcriptional regulator ThrR	NA	NA	NA	NA	NA
WP_007408172.1|2671171_2672458_-	GTPase ObgE	NA	NA	NA	NA	NA
WP_007408171.1|2672489_2673068_-	Spo0B domain-containing protein	NA	NA	NA	NA	NA
WP_003152662.1|2673385_2673670_-	50S ribosomal protein L27	NA	NA	NA	NA	NA
WP_012118103.1|2673682_2674024_-|protease	ribosomal-processing cysteine protease Prp	protease	NA	NA	NA	NA
WP_003152660.1|2674026_2674335_-	50S ribosomal protein L21	NA	NA	NA	NA	NA
WP_007408169.1|2674480_2675347_-|protease	site-2 protease family protein	protease	NA	NA	NA	NA
WP_007408168.1|2675339_2676143_-	M23 family metallopeptidase	NA	NA	NA	NA	NA
WP_003152655.1|2676270_2677074_-	septum site-determining protein MinD	NA	NA	NA	NA	NA
WP_003152653.1|2677076_2677757_-	septum site-determining protein MinC	NA	NA	NA	NA	NA
WP_007408167.1|2677810_2678329_-	rod shape-determining protein MreD	NA	NA	NA	NA	NA
WP_007408166.1|2678325_2679189_-	rod shape-determining protein MreC	NA	NA	NA	NA	NA
WP_003152647.1|2679219_2680233_-	rod shape-determining protein MreB	NA	NA	NA	NA	NA
WP_007408165.1|2680324_2681020_-	DNA repair protein RadC	NA	NA	NA	NA	NA
WP_007408164.1|2681051_2681621_-	septum formation inhibitor Maf	NA	NA	NA	NA	NA
WP_015240307.1|2681761_2682763_-	SPOR domain-containing protein	NA	NA	NA	NA	NA
WP_015240309.1|2683783_2685076_-	bifunctional folylpolyglutamate synthase/dihydrofolate synthase	NA	NA	NA	NA	NA
WP_012118109.1|2685134_2687777_-|tRNA	valine--tRNA ligase	tRNA	A0A1V0S951	Catovirus	42.3	3.7e-161
WP_003152639.1|2688229_2688421_+	hypothetical protein	NA	NA	NA	NA	NA
WP_015240310.1|2688435_2689458_-|coat	spore coat protein YsxE	coat	NA	NA	NA	NA
WP_015240311.1|2689491_2691336_-	LysM peptidoglycan-binding domain-containing protein	NA	NA	NA	NA	NA
WP_007408158.1|2691468_2692758_-	glutamate-1-semialdehyde 2,1-aminomutase	NA	NA	NA	NA	NA
WP_015240312.1|2692786_2693761_-	porphobilinogen synthase	NA	NA	NA	NA	NA
WP_015240313.1|2693766_2694546_-	uroporphyrinogen-III synthase	NA	NA	NA	NA	NA
WP_015240314.1|2694535_2695477_-	hydroxymethylbilane synthase	NA	NA	NA	NA	NA
WP_007408154.1|2695510_2696341_-	cytochrome c biogenesis protein CcsA	NA	NA	NA	NA	NA
WP_015240315.1|2696348_2697716_-|tRNA	glutamyl-tRNA reductase	tRNA	NA	NA	NA	NA
WP_015240316.1|2697910_2698402_+	hypothetical protein	NA	NA	NA	NA	NA
WP_015240318.1|2699017_2701342_-	endopeptidase La	NA	A0A0R6PGP8	Moraxella_phage	44.2	1.4e-183
WP_012118116.1|2701542_2703201_-|protease	ATP-dependent protease LonB	protease	A0A167RA83	Powai_lake_megavirus	32.7	1.9e-14
WP_007408149.1|2703350_2704613_-|protease	ATP-dependent protease ATP-binding subunit ClpX	protease	G3M9Z9	Bacillus_virus	65.3	4.2e-147
