The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
NC_019793	Deinococcus peraridilitoris DSM 19664, complete sequence	3881839	459943	505291	3881839	holin,terminase,head,integrase,transposase,capsid	Bacillus_phage(20.0%)	58	470641:470657	483467:483483
WP_015231680.1|459943_460960_+|transposase	IS4 family transposase	transposase	NA	NA	NA	NA
WP_015234334.1|461461_461647_+	hypothetical protein	NA	NA	NA	NA	NA
WP_015234335.1|461727_462303_-	hypothetical protein	NA	NA	NA	NA	NA
WP_015234336.1|462699_463800_+	ATP phosphoribosyltransferase regulatory subunit	NA	NA	NA	NA	NA
WP_015234337.1|463796_464474_+	ATP phosphoribosyltransferase	NA	NA	NA	NA	NA
WP_015234338.1|464473_465445_+	phosphotransferase	NA	NA	NA	NA	NA
WP_015234339.1|465685_466564_-	hypothetical protein	NA	NA	NA	NA	NA
WP_015234340.1|466887_468792_+	peptidyl-prolyl cis-trans isomerase	NA	NA	NA	NA	NA
WP_015234341.1|468859_469381_-	DUF4388 domain-containing protein	NA	NA	NA	NA	NA
WP_015234342.1|469488_470772_-	UDP-N-acetylglucosamine 1-carboxyvinyltransferase	NA	NA	NA	NA	NA
470641:470657	attL	CAACGTCACCGGCTCCT	NA	NA	NA	NA
WP_015234343.1|471059_471281_+	hypothetical protein	NA	NA	NA	NA	NA
WP_015234344.1|471392_473306_+	PQQ-binding-like beta-propeller repeat protein	NA	A0A142BKH6	Avian_leukosis_and_sarcoma_virus	28.9	6.5e-14
WP_015234345.1|473426_473693_+	twin-arginine translocase TatA/TatE family subunit	NA	NA	NA	NA	NA
WP_015234346.1|473853_474468_+	DedA family protein	NA	NA	NA	NA	NA
WP_015234347.1|474604_475582_+	YifB family Mg chelatase-like AAA ATPase	NA	NA	NA	NA	NA
WP_157448950.1|475613_475808_+	hypothetical protein	NA	NA	NA	NA	NA
WP_157448734.1|475829_476051_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_015234350.1|476149_476464_+	hypothetical protein	NA	NA	NA	NA	NA
WP_015234351.1|476489_477263_+	DNA (cytosine-5-)-methyltransferase	NA	B3VG55	Mycobacterium_virus	47.1	5.0e-50
WP_015234352.1|477259_477718_+	hypothetical protein	NA	A0A0Y0AEU3	Bacillus_phage	50.0	3.2e-36
WP_015234353.1|477882_478284_+	hypothetical protein	NA	NA	NA	NA	NA
WP_015234354.1|478294_478552_+	hypothetical protein	NA	NA	NA	NA	NA
WP_157448736.1|478529_478868_+	hypothetical protein	NA	NA	NA	NA	NA
WP_041230646.1|478901_479087_+	hypothetical protein	NA	NA	NA	NA	NA
WP_015234356.1|479104_479260_+	hypothetical protein	NA	NA	NA	NA	NA
WP_015234357.1|479256_479532_+	hypothetical protein	NA	NA	NA	NA	NA
WP_015234358.1|479542_479764_+	hypothetical protein	NA	NA	NA	NA	NA
WP_015234359.1|479788_479977_+	DUF1653 domain-containing protein	NA	NA	NA	NA	NA
WP_157448737.1|480157_480313_+	hypothetical protein	NA	NA	NA	NA	NA
WP_015234361.1|480383_481316_-|integrase	site-specific integrase	integrase	W8EHC2	Mycobacterium_phage	26.9	4.0e-09
WP_015234362.1|481594_482020_-	hypothetical protein	NA	NA	NA	NA	NA
WP_015234363.1|482016_482364_-	hypothetical protein	NA	NA	NA	NA	NA
WP_015234364.1|482438_484337_-	discoidin domain-containing protein	NA	NA	NA	NA	NA
483467:483483	attR	AGGAGCCGGTGACGTTG	NA	NA	NA	NA
WP_015234365.1|484333_484828_-	secretion activating protein	NA	NA	NA	NA	NA
WP_015234366.1|484824_485292_-|holin	phage holin family protein	holin	D0R7H7	Paenibacillus_phage	46.2	2.0e-25
WP_015234367.1|485537_486047_+	hypothetical protein	NA	NA	NA	NA	NA
WP_015234369.1|486302_489080_-	right-handed parallel beta-helix repeat-containing protein	NA	NA	NA	NA	NA
WP_015234370.1|489089_489587_-	hypothetical protein	NA	NA	NA	NA	NA
WP_015234371.1|489583_491188_-	hypothetical protein	NA	NA	NA	NA	NA
WP_015234372.1|491292_495639_-	tape measure protein	NA	M1I8I2	Bacillus_virus	33.2	2.0e-31
WP_157448738.1|495635_495947_-	hypothetical protein	NA	NA	NA	NA	NA
WP_015234374.1|496003_496387_-	hypothetical protein	NA	NA	NA	NA	NA
WP_157448739.1|496383_496533_-	hypothetical protein	NA	NA	NA	NA	NA
WP_015234376.1|496631_497087_-	hypothetical protein	NA	NA	NA	NA	NA
WP_015234377.1|497089_497449_-	hypothetical protein	NA	NA	NA	NA	NA
WP_015234378.1|497445_497808_-	hypothetical protein	NA	A0A088FB12	Idiomarinaceae_phage	45.6	1.0e-05
WP_015234379.1|497804_498122_-	hypothetical protein	NA	NA	NA	NA	NA
WP_015234380.1|498121_498481_-	hypothetical protein	NA	NA	NA	NA	NA
WP_015234381.1|498489_498819_-	hypothetical protein	NA	NA	NA	NA	NA
WP_015234382.1|498787_499024_-	hypothetical protein	NA	NA	NA	NA	NA
WP_015234383.1|499025_499271_-	hypothetical protein	NA	NA	NA	NA	NA
WP_015234384.1|499339_500290_-|capsid	N4-gp56 family major capsid protein	capsid	A0A0S2SXJ0	Bacillus_phage	41.2	1.1e-57
WP_085931720.1|500303_500879_-	DUF4355 domain-containing protein	NA	NA	NA	NA	NA
WP_015234386.1|501024_501213_-	hypothetical protein	NA	NA	NA	NA	NA
WP_015234387.1|501209_501953_-|head	phage head morphogenesis protein, SPP1 gp7	head	NA	NA	NA	NA
WP_015234388.1|501949_503320_-	hypothetical protein	NA	NA	NA	NA	NA
WP_015234389.1|503334_504618_-	Terminase-like family	NA	A0A2H4J4X1	uncultured_Caudovirales_phage	25.8	3.8e-10
WP_015234390.1|504607_505291_-|terminase	terminase small subunit	terminase	A0A2H4JBF3	uncultured_Caudovirales_phage	26.6	1.5e-05
>prophage 2
NC_019793	Deinococcus peraridilitoris DSM 19664, complete sequence	3881839	1594314	1677756	3881839	integrase,transposase,protease	Bacillus_phage(25.0%)	58	1630438:1630463	1679494:1679519
WP_015235462.1|1594314_1595292_-|protease	Zn-dependent protease	protease	NA	NA	NA	NA
WP_015235463.1|1595294_1596086_-	ion transporter	NA	NA	NA	NA	NA
WP_015235464.1|1596197_1597373_+	hypothetical protein	NA	NA	NA	NA	NA
WP_015235465.1|1598489_1598720_+	DUF2132 domain-containing protein	NA	NA	NA	NA	NA
WP_015235466.1|1598911_1600258_+	beta-glucosidase	NA	A0A0B5JD41	Pandoravirus	36.0	1.8e-74
WP_015235467.1|1600315_1600738_-	response regulator	NA	NA	NA	NA	NA
WP_052326659.1|1600730_1604753_-	PAS domain S-box protein	NA	A0A1V0SGX0	Hokovirus	30.0	2.7e-14
WP_041231298.1|1605146_1605839_-	phosphatase PAP2 family protein	NA	NA	NA	NA	NA
WP_015235470.1|1607285_1607720_+	hypothetical protein	NA	NA	NA	NA	NA
WP_015235471.1|1608821_1610321_-	hypothetical protein	NA	NA	NA	NA	NA
WP_157448802.1|1610548_1611358_-	hypothetical protein	NA	NA	NA	NA	NA
WP_015235473.1|1611885_1614984_+	DEAD/DEAH box helicase	NA	A0A1B1IUI1	uncultured_Mediterranean_phage	30.8	1.6e-102
WP_015235474.1|1614983_1619228_+	ATP phosphoribosyltransferase regulatory subunit	NA	A0A1B1IUC6	uncultured_Mediterranean_phage	27.3	6.2e-49
WP_015235475.1|1619224_1623130_+	helicase family protein with metal-binding cysteine cluster	NA	NA	NA	NA	NA
WP_015235476.1|1623126_1624974_+	DUF1998 domain-containing protein	NA	NA	NA	NA	NA
WP_041231301.1|1624999_1625731_+	hypothetical protein	NA	NA	NA	NA	NA
WP_041231302.1|1625808_1626873_+	DNA (cytosine-5-)-methyltransferase	NA	A0A0R6PG08	Moraxella_phage	52.3	2.3e-93
WP_015235479.1|1626855_1627284_-	very short patch repair endonuclease	NA	V5UTF4	Oenococcus_phage	47.2	3.8e-23
WP_015235480.1|1627396_1627876_-	hypothetical protein	NA	NA	NA	NA	NA
WP_015235481.1|1629107_1629308_+	hypothetical protein	NA	NA	NA	NA	NA
1630438:1630463	attL	CAGCGCTTTATCAGACGCACTTTAGC	NA	NA	NA	NA
WP_157448803.1|1630698_1631208_+	hypothetical protein	NA	NA	NA	NA	NA
WP_015235483.1|1631259_1631622_-	hypothetical protein	NA	NA	NA	NA	NA
WP_015235484.1|1631618_1632803_-	ThiF family adenylyltransferase	NA	NA	NA	NA	NA
WP_015235485.1|1632777_1633059_-	multiubiquitin domain-containing protein	NA	NA	NA	NA	NA
WP_015235486.1|1633221_1633632_+	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_041230770.1|1633667_1634471_+	ImmA/IrrE family metallo-endopeptidase	NA	NA	NA	NA	NA
WP_015235489.1|1634733_1635924_-|integrase	site-specific integrase	integrase	A0A1B0T6A8	Bacillus_phage	29.3	7.8e-34
WP_015235490.1|1636102_1638430_-	DUF927 domain-containing protein	NA	NA	NA	NA	NA
WP_015235491.1|1638426_1639560_-|integrase	site-specific integrase	integrase	A0A1B0T6A8	Bacillus_phage	31.5	2.1e-36
WP_015235492.1|1640080_1640410_+	hypothetical protein	NA	NA	NA	NA	NA
WP_015235493.1|1640534_1640771_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_015235494.1|1641080_1642976_+	hypothetical protein	NA	NA	NA	NA	NA
WP_015235495.1|1643278_1644133_-	hypothetical protein	NA	NA	NA	NA	NA
WP_157448804.1|1644145_1644727_-	hypothetical protein	NA	NA	NA	NA	NA
WP_015235497.1|1644879_1645203_-	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_015235498.1|1645307_1646147_+	hypothetical protein	NA	NA	NA	NA	NA
WP_015235499.1|1646255_1646573_+	hypothetical protein	NA	NA	NA	NA	NA
WP_015235500.1|1647172_1647502_-	hypothetical protein	NA	NA	NA	NA	NA
WP_169316596.1|1647498_1657209_-	hypothetical protein	NA	NA	NA	NA	NA
WP_157448806.1|1657469_1658615_+	hypothetical protein	NA	NA	NA	NA	NA
WP_157448807.1|1658737_1660687_+	S8 family serine peptidase	NA	A0A217EQY2	Bacillus_phage	38.0	3.7e-25
WP_015235504.1|1660687_1661872_+	type II secretion system protein GspD	NA	R9TEZ5	Vibrio_phage	24.7	1.9e-11
WP_015235505.1|1661958_1662315_+	hypothetical protein	NA	NA	NA	NA	NA
WP_015235506.1|1662317_1663274_+	alpha/beta hydrolase	NA	NA	NA	NA	NA
WP_169316588.1|1663433_1663925_+	hypothetical protein	NA	NA	NA	NA	NA
WP_015235508.1|1664117_1665041_+	DUF3800 domain-containing protein	NA	NA	NA	NA	NA
WP_157448808.1|1665160_1665304_-	hypothetical protein	NA	NA	NA	NA	NA
WP_083865759.1|1665359_1665758_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_015235509.1|1665778_1668004_-	hypothetical protein	NA	NA	NA	NA	NA
WP_015235510.1|1668014_1669091_-	AAA family ATPase	NA	G3MAU6	Bacillus_virus	27.4	8.1e-22
WP_157448809.1|1670643_1670868_+	hypothetical protein	NA	NA	NA	NA	NA
WP_157448810.1|1670864_1670990_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_041230776.1|1671227_1671422_+	hypothetical protein	NA	NA	NA	NA	NA
WP_015235511.1|1671441_1673394_+	hypothetical protein	NA	NA	NA	NA	NA
WP_015235512.1|1673684_1675472_-	putative DNA binding domain-containing protein	NA	A0A1B3AYT3	Gordonia_phage	26.6	3.5e-14
WP_015235513.1|1675713_1676043_+	hypothetical protein	NA	NA	NA	NA	NA
WP_157448811.1|1676172_1676526_+	hypothetical protein	NA	NA	NA	NA	NA
WP_157448813.1|1677258_1677756_-|transposase	transposase	transposase	NA	NA	NA	NA
1679494:1679519	attR	CAGCGCTTTATCAGACGCACTTTAGC	NA	NA	NA	NA
>prophage 3
NC_019793	Deinococcus peraridilitoris DSM 19664, complete sequence	3881839	1960709	2005702	3881839	integrase,transposase,protease	Acinetobacter_phage(26.67%)	52	1993329:1993346	2007919:2007936
WP_015235764.1|1960709_1961831_-|protease	cysteine protease StiP family protein	protease	A0A172Q0S8	Acinetobacter_phage	32.6	4.4e-39
WP_015235765.1|1961817_1962582_-	hypothetical protein	NA	A0A172Q0Q4	Acinetobacter_phage	23.1	9.8e-06
WP_015235766.1|1962572_1963673_-	phosphoribosyltransferase domain-containing protein	NA	A0A172Q0Y1	Acinetobacter_phage	27.0	2.7e-12
WP_015235767.1|1963669_1964707_-	ATP-grasp domain-containing protein	NA	NA	NA	NA	NA
WP_015235768.1|1964950_1966057_-	DUF475 domain-containing protein	NA	A0A172Q0Y5	Acinetobacter_phage	44.0	2.0e-68
WP_015235769.1|1966126_1966702_-	TerD family protein	NA	K4JRX3	Caulobacter_phage	38.0	2.1e-29
WP_015235770.1|1966820_1967417_-	TerD family protein	NA	K4JRX3	Caulobacter_phage	30.2	2.5e-12
WP_157449000.1|1967749_1968457_-	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_157448827.1|1968516_1969608_-	hypothetical protein	NA	NA	NA	NA	NA
WP_015235773.1|1969782_1970223_-	hypothetical protein	NA	NA	NA	NA	NA
WP_015235774.1|1970468_1971026_-	DUF1802 family protein	NA	NA	NA	NA	NA
WP_015235775.1|1971172_1971472_+	type II toxin-antitoxin system prevent-host-death family antitoxin	NA	NA	NA	NA	NA
WP_052326674.1|1971464_1971899_+	PIN domain-containing protein	NA	NA	NA	NA	NA
WP_015235777.1|1972202_1973801_-	pilus assembly PilX N-terminal domain-containing protein	NA	NA	NA	NA	NA
WP_015235778.1|1973809_1974613_-	type II secretion system protein	NA	NA	NA	NA	NA
WP_015235779.1|1974609_1975047_-	type II secretion system protein	NA	NA	NA	NA	NA
WP_015235780.1|1975043_1975535_-	GspH/FimT family pseudopilin	NA	NA	NA	NA	NA
WP_041230670.1|1975892_1976411_-|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_157448751.1|1976446_1976854_-	winged helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_169316599.1|1977346_1978006_-|transposase	IS630 family transposase	transposase	A0A1V0SCG6	Indivirus	26.7	5.8e-15
WP_041230612.1|1977920_1978280_-	hypothetical protein	NA	NA	NA	NA	NA
WP_015235782.1|1979205_1979394_+	hypothetical protein	NA	NA	NA	NA	NA
WP_015235783.1|1979393_1980911_+	hypothetical protein	NA	NA	NA	NA	NA
WP_015235784.1|1980921_1981362_+	prepilin-type N-terminal cleavage/methylation domain-containing protein	NA	NA	NA	NA	NA
WP_015235785.1|1981406_1981865_+	type II secretion system protein	NA	NA	NA	NA	NA
WP_015235786.1|1981875_1982583_+	prepilin-type N-terminal cleavage/methylation domain-containing protein	NA	NA	NA	NA	NA
WP_015235787.1|1982744_1983110_-	hypothetical protein	NA	NA	NA	NA	NA
WP_015235788.1|1983587_1984208_+|protease	ATP-dependent Clp protease proteolytic subunit	protease	A0A223W000	Agrobacterium_phage	46.1	7.9e-46
WP_015235789.1|1984197_1985394_+|protease	ATP-dependent Clp protease ATP-binding subunit ClpX	protease	G3M9Z9	Bacillus_virus	54.5	2.5e-112
WP_015235790.1|1985632_1988026_+	endopeptidase La	NA	A0A0R6PGP8	Moraxella_phage	43.5	2.7e-174
WP_157448829.1|1988411_1988669_+	PIG-L family deacetylase	NA	NA	NA	NA	NA
WP_052326676.1|1988598_1989303_+	PIG-L family deacetylase	NA	NA	NA	NA	NA
WP_015235791.1|1989304_1989997_+	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_083865875.1|1990000_1990369_-	thioesterase family protein	NA	NA	NA	NA	NA
WP_015235793.1|1990542_1990758_-	hypothetical protein	NA	NA	NA	NA	NA
WP_015235794.1|1990928_1991423_+	hypothetical protein	NA	NA	NA	NA	NA
WP_015235795.1|1991414_1992245_-	5'-3' exonuclease	NA	NA	NA	NA	NA
WP_157448830.1|1992434_1993517_+	diguanylate cyclase	NA	A0A127AWB9	Bacillus_phage	31.2	2.4e-13
1993329:1993346	attL	GCGCGACGGGTCGCGCAG	NA	NA	NA	NA
WP_052326678.1|1994300_1994900_+	metal ABC transporter permease	NA	NA	NA	NA	NA
WP_015235797.1|1995045_1995513_-	response regulator	NA	NA	NA	NA	NA
WP_015235798.1|1995808_1996588_-	enoyl-CoA hydratase/isomerase family protein	NA	NA	NA	NA	NA
WP_015235799.1|1996709_1997378_-	response regulator transcription factor	NA	NA	NA	NA	NA
WP_015235800.1|1997519_1998554_-	response regulator	NA	W8CYM9	Bacillus_phage	32.5	1.7e-16
WP_015235801.1|1998770_1999079_+	30S ribosomal protein S6	NA	NA	NA	NA	NA
WP_015235802.1|1999225_2000092_+	single-stranded DNA-binding protein	NA	A0A059T5E0	Listeria_phage	52.4	3.7e-09
WP_015235803.1|2000143_2000407_+	30S ribosomal protein S18	NA	NA	NA	NA	NA
WP_015235804.1|2000403_2000847_+	50S ribosomal protein L9	NA	NA	NA	NA	NA
WP_015235805.1|2001014_2001764_+	metallophosphoesterase family protein	NA	NA	NA	NA	NA
WP_015235806.1|2001879_2003871_+	transketolase	NA	NA	NA	NA	NA
WP_015235807.1|2003946_2004603_+	guanylate kinase	NA	U5TH34	Cowpox_virus	33.2	6.6e-19
WP_015235808.1|2004604_2005126_+	macro domain-containing protein	NA	A0A0K1L687	Scale_drop_disease_virus	45.0	4.2e-24
WP_015235809.1|2005138_2005702_-|integrase	site-specific integrase	integrase	NA	NA	NA	NA
2007919:2007936	attR	CTGCGCGACCCGTCGCGC	NA	NA	NA	NA
>prophage 4
NC_019793	Deinococcus peraridilitoris DSM 19664, complete sequence	3881839	2111843	2164371	3881839	transposase,protease,tail	Bacillus_phage(20.0%)	47	NA	NA
WP_015235927.1|2111843_2113427_+|tail	phage tail sheath family protein	tail	J9PVC2	Bacillus_phage	34.2	3.1e-70
WP_015235928.1|2113555_2113999_+|tail	phage tail protein	tail	NA	NA	NA	NA
WP_157449003.1|2114206_2114572_+	hypothetical protein	NA	NA	NA	NA	NA
WP_015235930.1|2114568_2114742_+	hypothetical protein	NA	NA	NA	NA	NA
WP_015235931.1|2114914_2115373_+|tail	phage tail protein	tail	NA	NA	NA	NA
WP_041230833.1|2116496_2119136_+	DUF4157 domain-containing protein	NA	NA	NA	NA	NA
WP_015235933.1|2119201_2119522_-	hypothetical protein	NA	NA	NA	NA	NA
WP_015235934.1|2119533_2119743_-	hypothetical protein	NA	NA	NA	NA	NA
WP_015235935.1|2119903_2120326_+	response regulator	NA	NA	NA	NA	NA
WP_015235936.1|2120425_2120845_+	hypothetical protein	NA	NA	NA	NA	NA
WP_015235937.1|2120954_2121338_+	hypothetical protein	NA	NA	NA	NA	NA
WP_015235938.1|2121387_2123031_-	RecQ family ATP-dependent DNA helicase	NA	F2NZ48	Diadromus_pulchellus_ascovirus	41.7	2.1e-61
WP_015235939.1|2123228_2123666_-	SufE family protein	NA	NA	NA	NA	NA
WP_015235940.1|2123817_2124678_+	sulfurtransferase	NA	NA	NA	NA	NA
WP_015235941.1|2124729_2125722_-	metallophosphoesterase	NA	NA	NA	NA	NA
WP_015235942.1|2125916_2126375_-	MarR family transcriptional regulator	NA	NA	NA	NA	NA
WP_015235943.1|2126679_2126964_+	hypothetical protein	NA	NA	NA	NA	NA
WP_015235944.1|2127253_2127469_-	hypothetical protein	NA	NA	NA	NA	NA
WP_015235945.1|2127561_2128713_-	type IV pilus twitching motility protein PilT	NA	NA	NA	NA	NA
WP_015235946.1|2128763_2131430_-	Flp pilus assembly complex ATPase component TadA	NA	NA	NA	NA	NA
WP_015235947.1|2131481_2131988_-	YqeG family HAD IIIA-type phosphatase	NA	NA	NA	NA	NA
WP_015235948.1|2132043_2132805_-	peptidoglycan editing factor PgeF	NA	NA	NA	NA	NA
WP_015235949.1|2132943_2133726_+	enoyl-ACP reductase	NA	NA	NA	NA	NA
WP_083865793.1|2133842_2133980_-	hypothetical protein	NA	NA	NA	NA	NA
WP_015235950.1|2134116_2136999_+	PAS domain S-box protein	NA	A0A2K9L5I4	Tupanvirus	22.0	4.4e-06
WP_015235951.1|2137192_2137393_-	hypothetical protein	NA	NA	NA	NA	NA
WP_015231360.1|2138248_2139349_+|transposase	IS4 family transposase	transposase	NA	NA	NA	NA
WP_015231253.1|2139672_2140773_+|transposase	IS4 family transposase	transposase	NA	NA	NA	NA
WP_015235953.1|2141030_2141201_-	hypothetical protein	NA	NA	NA	NA	NA
WP_052326685.1|2141424_2142330_+	ChbG/HpnK family deacetylase	NA	NA	NA	NA	NA
WP_041230836.1|2143312_2143558_-	AAC(3) family N-acetyltransferase	NA	NA	NA	NA	NA
WP_015235955.1|2143727_2144687_-	ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_015235956.1|2144683_2145448_-	ABC transporter ATP-binding protein	NA	G3M9Y6	Bacillus_virus	34.5	2.2e-29
WP_041230837.1|2145444_2146200_-	ABC transporter permease subunit	NA	NA	NA	NA	NA
WP_015235958.1|2146313_2146628_+	DsrE family protein	NA	NA	NA	NA	NA
WP_015235959.1|2146965_2147871_-	YegS/Rv2252/BmrU family lipid kinase	NA	A0A1V0SBJ0	Catovirus	23.6	5.0e-09
WP_015235960.1|2147950_2148817_+	SDR family NAD(P)-dependent oxidoreductase	NA	NA	NA	NA	NA
WP_015235961.1|2148813_2150358_+	AMP-binding protein	NA	NA	NA	NA	NA
WP_015235962.1|2150529_2153637_+	hypothetical protein	NA	NA	NA	NA	NA
WP_015235963.1|2153753_2154434_-	hypothetical protein	NA	NA	NA	NA	NA
WP_083865794.1|2154630_2154885_+	zinc ribbon domain-containing protein	NA	NA	NA	NA	NA
WP_015235964.1|2155143_2156934_-	hypothetical protein	NA	NA	NA	NA	NA
WP_015235965.1|2156930_2159819_-	PQQ-binding-like beta-propeller repeat protein	NA	NA	NA	NA	NA
WP_015235966.1|2159815_2161168_-	hypothetical protein	NA	NA	NA	NA	NA
WP_015235967.1|2161295_2162939_-	trypsin-like peptidase domain-containing protein	NA	NA	NA	NA	NA
WP_169316601.1|2162947_2163532_-	hypothetical protein	NA	NA	NA	NA	NA
WP_015235969.1|2163540_2164371_-|protease	PrsW family intramembrane metalloprotease	protease	NA	NA	NA	NA
>prophage 1
NC_019789	Deinococcus peraridilitoris DSM 19664 plasmid pDEIPE01, complete sequence	556630	86354	108408	556630	transposase,integrase	Rhodococcus_phage(50.0%)	22	89191:89205	112041:112055
WP_157449092.1|86354_86744_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_083865900.1|86841_87180_-|transposase	transposase family protein	transposase	NA	NA	NA	NA
WP_015231234.1|87440_88505_+|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_052326828.1|88885_89947_-	aminopeptidase P family N-terminal domain-containing protein	NA	NA	NA	NA	NA
89191:89205	attL	CTTCGAGCGTGCCGC	NA	NA	NA	NA
WP_015231236.1|89943_91368_-	NAD-dependent succinate-semialdehyde dehydrogenase	NA	NA	NA	NA	NA
WP_015231237.1|91364_92048_-	GntR family transcriptional regulator	NA	NA	NA	NA	NA
WP_015231238.1|92179_93421_+	ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_041231774.1|93478_94375_+	sugar ABC transporter permease	NA	NA	NA	NA	NA
WP_015231240.1|94371_95289_+	carbohydrate ABC transporter permease	NA	NA	NA	NA	NA
WP_015231241.1|95285_96590_+	L-fucose isomerase	NA	NA	NA	NA	NA
WP_157449093.1|96586_97465_+	sugar kinase	NA	NA	NA	NA	NA
WP_015231243.1|97436_98468_+	tagatose 1,6-diphosphate aldolase	NA	NA	NA	NA	NA
WP_015231244.1|98481_100668_+	alpha-xylosidase	NA	NA	NA	NA	NA
WP_015231245.1|100686_101607_+	AEC family transporter	NA	NA	NA	NA	NA
WP_015231246.1|101755_102550_-|transposase	IS5 family transposase	transposase	NA	NA	NA	NA
WP_015231247.1|102982_103243_+	AbrB/MazE/SpoVT family DNA-binding domain-containing protein	NA	NA	NA	NA	NA
WP_015231248.1|103239_103647_+	PIN domain-containing protein	NA	NA	NA	NA	NA
WP_157449139.1|104190_104835_+|integrase	tyrosine-type recombinase/integrase	integrase	D4P765	Rhodococcus_phage	32.7	1.4e-08
WP_015231250.1|104930_105215_-	hypothetical protein	NA	NA	NA	NA	NA
WP_052326829.1|105388_106012_-	AAA family ATPase	NA	A0A2P1A2G0	Mycobacterium_phage	32.6	4.1e-10
WP_041231778.1|106308_106713_-	hypothetical protein	NA	NA	NA	NA	NA
WP_015231253.1|107307_108408_-|transposase	IS4 family transposase	transposase	NA	NA	NA	NA
112041:112055	attR	CTTCGAGCGTGCCGC	NA	NA	NA	NA
>prophage 2
NC_019789	Deinococcus peraridilitoris DSM 19664 plasmid pDEIPE01, complete sequence	556630	114926	177126	556630	transposase	Mycobacterium_phage(14.29%)	57	NA	NA
WP_157449095.1|114926_115247_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_015231259.1|116313_116976_+	hypothetical protein	NA	NA	NA	NA	NA
WP_015231260.1|117206_118190_+|transposase	IS110 family transposase	transposase	A0A1S7J231	Thermus_phage	33.2	9.6e-22
WP_015231261.1|118363_119140_-|transposase	IS4 family transposase	transposase	NA	NA	NA	NA
WP_041231780.1|119160_119358_+	hypothetical protein	NA	NA	NA	NA	NA
WP_015231262.1|119377_120034_-|transposase	IS3 family transposase	transposase	A0A1B1P773	Bacillus_phage	36.4	4.2e-05
WP_015231265.1|122226_123129_-	proline iminopeptidase-family hydrolase	NA	NA	NA	NA	NA
WP_157449140.1|123342_124107_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_015231267.1|124160_125666_+	ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_015231268.1|125675_126599_+	ABC transporter permease	NA	NA	NA	NA	NA
WP_015231269.1|126600_127461_+	ABC transporter permease	NA	NA	NA	NA	NA
WP_015231270.1|127460_129410_+	zinc carboxypeptidase	NA	NA	NA	NA	NA
WP_157449096.1|129630_130278_+	5-oxoprolinase subunit PxpB	NA	NA	NA	NA	NA
WP_015231272.1|130271_131294_+	biotin-dependent carboxyltransferase	NA	NA	NA	NA	NA
WP_015231273.1|131290_132058_+	LamB/YcsF family protein	NA	NA	NA	NA	NA
WP_041231895.1|132338_133763_+	DEAD/DEAH box helicase family protein	NA	A0A2I5ARD8	Synechococcus_phage	26.2	5.1e-16
WP_015231275.1|133762_135001_+	DUF790 family protein	NA	NA	NA	NA	NA
WP_015231277.1|135424_137473_+	type I DNA topoisomerase	NA	A0A2K9L5F8	Tupanvirus	35.9	1.1e-83
WP_015231278.1|137703_139095_-	serine hydrolase	NA	G1DB24	Mycobacterium_phage	28.8	7.2e-15
WP_015231279.1|140188_140587_-	hypothetical protein	NA	NA	NA	NA	NA
WP_015231280.1|140573_140966_-	nuclear transport factor 2 family protein	NA	NA	NA	NA	NA
WP_041231898.1|141088_141901_+	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_015231282.1|141956_142211_+	DUF3006 domain-containing protein	NA	NA	NA	NA	NA
WP_015231283.1|142207_143200_+	excalibur calcium-binding domain-containing protein	NA	Q0H255	Geobacillus_phage	32.7	8.2e-29
WP_041231899.1|144003_144798_+	nucleotidyltransferase domain-containing protein	NA	NA	NA	NA	NA
WP_015231286.1|144921_145059_-	hypothetical protein	NA	NA	NA	NA	NA
WP_015231287.1|145036_145543_-	hypothetical protein	NA	NA	NA	NA	NA
WP_015231288.1|145539_146037_-	GIY-YIG nuclease family protein	NA	NA	NA	NA	NA
WP_015231289.1|146233_146989_-	hypothetical protein	NA	A0A1X9SGN6	Bradyrhizobium_phage	42.6	3.3e-22
WP_015231290.1|147218_147437_+	hypothetical protein	NA	NA	NA	NA	NA
WP_169316626.1|147505_151411_-	UvrD-helicase domain-containing protein	NA	Q9DSV4	Diadromus_pulchellus_ascovirus	31.3	1.9e-20
WP_169316627.1|151422_151875_-	hypothetical protein	NA	NA	NA	NA	NA
WP_052326834.1|152807_153089_-|transposase	transposase	transposase	U5P429	Shigella_phage	42.0	7.5e-12
WP_052326835.1|153987_154620_-|transposase	IS3 family transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	37.6	4.7e-30
WP_015231291.1|154597_154912_-|transposase	transposase	transposase	A9YX41	Burkholderia_phage	38.5	3.4e-05
WP_157449097.1|155261_155696_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_041231787.1|155873_156353_-	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_015231293.1|157529_157847_+	hypothetical protein	NA	NA	NA	NA	NA
WP_015231294.1|157908_159534_+|transposase	ISL3 family transposase	transposase	NA	NA	NA	NA
WP_015231295.1|159522_160158_-	plasmid pRiA4b ORF-3 family protein	NA	A0A2H4PDG5	Mycobacterium_phage	39.3	4.7e-30
WP_157449142.1|160111_160699_+	hypothetical protein	NA	NA	NA	NA	NA
WP_083865905.1|161067_161838_-|transposase	IS5 family transposase	transposase	A0A0N9SHJ4	Paenibacillus_phage	44.0	1.4e-20
WP_015231298.1|161981_162362_-	hypothetical protein	NA	NA	NA	NA	NA
WP_015231299.1|162404_163700_-|transposase	IS701 family transposase	transposase	NA	NA	NA	NA
WP_015231300.1|164354_165221_-	serine hydrolase	NA	NA	NA	NA	NA
WP_015231301.1|165270_166086_-	MurR/RpiR family transcriptional regulator	NA	NA	NA	NA	NA
WP_015231302.1|166239_167289_-	dipeptide epimerase	NA	NA	NA	NA	NA
WP_015231303.1|167285_168188_-	C40 family peptidase	NA	A0A2P0ZLG0	Lactobacillus_phage	29.6	1.0e-06
WP_015231304.1|168184_169294_-	M20/M25/M40 family metallo-hydrolase	NA	NA	NA	NA	NA
WP_015231305.1|169300_170170_-	ABC transporter permease	NA	NA	NA	NA	NA
WP_015231306.1|170166_171084_-	ABC transporter permease	NA	NA	NA	NA	NA
WP_015231307.1|171080_172670_-	ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_157449098.1|172845_173052_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_041231789.1|173048_174233_+|transposase	IS701 family transposase	transposase	NA	NA	NA	NA
WP_015231308.1|174444_175014_+	helix-turn-helix domain containing protein	NA	NA	NA	NA	NA
WP_083865778.1|175010_175577_+|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_015231310.1|176025_177126_+|transposase	IS4 family transposase	transposase	NA	NA	NA	NA
>prophage 3
NC_019789	Deinococcus peraridilitoris DSM 19664 plasmid pDEIPE01, complete sequence	556630	189600	242565	556630	transposase	Leptospira_phage(20.0%)	42	NA	NA
WP_083865908.1|189600_189984_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_157449101.1|191178_191316_-	hypothetical protein	NA	NA	NA	NA	NA
WP_041231796.1|191933_192842_+	radical SAM protein	NA	NA	NA	NA	NA
WP_015231331.1|192838_193270_+	hypothetical protein	NA	NA	NA	NA	NA
WP_157449143.1|193239_194190_-|transposase	IS3 family transposase	transposase	S5WIU1	Leptospira_phage	32.3	3.2e-30
WP_015231333.1|194087_194357_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_052326841.1|194460_195135_+	Fic family protein	NA	NA	NA	NA	NA
WP_157449144.1|195114_195297_-	hypothetical protein	NA	NA	NA	NA	NA
WP_015231335.1|195948_197793_-	discoidin domain-containing protein	NA	NA	NA	NA	NA
WP_015231336.1|198400_199573_-	diaminopropionate ammonia-lyase	NA	NA	NA	NA	NA
WP_015231337.1|199590_200727_-	ArgE/DapE family deacylase	NA	NA	NA	NA	NA
WP_041230670.1|201056_201575_-|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_157448751.1|201610_202018_-	winged helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_015231339.1|202564_203950_-	class I SAM-dependent methyltransferase	NA	A0A2K9L0U7	Tupanvirus	34.1	2.1e-38
WP_052326878.1|204639_205842_-	membrane dipeptidase	NA	NA	NA	NA	NA
WP_015231342.1|206033_206882_-	ABC transporter permease	NA	NA	NA	NA	NA
WP_157449145.1|206883_207843_-	ABC transporter permease subunit	NA	NA	NA	NA	NA
WP_015231344.1|207843_209382_-	peptide ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_015231345.1|209416_211165_-	M28 family peptidase	NA	NA	NA	NA	NA
WP_015231346.1|211236_212016_+	IclR family transcriptional regulator	NA	NA	NA	NA	NA
WP_015231347.1|212694_213432_+	DUF1028 domain-containing protein	NA	NA	NA	NA	NA
WP_015231348.1|213494_215012_+	peptide ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_015231349.1|215024_215969_+	ABC transporter permease	NA	NA	NA	NA	NA
WP_015231350.1|215965_216829_+	ABC transporter permease	NA	NA	NA	NA	NA
WP_015231351.1|216877_218911_+	S9 family peptidase	NA	NA	NA	NA	NA
WP_015231352.1|219469_220735_-	FAD-binding protein	NA	NA	NA	NA	NA
WP_015231353.1|220904_222059_-	MFS transporter	NA	NA	NA	NA	NA
WP_083865911.1|222433_222703_-	HNH endonuclease	NA	A0A2I7QIM4	Bacillus_phage	60.5	1.3e-08
WP_157449102.1|222749_222878_+|transposase	Tn3 family transposase	transposase	NA	NA	NA	NA
WP_041231798.1|222908_223118_+|transposase	Tn3 family transposase	transposase	A0A1B0V7H9	Salmonella_phage	54.2	2.0e-09
WP_015231354.1|223241_224225_+	aldo/keto reductase	NA	NA	NA	NA	NA
WP_015231355.1|224661_225615_-	secreted hydrolase	NA	NA	NA	NA	NA
WP_015231356.1|225792_227808_+	DUF4158 domain-containing protein	NA	Q1MVP5	Enterobacteria_phage	35.2	2.0e-98
WP_041231799.1|230956_231928_+	hypothetical protein	NA	NA	NA	NA	NA
WP_015231357.1|232337_232823_-	hypothetical protein	NA	NA	NA	NA	NA
WP_041231800.1|233005_233338_+	hypothetical protein	NA	NA	NA	NA	NA
WP_015231360.1|237539_238640_+|transposase	IS4 family transposase	transposase	NA	NA	NA	NA
WP_083865935.1|238650_238986_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_041231925.1|239000_239411_-|transposase	transposase family protein	transposase	NA	NA	NA	NA
WP_015231361.1|239887_240274_-	hypothetical protein	NA	NA	NA	NA	NA
WP_041231803.1|240286_241879_-	hypothetical protein	NA	NA	NA	NA	NA
WP_041231804.1|242097_242565_+|transposase	IS1182 family transposase	transposase	NA	NA	NA	NA
>prophage 4
NC_019789	Deinococcus peraridilitoris DSM 19664 plasmid pDEIPE01, complete sequence	556630	272231	301432	556630	integrase,transposase	Salmonella_phage(16.67%)	22	283544:283559	310042:310057
WP_041231808.1|272231_272561_+|integrase	tyrosine-type recombinase/integrase	integrase	NA	NA	NA	NA
WP_157449106.1|272679_273615_-|transposase	Tn3 family transposase	transposase	A0A1B0V7H9	Salmonella_phage	34.2	1.6e-34
WP_157449107.1|274315_275350_-	DUF4158 domain-containing protein	NA	NA	NA	NA	NA
WP_052326853.1|275369_275669_-	DUF4158 domain-containing protein	NA	NA	NA	NA	NA
WP_015231386.1|276725_280064_+	GAF domain-containing protein	NA	NA	NA	NA	NA
WP_015231388.1|280146_280524_+	response regulator	NA	NA	NA	NA	NA
WP_157449108.1|280604_280925_-|transposase	transposase	transposase	NA	NA	NA	NA
283544:283559	attL	CGAGCAGCTGGTCGAG	NA	NA	NA	NA
WP_015231390.1|284580_285522_+|integrase	site-specific integrase	integrase	W8EHC2	Mycobacterium_phage	26.4	2.7e-05
WP_052326854.1|285740_285938_+	hypothetical protein	NA	NA	NA	NA	NA
WP_083865918.1|285915_286266_+	RtcB family protein	NA	NA	NA	NA	NA
WP_015231392.1|286724_287519_-|transposase	IS5 family transposase	transposase	A0A0N9SHJ4	Paenibacillus_phage	44.2	7.5e-25
WP_015231393.1|287894_288206_+	hypothetical protein	NA	NA	NA	NA	NA
WP_157449147.1|288307_289387_+	ABC transporter permease	NA	NA	NA	NA	NA
WP_015231395.1|289579_289972_-	type II toxin-antitoxin system VapC family toxin	NA	NA	NA	NA	NA
WP_015231396.1|289968_290220_-	AbrB/MazE/SpoVT family DNA-binding domain-containing protein	NA	NA	NA	NA	NA
WP_157449148.1|290535_291534_+|integrase	tyrosine-type recombinase/integrase	integrase	S5M9V8	Brevibacillus_phage	25.3	2.3e-07
WP_015231399.1|292162_292537_-	hypothetical protein	NA	NA	NA	NA	NA
WP_052326856.1|292948_295207_+	bifunctional diguanylate cyclase/phosphodiesterase	NA	NA	NA	NA	NA
WP_015231401.1|295887_298026_+	cadmium-translocating P-type ATPase	NA	E4ZFI9	Streptococcus_phage	40.0	7.5e-128
WP_041231810.1|298069_298450_+	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_015231403.1|298689_299781_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_015231405.1|300268_301432_+|integrase	site-specific integrase	integrase	A0A1B0T6A8	Bacillus_phage	28.0	8.1e-36
310042:310057	attR	CTCGACCAGCTGCTCG	NA	NA	NA	NA
>prophage 5
NC_019789	Deinococcus peraridilitoris DSM 19664 plasmid pDEIPE01, complete sequence	556630	410455	453282	556630	transposase	Bacillus_phage(50.0%)	30	NA	NA
WP_015231499.1|410455_411310_-|transposase	IS256 family transposase	transposase	A0A218MND5	uncultured_virus	56.5	7.1e-05
WP_015231500.1|411402_411876_+	hypothetical protein	NA	NA	NA	NA	NA
WP_015231501.1|412711_412993_+	HNH endonuclease	NA	A0A2I7QIM4	Bacillus_phage	62.8	1.7e-08
WP_015231502.1|413027_414653_+	MBL fold metallo-hydrolase	NA	NA	NA	NA	NA
WP_157449120.1|414686_414830_+	hypothetical protein	NA	NA	NA	NA	NA
WP_041231832.1|415109_415523_-	hypothetical protein	NA	NA	NA	NA	NA
WP_157449121.1|416141_418175_+	tetratricopeptide repeat protein	NA	NA	NA	NA	NA
WP_015231506.1|419730_422550_-	PAS domain S-box protein	NA	W8CYF6	Bacillus_phage	27.0	1.9e-14
WP_015231507.1|423429_424143_+|transposase	IS1 transposase	transposase	NA	NA	NA	NA
WP_083865923.1|424135_424624_+	GGDEF domain-containing protein	NA	A0A127AWB9	Bacillus_phage	36.3	1.2e-12
WP_015231508.1|424660_425110_-	response regulator	NA	NA	NA	NA	NA
WP_157449122.1|425514_425679_+	hypothetical protein	NA	NA	NA	NA	NA
WP_052326866.1|425890_426403_-	ATP-binding protein	NA	Q8QKW6	Ectocarpus_siliculosus_virus	34.2	2.9e-06
WP_157449123.1|426399_426672_-	hypothetical protein	NA	NA	NA	NA	NA
WP_169316629.1|426656_426932_-	hypothetical protein	NA	NA	NA	NA	NA
WP_041231835.1|426928_427561_-	PAS domain-containing protein	NA	NA	NA	NA	NA
WP_083865924.1|427781_428567_+|transposase	IS5 family transposase	transposase	NA	NA	NA	NA
WP_015231509.1|429359_430286_+	hypothetical protein	NA	NA	NA	NA	NA
WP_015231510.1|430708_433459_+	GAF domain-containing protein	NA	NA	NA	NA	NA
WP_015231511.1|433455_433911_+	response regulator	NA	NA	NA	NA	NA
WP_157449124.1|433907_434270_+	response regulator	NA	NA	NA	NA	NA
WP_015231513.1|434411_434714_+	hypothetical protein	NA	NA	NA	NA	NA
WP_015231514.1|434830_436471_-	PAS domain-containing protein	NA	NA	NA	NA	NA
WP_157449125.1|436996_437494_+	hypothetical protein	NA	NA	NA	NA	NA
WP_015231260.1|438765_439749_+|transposase	IS110 family transposase	transposase	A0A1S7J231	Thermus_phage	33.2	9.6e-22
WP_015231519.1|440307_442212_-	hypothetical protein	NA	NA	NA	NA	NA
WP_041231837.1|443991_444333_-	hypothetical protein	NA	NA	NA	NA	NA
WP_157449126.1|450531_451323_-	phosphatase PAP2 family protein	NA	NA	NA	NA	NA
WP_157449127.1|451640_452171_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_083865925.1|452508_453282_-|transposase	ISL3 family transposase	transposase	NA	NA	NA	NA
>prophage 1
NC_019790	Deinococcus peraridilitoris DSM 19664 plasmid pDEIPE02, complete sequence	75245	17626	58872	75245	transposase	Bacillus_virus(12.5%)	42	NA	NA
WP_083865941.1|17626_18622_-|transposase	IS4 family transposase	transposase	NA	NA	NA	NA
WP_015231471.1|19049_19697_+	HAD hydrolase-like protein	NA	NA	NA	NA	NA
WP_157449174.1|19806_20022_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_157449184.1|20535_20877_-	hypothetical protein	NA	NA	NA	NA	NA
WP_015231645.1|21723_23229_+	diguanylate cyclase	NA	G3MA91	Bacillus_virus	41.0	8.7e-14
WP_157449175.1|23385_23757_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_083865938.1|24290_25097_-|transposase	ISL3 family transposase	transposase	NA	NA	NA	NA
WP_041232012.1|25366_25948_+	SMI1/KNR4 family protein	NA	NA	NA	NA	NA
WP_015231647.1|26320_26890_-	dihydrofolate reductase	NA	NA	NA	NA	NA
WP_041231996.1|26951_27533_+	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_015231649.1|27638_28535_+	phosphotransferase	NA	NA	NA	NA	NA
WP_041232014.1|28765_29575_-	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_015231651.1|30124_33286_+	GAF domain-containing protein	NA	W8CYF6	Bacillus_phage	27.8	5.3e-13
WP_015231652.1|33282_33765_+	response regulator	NA	NA	NA	NA	NA
WP_083865939.1|33756_34008_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_015231653.1|34013_36578_-	PAS domain-containing protein	NA	A0A1V0SGX0	Hokovirus	25.8	2.6e-10
WP_015231654.1|36574_37192_-	recombinase family protein	NA	W6CWV1	Ralstonia_phage	45.0	2.3e-37
WP_157449176.1|37446_38274_-|transposase	IS3 family transposase	transposase	S5WIU1	Leptospira_phage	32.0	8.1e-30
WP_015231656.1|38294_38564_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_041231997.1|39299_40436_-	Fic family protein	NA	NA	NA	NA	NA
WP_157449177.1|40728_41433_-	recombinase family protein	NA	A0A1B1IWV2	uncultured_Mediterranean_phage	42.6	1.3e-31
WP_015231660.1|41736_41997_+	AbrB/MazE/SpoVT family DNA-binding domain-containing protein	NA	NA	NA	NA	NA
WP_015231661.1|41993_42401_+	PIN domain-containing protein	NA	NA	NA	NA	NA
WP_015231662.1|42593_43226_+	ParA family protein	NA	NA	NA	NA	NA
WP_157449178.1|43326_43485_+	hypothetical protein	NA	NA	NA	NA	NA
WP_157449179.1|44381_45116_+	hypothetical protein	NA	NA	NA	NA	NA
WP_015231308.1|45272_45842_+	helix-turn-helix domain containing protein	NA	NA	NA	NA	NA
WP_083865778.1|45838_46405_+|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_015231665.1|46552_48325_+	ParB N-terminal domain-containing protein	NA	NA	NA	NA	NA
WP_157449185.1|48387_48747_+	hypothetical protein	NA	NA	NA	NA	NA
WP_015231667.1|48854_49889_+	bifunctional DNA primase/polymerase	NA	A0A173H0P8	Pseudoalteromonas_phage	32.1	1.7e-05
WP_015231668.1|49986_50214_+	hypothetical protein	NA	NA	NA	NA	NA
WP_157449180.1|50455_50857_+	hypothetical protein	NA	NA	NA	NA	NA
WP_157449181.1|51080_51335_+	hypothetical protein	NA	NA	NA	NA	NA
WP_015231672.1|52181_52643_+	hypothetical protein	NA	NA	NA	NA	NA
WP_015231673.1|53364_53853_+	DnaJ domain-containing protein	NA	I6WMN0	Aeromonas_phage	45.0	9.0e-05
WP_015231675.1|54040_54214_+	hypothetical protein	NA	NA	NA	NA	NA
WP_015231676.1|54210_54726_+	hypothetical protein	NA	NA	NA	NA	NA
WP_015231678.1|55896_56325_+	TIR domain-containing protein	NA	NA	NA	NA	NA
WP_015231360.1|56269_57370_-|transposase	IS4 family transposase	transposase	NA	NA	NA	NA
WP_015231679.1|57397_57667_-	HD domain-containing protein	NA	NA	NA	NA	NA
WP_015231680.1|57855_58872_+|transposase	IS4 family transposase	transposase	NA	NA	NA	NA
